ID: 926174633

View in Genome Browser
Species Human (GRCh38)
Location 2:10579645-10579667
Sequence GAATGACATGAACAGGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 250}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926174633_926174637 27 Left 926174633 2:10579645-10579667 CCCTCAACCTGTTCATGTCATTC 0: 1
1: 0
2: 3
3: 15
4: 250
Right 926174637 2:10579695-10579717 TCTGAGGTTTCAAAGTTAACAGG 0: 1
1: 0
2: 3
3: 13
4: 204
926174633_926174636 11 Left 926174633 2:10579645-10579667 CCCTCAACCTGTTCATGTCATTC 0: 1
1: 0
2: 3
3: 15
4: 250
Right 926174636 2:10579679-10579701 TTTCATAGCTATAAACTCTGAGG 0: 1
1: 0
2: 1
3: 22
4: 248
926174633_926174638 28 Left 926174633 2:10579645-10579667 CCCTCAACCTGTTCATGTCATTC 0: 1
1: 0
2: 3
3: 15
4: 250
Right 926174638 2:10579696-10579718 CTGAGGTTTCAAAGTTAACAGGG 0: 1
1: 0
2: 0
3: 10
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926174633 Original CRISPR GAATGACATGAACAGGTTGA GGG (reversed) Intronic
901103793 1:6739670-6739692 GAACTACATGAGCAGGATGAAGG - Intergenic
902751517 1:18515247-18515269 GAATGCCATGAACAGGTGCATGG + Intergenic
906680129 1:47720550-47720572 GAAGGAAATAAAGAGGTTGAGGG - Intergenic
907378621 1:54065982-54066004 GAATTGCTTGAACAGGTTGGGGG + Intronic
908748115 1:67395285-67395307 GAAAGAAAGAAACAGGTTGAAGG + Intronic
909027848 1:70503828-70503850 GAAGGACGAGAAAAGGTTGATGG - Intergenic
910217440 1:84856343-84856365 GAGTGAAATGAACAGATTGTTGG - Intronic
910262246 1:85303908-85303930 AAATGACATGAACAGTTTATAGG - Intergenic
913406296 1:118495764-118495786 GTTTGACATGAACACGGTGAAGG + Intergenic
914562580 1:148835426-148835448 GAATGACTTTGACAAGTTGAGGG - Intronic
914610250 1:149294796-149294818 GAATGACTTTGACAAGTTGAGGG + Intergenic
915104592 1:153525752-153525774 CAATGACCTGGGCAGGTTGAAGG - Intergenic
915974193 1:160374425-160374447 GAATGACATAAGCAGCATGAAGG + Intergenic
916216251 1:162397612-162397634 GAATGGGAGGAAGAGGTTGATGG + Intronic
916301511 1:163280378-163280400 AAATCACATCAACAGGATGAAGG + Intronic
917372449 1:174309625-174309647 GCATCACATGAACAGAATGAAGG - Intronic
917930370 1:179818531-179818553 GAGTGACATGGACAGGTTTTGGG - Intergenic
917970644 1:180204511-180204533 GAAAGGCCTGAACAGGTTCAAGG + Intergenic
919787198 1:201266632-201266654 GAATGAGATGAAGAGATTGCAGG - Intergenic
920796758 1:209145237-209145259 GAATGACATGATTAGGTTAAAGG + Intergenic
923119289 1:230976126-230976148 GATTGATATGAACAGGTTTGTGG + Intronic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1064142379 10:12801394-12801416 GAATGAGATGGACAGATGGATGG - Intronic
1064380206 10:14835063-14835085 GCATGACAGTAACAGGTTTAGGG + Intronic
1065812773 10:29457758-29457780 AAATAACATGAAAAGGTAGATGG - Intronic
1068852636 10:61761469-61761491 TAATTACATGAACATGGTGATGG + Intronic
1071890161 10:89996136-89996158 AAATGACATCAAATGGTTGAAGG - Intergenic
