ID: 926171657

View in Genome Browser
Species Human (GRCh38)
Location 2:10556497-10556519
Sequence GTGATGAGAGGCCTGAGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926171646_926171657 14 Left 926171646 2:10556460-10556482 CCTGACGTCACGCTCTGCCCATC No data
Right 926171657 2:10556497-10556519 GTGATGAGAGGCCTGAGTTGAGG No data
926171642_926171657 25 Left 926171642 2:10556449-10556471 CCCCCATGGTGCCTGACGTCACG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 926171657 2:10556497-10556519 GTGATGAGAGGCCTGAGTTGAGG No data
926171650_926171657 -3 Left 926171650 2:10556477-10556499 CCCATCCCAGGCCTCCATGGGTG No data
Right 926171657 2:10556497-10556519 GTGATGAGAGGCCTGAGTTGAGG No data
926171644_926171657 23 Left 926171644 2:10556451-10556473 CCCATGGTGCCTGACGTCACGCT No data
Right 926171657 2:10556497-10556519 GTGATGAGAGGCCTGAGTTGAGG No data
926171643_926171657 24 Left 926171643 2:10556450-10556472 CCCCATGGTGCCTGACGTCACGC No data
Right 926171657 2:10556497-10556519 GTGATGAGAGGCCTGAGTTGAGG No data
926171651_926171657 -4 Left 926171651 2:10556478-10556500 CCATCCCAGGCCTCCATGGGTGA No data
Right 926171657 2:10556497-10556519 GTGATGAGAGGCCTGAGTTGAGG No data
926171641_926171657 26 Left 926171641 2:10556448-10556470 CCCCCCATGGTGCCTGACGTCAC No data
Right 926171657 2:10556497-10556519 GTGATGAGAGGCCTGAGTTGAGG No data
926171652_926171657 -8 Left 926171652 2:10556482-10556504 CCCAGGCCTCCATGGGTGATGAG No data
Right 926171657 2:10556497-10556519 GTGATGAGAGGCCTGAGTTGAGG No data
926171645_926171657 22 Left 926171645 2:10556452-10556474 CCATGGTGCCTGACGTCACGCTC No data
Right 926171657 2:10556497-10556519 GTGATGAGAGGCCTGAGTTGAGG No data
926171653_926171657 -9 Left 926171653 2:10556483-10556505 CCAGGCCTCCATGGGTGATGAGA No data
Right 926171657 2:10556497-10556519 GTGATGAGAGGCCTGAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926171657 Original CRISPR GTGATGAGAGGCCTGAGTTG AGG Intergenic