ID: 926176875

View in Genome Browser
Species Human (GRCh38)
Location 2:10601481-10601503
Sequence CGCCCTCATTTCTCTTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926176868_926176875 22 Left 926176868 2:10601436-10601458 CCACATGGCAAAAAAACGGCAAC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 926176875 2:10601481-10601503 CGCCCTCATTTCTCTTCCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 170
926176873_926176875 -2 Left 926176873 2:10601460-10601482 CCAGCTTACTGCTAGGGAACTCG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 926176875 2:10601481-10601503 CGCCCTCATTTCTCTTCCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 170
926176872_926176875 -1 Left 926176872 2:10601459-10601481 CCCAGCTTACTGCTAGGGAACTC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 926176875 2:10601481-10601503 CGCCCTCATTTCTCTTCCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 170
926176871_926176875 0 Left 926176871 2:10601458-10601480 CCCCAGCTTACTGCTAGGGAACT 0: 1
1: 0
2: 1
3: 8
4: 127
Right 926176875 2:10601481-10601503 CGCCCTCATTTCTCTTCCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926176875 Original CRISPR CGCCCTCATTTCTCTTCCCA GGG Intronic
906252325 1:44320079-44320101 CGCCCTTCTTTCTCTTGCCCAGG + Intronic
906821478 1:48934738-48934760 TCCCCTCCTTTCTATTCCCACGG + Intronic
906826592 1:48988083-48988105 CCCCCTCATTCCCCATCCCAGGG + Intronic
910959241 1:92743512-92743534 CTCCCTATTTCCTCTTCCCATGG - Intronic
913675873 1:121139696-121139718 TGCCCTCCTTTTTCTCCCCAAGG + Intergenic
914027769 1:143927636-143927658 TGCCCTCCTTTTTCTCCCCAAGG + Intergenic
915325705 1:155080391-155080413 CGCCCCCCTCTCGCTTCCCATGG + Intronic
916418191 1:164611908-164611930 TGCCCTCCTTTCTTCTCCCAGGG + Intronic
919807808 1:201391099-201391121 CGCCTTCCTTTCACTTCCCAGGG + Intronic
920456777 1:206107591-206107613 AGCCCTCATTGTTCCTCCCATGG - Intergenic
920463241 1:206158533-206158555 TGCCCTCCTTTTTCTCCCCAAGG + Intergenic
1063259728 10:4373358-4373380 CACCCTCCTGTATCTTCCCATGG + Intergenic
1068363456 10:56012158-56012180 CACCTTCATATCTCCTCCCATGG + Intergenic
1070580689 10:77716864-77716886 AGCCCTCATTTCCCTTCTCCTGG - Intergenic
1071102248 10:82052449-82052471 GGCCATCATTTCTGTGCCCAAGG + Intronic
1078729408 11:13962216-13962238 CGGGCCCATTGCTCTTCCCAAGG - Intergenic
1079248884 11:18772992-18773014 CCCCCTCCTGTCTCATCCCACGG - Intronic
1079418273 11:20261130-20261152 AGCCCTCATTTCTCTCTACATGG + Intergenic
1080441025 11:32294705-32294727 AGTCCTCATTTTGCTTCCCAGGG + Intergenic
1080444758 11:32327769-32327791 CAGCCTCATTTCCCATCCCAGGG + Intergenic
1081520786 11:43879176-43879198 CGCCTTCATTCCTTCTCCCATGG + Intergenic
1084525907 11:69697881-69697903 CGCCCTCAGCACTCTTCCCTGGG - Intergenic
1086512524 11:87574629-87574651 CTCCCTCTTCTCTCTTTCCAAGG - Intergenic
1087022062 11:93613262-93613284 CTCCTTCCTTTCTCTTTCCATGG - Intergenic
1087181988 11:95150660-95150682 CGCCTTGATGTCCCTTCCCAGGG + Intergenic
1089787972 11:120921663-120921685 CGGCCCCATCTCACTTCCCAGGG + Intronic
1090424105 11:126595140-126595162 GGCCTTCTTTTCTCTTTCCAAGG + Intronic
1090605994 11:128423307-128423329 CGCTGTCATTTATTTTCCCACGG - Intergenic
1090913550 11:131142675-131142697 CTCCCTCATTTCTCCACCCCTGG - Intergenic
1091173574 11:133540218-133540240 AGCCCTTCATTCTCTTCCCAGGG + Intergenic
1091643650 12:2256649-2256671 TGTCCTCATTTCTCTACCCCTGG - Intronic
1094229760 12:28089635-28089657 CACCCTCATTCCTCTCCCCTTGG + Intergenic
1094451574 12:30588338-30588360 CACCCTCATTTATCTGCCTATGG - Intergenic
1096917276 12:55046884-55046906 CTCCCTCCTTTCTCTTCCACTGG + Intergenic