1074843638 10:117377362-117377384 GAATGTTATGAATAGGTTTACGG - Intergenic
1077290352 11:1786974-1786996 AAATGCCATGAACAGTTAGATGG - Intergenic
1079377081 11:19903123-19903145 TAATGAAATGCACACGTTGATGG - Intronic
1079514570 11:21251742-21251764 CAATGACATGAGGAGGTTCAAGG + Intronic
1079691612 11:23425407-23425429 CAATTACATGACCAGTTTGATGG + Intergenic
1079749100 11:24173430-24173452 GAATGACCTGAAAATGTTGTAGG - Intergenic
1080748926 11:35135094-35135116 GAATCACATGAACTGGTGGGAGG - Intergenic
1081267271 11:41040158-41040180 GTATGACTTGAACTGGTTTAGGG + Intronic
1081500092 11:43658383-43658405 GAATGACTTTCACAAGTTGAGGG - Intronic
1081913679 11:46717691-46717713 GAATCACTTGAACAGGGAGATGG + Intergenic
1087060519 11:93972634-93972656 TAACTACATGAAAAGGTTGAGGG - Intergenic
1088842553 11:113639119-113639141 GATGGACATGACCAGGTAGATGG + Intergenic
1088845888 11:113666705-113666727 CAAAGACATAAAGAGGTTGAAGG - Intergenic
1091405384 12:205809-205831 TACTGACATGAAGAGGTTTACGG - Intronic
1092980116 12:13786392-13786414 GAATGAGATTAACATGTTTAAGG - Intronic
1093738241 12:22649651-22649673 GAAAGACAAGAACAAGTTGGAGG - Intronic
1097108042 12:56636583-56636605 GAAGGACGTGAACATGTTGGGGG + Intronic
1098159134 12:67631640-67631662 GACTGAAATGAACAAGTGGAAGG + Intergenic
1098924203 12:76331155-76331177 AAATGAAATCAACATGTTGAGGG + Intergenic
1101806427 12:108068188-108068210 GCATGACATAAAGAGGTGGAGGG - Intergenic
1102108512 12:110346063-110346085 GAGTGACATGGACAGGCAGATGG - Exonic
1103203509 12:119109818-119109840 GAATGACTTTGACAAGTTGAGGG - Intronic
1105518510 13:21111574-21111596 GAATGCCATGATTAGCTTGATGG + Intergenic
1107671519 13:42751065-42751087 GAATTGCATCATCAGGTTGATGG + Intergenic
1109895172 13:68677273-68677295 GTATCACATGAACAGCATGAAGG - Intergenic
1110055908 13:70970933-70970955 CAATGACAAGAACAGGATAAAGG - Intergenic
1110499328 13:76208525-76208547 GAATGACATGAACATTTGAATGG - Intergenic
1111093078 13:83472919-83472941 AAATCACATTAACAGGATGAAGG + Intergenic
1111646849 13:91042045-91042067 GAATGACATGATCAGGTTTGTGG - Intergenic
1111789696 13:92838394-92838416 GAATGACGTGAACCGGTAGTCGG + Intronic
1112488796 13:99843558-99843580 GAATGAAATGAACATATTAATGG + Intronic
1112612455 13:100969192-100969214 GAATGACTTTAACAAGTTGAGGG - Intergenic
1117049914 14:51849488-51849510 GAATGAATTGAAAAGGGTGAGGG + Intronic
1118427639 14:65684460-65684482 GAATGACATGAGTAGATAGAGGG - Intronic
1118660883 14:68009939-68009961 GAAACAAATGAATAGGTTGAAGG - Intronic
1119010279 14:70978440-70978462 GAATGACTCAAACAGGTTAATGG + Exonic
1119252481 14:73168713-73168735 AGATCACATGAACAGATTGAAGG - Intronic
1119560997 14:75589680-75589702 GAATGTCATGAACAGCTTGGGGG - Intronic
1119645203 14:76342972-76342994 GAAGGAAATGAACAAGGTGATGG + Intronic
1119753883 14:77099946-77099968 GAAATACCTGAACAGCTTGAAGG - Intronic
1119859468 14:77925820-77925842 GACTGACATGAAGAGAGTGAAGG + Exonic
1120188300 14:81417096-81417118 GAGTGGCAGGAACAAGTTGAGGG - Intronic
1122330323 14:100907693-100907715 AAAGGAAATAAACAGGTTGAGGG - Intergenic
1123882829 15:24691295-24691317 GAATTAGATGAAAGGGTTGAAGG + Intergenic
1124438992 15:29673796-29673818 GAATGACAAGGACAGCTTGGGGG + Intergenic
1126470810 15:49008434-49008456 GTATGAAATGAACAGCTTGAAGG - Intronic
1126548173 15:49895611-49895633 CAAAGACATGAGCAGCTTGATGG - Intronic
1126568223 15:50123234-50123256 GAATGACAAGGACAGCTTGGAGG - Intronic
1128702623 15:69815203-69815225 GCATGACAGGACCAGGTTCAAGG + Intergenic
1129046893 15:72743533-72743555 GAATGTTATGAACAGTTTTATGG + Intergenic
1129746771 15:78027454-78027476 GAATAACATGGACAAGTTGGAGG + Intronic
1129773887 15:78221270-78221292 GAATGGGGTGAACAGGGTGATGG + Intronic
1130056336 15:80529191-80529213 CAATGGCAAGAACAGGTGGAGGG - Intronic
1130238993 15:82167908-82167930 GGTTAACAGGAACAGGTTGATGG - Intronic
1133860640 16:9591730-9591752 CAATAACATGAACAGTTTGCAGG + Intergenic
1135555426 16:23432241-23432263 GAATGACATGACCCGGTATAAGG + Intronic
1135643947 16:24145089-24145111 GAGTGACCTGAACAAGATGAGGG + Intronic
1135897433 16:26420383-26420405 GAATGACTTTGACAAGTTGACGG + Intergenic
1137766780 16:50983650-50983672 AAATGAGATAAACATGTTGAGGG + Intergenic
1137782251 16:51107573-51107595 GAAGGTCATGTACATGTTGAAGG + Intergenic
1138615798 16:58165149-58165171 GAAGGAGATGAACAGATGGATGG - Intronic
1138877660 16:60972557-60972579 GAATGACGTTAACAGGTTTTTGG - Intergenic
1140138694 16:72232722-72232744 GACTGACATGAAGAGGTTGGAGG + Intergenic
1141159630 16:81620535-81620557 GAATGGGATGAACTGGTTGGAGG - Intronic
1141731856 16:85828323-85828345 GAGTGACCTGCACAGGCTGATGG + Intergenic
1148624524 17:49058637-49058659 GAATGGCATGAACCGGAGGACGG + Intergenic
1148954759 17:51344438-51344460 GAAAGACCTGACCTGGTTGAGGG - Intergenic
1149333089 17:55606651-55606673 AACTGACAGGAACAGCTTGATGG - Intergenic
1150854661 17:68740644-68740666 GTATGACATGAACAGGAGAAAGG + Intergenic
1153402763 18:4699254-4699276 GAAAGTCATTGACAGGTTGATGG - Intergenic
1156023177 18:32622451-32622473 GAATGACATGGAGAGGTTTTGGG - Intergenic
1158487248 18:57878519-57878541 GAATGCCATGAACAAAATGAGGG + Intergenic
1159572171 18:70128521-70128543 CAATTACATGAACAGGTAGATGG + Exonic
1160800763 19:967169-967191 GAATCACATGAACTGGGAGATGG + Intronic
1161093039 19:2372476-2372498 GAATGAAATACACAGGTAGAAGG - Intergenic
1162153974 19:8664376-8664398 GAGTGCCAGGAACAGGCTGATGG - Intergenic
1163714345 19:18865382-18865404 GGGTGGCATGACCAGGTTGAAGG - Exonic
1165645086 19:37428990-37429012 TAATGAAATGAATAGGTTAAAGG + Intronic
925710942 2:6739690-6739712 GAATTATATAAACAGTTTGAGGG - Intergenic
926174633 2:10579645-10579667 GAATGACATGAACAGGTTGAGGG - Intronic
929069704 2:38017632-38017654 AAAGGACATGAACAAGTTGTTGG + Intronic
930191734 2:48466725-48466747 GAATGACATGAACAAAATCATGG + Intronic
930719664 2:54626916-54626938 GGAGGACATGAACAGGTACAGGG - Intronic
931190123 2:59992167-59992189 GAATAACGTGTACAGGTTCATGG + Intergenic
931781522 2:65582789-65582811 GAATGGCAGGAACAGTTAGAAGG + Intergenic
934477858 2:94604828-94604850 GAATGACAGAAACAGAATGAGGG + Intergenic
934683458 2:96303284-96303306 GCATGACATCAACAAGATGAAGG - Exonic
937539031 2:122925738-122925760 AAGTCACATGAACAGATTGAAGG + Intergenic
937925232 2:127162751-127162773 GACTGACCTGGACAGGTTCAAGG + Intergenic
939367479 2:141251903-141251925 GAATCACATGAACACTCTGAGGG - Intronic
940804005 2:158165241-158165263 GAATGTTAATAACAGGTTGATGG - Intergenic
940903031 2:159144263-159144285 GGATGACATGAAAATTTTGAAGG + Intronic
943142839 2:184004387-184004409 GACTGACATGAACAGGATGAGGG + Intergenic
943666256 2:190612034-190612056 GAAAGAAATGTACAGTTTGAAGG - Intergenic
944961082 2:204874621-204874643 GTTTTACATGAACAGCTTGATGG + Intronic
947905619 2:233759610-233759632 GAAGGAAATGAACAGGTGGGTGG - Intronic
948212768 2:236207326-236207348 GAATGACATGAAAAGGAAGATGG - Intronic
948759365 2:240181080-240181102 GGAGGACATGGCCAGGTTGAAGG - Intergenic
1169167188 20:3434114-3434136 TAATGACATAAACTGGATGATGG + Intergenic
1170798002 20:19566488-19566510 GAATGACAGGCACAGGGTGGAGG - Intronic
1172035004 20:32004431-32004453 AAATGCCATGATCAGGTTTATGG - Intergenic
1172239406 20:33402406-33402428 GAATGACAGGTACAGGTTTTTGG - Intergenic
1175503082 20:59464017-59464039 GAAGGAGAAGTACAGGTTGAAGG - Intergenic
1179769899 21:43606674-43606696 GAATGACTTGAACATGTTTAGGG - Intronic
1182462529 22:30492514-30492536 GAACGACTTGACCAAGTTGAAGG + Exonic
1182467868 22:30529127-30529149 GTAAGACTTGACCAGGTTGAAGG + Exonic
1182817478 22:33178470-33178492 AATGGACATGAACAGGTTCAGGG + Intronic
950484505 3:13265115-13265137 GATTCACTTGGACAGGTTGAGGG - Intergenic
950780917 3:15390906-15390928 AAGTCACATGAACAGATTGAAGG + Intronic
950821423 3:15763622-15763644 CAAGGACATGAAAAGGTTCATGG + Intronic
951506523 3:23451953-23451975 GAATAACATTAACAGGTTGATGG - Intronic
952173658 3:30837553-30837575 GAATGACATTAAGAGATTTATGG - Intronic
953023319 3:39129845-39129867 GAGTGAGAGGAACAGGTAGAGGG + Intronic
955566192 3:60249466-60249488 CAATCAAATGAACAGGGTGATGG - Intronic
955611040 3:60757785-60757807 GAACAACATGAACAGATTGGTGG + Intronic
956424651 3:69121082-69121104 GTATAACTTGAACAGCTTGATGG - Intronic
956738156 3:72255053-72255075 GAAGGAAATAAACATGTTGAAGG + Intergenic
957841674 3:85679050-85679072 AAATGACATGAACTCTTTGAGGG - Intronic
958160440 3:89811705-89811727 GAAGCACATGAACAGCATGATGG + Intergenic
958873594 3:99590012-99590034 AAATGACTTTAACAAGTTGATGG + Intergenic
959255931 3:104013863-104013885 GAATGACATCACTAGTTTGATGG - Intergenic
959694606 3:109235309-109235331 GAATGAGATGGACAAATTGACGG + Intergenic
960893312 3:122474729-122474751 GAATCACATTAACAGAATGAAGG + Intronic
964894373 3:161577695-161577717 GAGTGACAGAAACATGTTGAAGG - Intergenic
965671887 3:171156257-171156279 GAAGGACATAATGAGGTTGATGG + Intronic
967879843 3:194293779-194293801 GAAGGACATAAACAGTGTGAAGG + Intergenic
968178710 3:196573665-196573687 GAATGATAGGAAAAGGTTTAGGG + Intronic
968947784 4:3674730-3674752 GAACCACAAGAACAGGATGAGGG - Intergenic
970808636 4:20065066-20065088 AAATGACATGACCAGGTAGAAGG + Intergenic
971150488 4:24026242-24026264 GAATGACATAGTCAGGTGGAGGG - Intergenic
974891209 4:67886266-67886288 GAATGACAGGAACAGTTTTCAGG + Intergenic
976740435 4:88350805-88350827 GAATGACAAGGACAGCTTGGAGG + Intergenic
977786413 4:101040051-101040073 GATTCACATGAACAGCTTTATGG + Intronic
979310627 4:119198803-119198825 GAATGACTTTGACAAGTTGATGG + Intronic
979470703 4:121092928-121092950 GAGTGACCAGAACATGTTGAGGG + Intergenic
982873035 4:160608027-160608049 AAATGACAAAAACAGGTTAAAGG - Intergenic
984397684 4:179222306-179222328 GAATGACATGAATAGGGTCTGGG + Intergenic
986031971 5:3903190-3903212 TAATGACATGAACTGGTAAACGG + Intergenic
986154002 5:5155726-5155748 GAATGACAGGAACAGGAGGCAGG + Intronic
987089223 5:14496536-14496558 GAATAAGATGAACATTTTGATGG - Intronic
988360952 5:30235519-30235541 GAATGACCTGCAGAGGCTGATGG - Intergenic
988542303 5:32121518-32121540 GAAAGACTTGAACAGCTTCAGGG + Intergenic
989073625 5:37538693-37538715 GAATGAAATGAAGAGGAAGAGGG + Intronic
994644510 5:102451534-102451556 GAATGACATGAAGAGCTGCATGG - Intronic
994673081 5:102785599-102785621 GATTGGCTTGAAGAGGTTGAGGG + Intronic
997616324 5:135248739-135248761 GAAAGAAATGAAGAGATTGATGG + Intronic
997907103 5:137828843-137828865 GAAAGATATTAACAGGTGGAGGG - Intergenic
1000458727 5:161485635-161485657 GAATGACATGAACATGGAGTGGG - Intronic
1002382067 5:178838355-178838377 GACTGAGATTTACAGGTTGAAGG + Intergenic
1002648660 5:180674910-180674932 GACTGAGATTTACAGGTTGAAGG - Intergenic
1002653760 5:180724993-180725015 GAAGGACATGAAGCAGTTGACGG + Intergenic
1008720823 6:54349371-54349393 TAATTATATAAACAGGTTGAAGG + Intronic
1008921445 6:56847400-56847422 GAATGGCATAATCAGGTTTACGG - Intronic
1009511694 6:64559099-64559121 GAATAACATGAACAGAATTAGGG - Intronic
1010149448 6:72713373-72713395 AACTCAGATGAACAGGTTGATGG - Intronic
1010660439 6:78564384-78564406 GTGTGACATCAGCAGGTTGAAGG + Intergenic
1012945394 6:105460811-105460833 GAATGACATGGACAGGAGGCAGG + Intergenic
1013847127 6:114466848-114466870 AAATGACATGAACATTTTAAAGG - Intergenic
1014515006 6:122367290-122367312 GAAAAAAATGAACAGGTTCAGGG + Intergenic
1015013368 6:128378437-128378459 AAATGACATCAAAAGATTGATGG + Intronic
1015673418 6:135718043-135718065 GAATGTGAAGAACAGGTTGTAGG + Intergenic
1017061081 6:150485554-150485576 GCATGATCTGAACAGGTAGAGGG - Intergenic
1017431798 6:154378665-154378687 GCATGTTATGAACAAGTTGAGGG + Intronic
1017475458 6:154786615-154786637 GAATGACAAGGACAGCTTGAAGG + Intronic
1018076946 6:160225863-160225885 GAATGACAAGGACAGCTTGGAGG - Intronic
1018870905 6:167781393-167781415 GAATGAAAAGAACAGCTTCAAGG + Intergenic
1019892128 7:3955197-3955219 GAATTCCATGAACAACTTGAAGG - Intronic
1020234475 7:6345077-6345099 AAATGACATGATCAGATTTATGG + Intronic
1020758347 7:12234888-12234910 GAAAGGCATGAAGAAGTTGAGGG + Exonic
1020941942 7:14550724-14550746 GATTGTCATGAACATGATGACGG + Intronic
1020967347 7:14888122-14888144 GAAAGACAAGAACTGGTAGAAGG + Intronic
1021161765 7:17282364-17282386 GAATGACATAATGAGGTTAAGGG - Intergenic
1021782830 7:24122641-24122663 GAGGAACATGAACAGGTTGGGGG - Intergenic
1021939128 7:25662435-25662457 GAATGACATTTTCAGGTTTATGG + Intergenic
1021997056 7:26189319-26189341 GACTGAAATGAACTGATTGAAGG - Intergenic
1022927944 7:35074702-35074724 GAATGCCATGCACATGCTGATGG + Intergenic
1023097435 7:36675354-36675376 GAATGTTATGAACAGGTGCATGG + Intronic
1023284145 7:38602049-38602071 GGGTGAGATGACCAGGTTGAAGG - Intronic
1023783310 7:43679544-43679566 GAATGACATGAACTAGATTATGG + Intronic
1024411680 7:49050108-49050130 GACCAACATGAAAAGGTTGATGG + Intergenic
1025787639 7:64658162-64658184 GAATGACATCAAATAGTTGATGG - Intergenic
1027131106 7:75592055-75592077 GAGTGACATGAGCAGGATGTGGG - Exonic
1028114324 7:86980749-86980771 GAATGAAAGGAACACGTTTAAGG - Intronic
1028415396 7:90574876-90574898 GAGTGACATGAACTGATTTATGG + Intronic
1028486040 7:91358584-91358606 TCATGACATGAACAAGTTAAAGG + Intergenic
1029361202 7:100089582-100089604 GAATGACATGGAAAAGGTGAGGG - Intronic
1030835417 7:114277938-114277960 GAATCACTTGAACAGGTGGGTGG + Intronic
1031510953 7:122649027-122649049 GAATGACTGGAACAAATTGAGGG - Intronic
1031678959 7:124646819-124646841 GGATGTGATGAACAGGTTAATGG + Intergenic
1032079242 7:128850436-128850458 GAAGGGGATGACCAGGTTGAAGG - Exonic
1032982502 7:137300116-137300138 TAAATACATGAACAGGTAGATGG + Intronic
1035256029 7:157628213-157628235 GATTGCCATGAACACTTTGAGGG + Intronic
1035984485 8:4411616-4411638 GAATGGAATGAGCAGGTGGAAGG - Intronic
1036430673 8:8687295-8687317 GGATGACATGGGCAGGTTTAAGG - Intergenic
1036464149 8:8980582-8980604 AAAAGACATTAACAGGGTGAAGG - Intergenic
1039350686 8:36760487-36760509 GAAGGAAATGAACAGGATGATGG - Intergenic
1040424649 8:47273451-47273473 GTAAGACATGAACAGGTTGAGGG + Intronic
1040639146 8:49311532-49311554 GAAAGACATGTACATGTTCAGGG + Intergenic
1041165950 8:55092552-55092574 GAATCACTTGAACAGGTAGTCGG - Intergenic
1042339849 8:67667201-67667223 GCATGTCAAGAAAAGGTTGATGG + Intronic
1043268140 8:78292604-78292626 AAATAACATGTATAGGTTGAAGG - Intergenic
1045599424 8:103695318-103695340 GACTGACATAAGCAAGTTGAGGG - Intronic
1045885161 8:107087063-107087085 GAAAGACAAGAAAAGGCTGAGGG - Intergenic
1046746970 8:117886706-117886728 GAATGAGACGAACAGGCAGATGG - Intronic
1049285405 8:141772372-141772394 GTAAGACATGAACAGGATGCAGG - Intergenic
1050021777 9:1292063-1292085 TAATGGCAGGAACAGGTTGCGGG - Intergenic
1050757922 9:9030962-9030984 GAATGTAAGGAACAGGTAGATGG + Intronic
1051476154 9:17511197-17511219 GGATGATAAGGACAGGTTGATGG + Intergenic
1053680201 9:40481279-40481301 GAATGACAGAAACAGAATGAGGG - Intergenic
1053930192 9:43109589-43109611 GAATGACAGAAACAGAATGAGGG - Intergenic
1054283511 9:63143656-63143678 GAATGACAGAAACAGAATGAGGG + Intergenic
1054293281 9:63316789-63316811 GAATGACAGAAACAGAATGAGGG - Intergenic
1054391309 9:64621282-64621304 GAATGACAGAAACAGAATGAGGG - Intergenic
1054504420 9:65895045-65895067 GAATGACAGAAACAGAATGAGGG + Intergenic
1055154081 9:73039254-73039276 GAAAGACATACATAGGTTGAAGG - Intronic
1055428519 9:76219757-76219779 GAATGACTTGAAAGGGCTGAGGG - Intronic
1057303594 9:93900092-93900114 GAAGGACTTGAGCAGGATGAGGG - Intergenic
1058754636 9:108073041-108073063 TAATGACGTGAACAGGTGGATGG - Intergenic
1058844618 9:108944562-108944584 TAATGAGATGAACAGGATGATGG + Intronic
1059960587 9:119560572-119560594 GAAAGACTTGAAGAGGTGGAAGG - Intergenic
1187024099 X:15415391-15415413 GAATGCCATGAACATTTTAAGGG - Intronic
1187543396 X:20222276-20222298 GAAGGAAATGAAGAGGTTTAGGG + Intronic
1187595910 X:20772304-20772326 GAATGACTTTGACAAGTTGACGG + Intergenic
1187866432 X:23727253-23727275 GAATCAAGTGAACAGGTTAAAGG + Intronic
1188318627 X:28707832-28707854 GAATGACATGCACATAGTGAGGG + Intronic
1188323415 X:28769430-28769452 GAATGACATGCACATATGGAAGG + Intronic
1190158069 X:48009502-48009524 GGATGAAGTGGACAGGTTGATGG - Intronic
1190173840 X:48132386-48132408 GGATGAAGTGGACAGGTTGATGG - Intronic
1190608750 X:52171915-52171937 GAATGACTTTGACAAGTTGAGGG + Intergenic
1190623227 X:52309720-52309742 TAATGTCATGAACAGGTTCTTGG - Intergenic
1190862186 X:54355647-54355669 GAATAACATAAACAGATTTATGG - Intronic
1193451784 X:81679733-81679755 AAAACACATGAACAGGCTGAAGG - Intergenic
1194877879 X:99211867-99211889 GAATGGCATGAACCGGGAGATGG - Intergenic
1195132067 X:101862972-101862994 CAATGACGGGAACAGGTTTATGG + Intergenic
1195163578 X:102196055-102196077 GAATGACTTTGACAAGTTGATGG - Intergenic
1197297176 X:124733123-124733145 TAATGTGAGGAACAGGTTGAAGG + Intronic
1198071966 X:133158298-133158320 CAATAACATGAACAGTATGAGGG - Intergenic
1198971349 X:142284016-142284038 CAATGACAGGGACAGATTGAAGG - Intergenic
1199025728 X:142935289-142935311 GAACGACATGATCAGGGTCATGG - Intergenic
1201562504 Y:15333023-15333045 GAGTGACAGGAGCAGGCTGAAGG + Intergenic
1202142526 Y:21743280-21743302 GAATGGCATGAACTGGGAGATGG + Intergenic
1202144332 Y:21762338-21762360 GAATGGCATGAACTGGGAGATGG - Intergenic