1099092044 12:78324430-78324452 TGCCCTCCTTCCTGTTCCCAAGG + Intergenic
1099283244 12:80679966-80679988 GGCCGTCATTTCATTTCCCAAGG + Exonic
1099491331 12:83292306-83292328 AGTCCTCTTTACTCTTCCCAGGG - Intergenic
1100327757 12:93555269-93555291 CGTCCTTATTTGTTTTCCCAGGG + Intergenic
1101473851 12:105025136-105025158 CGCACTCATTAGTTTTCCCATGG - Intronic
1101850295 12:108396612-108396634 ATCCCTAATTTCCCTTCCCAAGG - Intergenic
1101891032 12:108715592-108715614 CGCCTGCCTTTGTCTTCCCAAGG - Intronic
1102015660 12:109646252-109646274 CACCCACATTTCTCTGCCCCAGG - Intergenic
1103232223 12:119340976-119340998 CTCCCTCATTTCTCTTTTCCTGG - Intronic
1104051008 12:125193875-125193897 CTGCTTCATTTCTCTCCCCATGG - Intronic
1104171115 12:126281719-126281741 CCCCATCATTTCTCTTCATAAGG - Intergenic
1104293638 12:127492142-127492164 CTTCCTCCCTTCTCTTCCCAAGG + Intergenic
1104364976 12:128168526-128168548 CCCCCTCATCCCTTTTCCCAGGG + Intergenic
1104501753 12:129293032-129293054 GGCCCTGTTTTCTGTTCCCAGGG + Intronic
1104940574 12:132392611-132392633 CGACCACGTTGCTCTTCCCAGGG + Intergenic
1107746495 13:43515927-43515949 GTCCCTCATTTTTGTTCCCAGGG + Intronic
1110849812 13:80232245-80232267 CCCTTCCATTTCTCTTCCCATGG - Intergenic
1113320420 13:109227460-109227482 CACCCTCAGTTCTCTCCACACGG + Intergenic
1113650688 13:112032203-112032225 GGCCCTCTTTTCTGTTCGCATGG - Intergenic
1116187279 14:41612643-41612665 AGCCCACATTTTTATTCCCATGG + Intronic
1120708950 14:87773325-87773347 CCCCTTTATTTTTCTTCCCAAGG - Intergenic
1121105925 14:91279726-91279748 GGTCCTCATCTCTCTTCCCGTGG - Intronic
1122740446 14:103868911-103868933 CTCCCTCTTCTCTGTTCCCATGG + Intergenic
1123696176 15:22880686-22880708 CTCCCGCTTTGCTCTTCCCAGGG - Intronic
1127539338 15:59921578-59921600 CTCCATCATTCCTCTTCCTAGGG - Intergenic
1128372206 15:67048740-67048762 ATCCCTCACTTTTCTTCCCATGG + Intergenic
1129009618 15:72403361-72403383 TGACATCCTTTCTCTTCCCAAGG + Intronic
1130108390 15:80945774-80945796 CTGCCCCATTTCTATTCCCAAGG + Intronic
1131360893 15:91789527-91789549 CGCCCTCCCCTCTCTTCCCAGGG - Intergenic
1133942490 16:10322001-10322023 CGTCCTCTTCTCTCTGCCCAAGG + Intergenic
1137036985 16:35576049-35576071 CAGCCCCATGTCTCTTCCCAAGG - Intergenic
1138347101 16:56326748-56326770 CGCCCTCCTGCCTCTGCCCATGG - Intronic
1145286070 17:21506712-21506734 CTCCCCCATTTCCCTTCCCACGG + Intergenic
1146884144 17:36459711-36459733 CCCTCTCATATCTGTTCCCATGG + Intergenic
1151578266 17:74963553-74963575 GGCCCTCAGTTCCCCTCCCATGG - Intronic
1155354115 18:24935139-24935161 CTCCCTTATTTCTGTTCCCCTGG + Intergenic
1155498643 18:26465870-26465892 TGACCTCTTTTCTCCTCCCAAGG - Intronic
1156700091 18:39815241-39815263 TGAACTCATTCCTCTTCCCAGGG + Intergenic
1157491601 18:48127599-48127621 GGCCAGCATTTCTCCTCCCAGGG + Intronic
1161412190 19:4123129-4123151 CACCCTCATTTCACTACTCAAGG + Intronic
1161969735 19:7571033-7571055 CACCCTGATATTTCTTCCCAAGG - Intergenic
1162964732 19:14150517-14150539 AGCCCTCATTTCCCTTCACAGGG + Exonic
1166313631 19:41976565-41976587 CGCTCTCTCTGCTCTTCCCAGGG - Exonic
1167241028 19:48343115-48343137 CCCCATCCTTTCTCTTCCCCTGG + Intronic
1167882909 19:52476952-52476974 TTCCCTCATTTCTCTTTTCATGG + Intronic
1168416813 19:56174494-56174516 CCCCATCCTTTCTCATCCCAAGG - Intergenic
1168455298 19:56502874-56502896 TGCCCTCATTTCTTGTCACAAGG - Intergenic
925879323 2:8338822-8338844 CTTCCCCAGTTCTCTTCCCAAGG + Intergenic
926176875 2:10601481-10601503 CGCCCTCATTTCTCTTCCCAGGG + Intronic
927246213 2:20958896-20958918 CGCCCTCTATTCCCTTTCCATGG + Intergenic
927971201 2:27307178-27307200 CGCCCTCGGCCCTCTTCCCAGGG - Exonic
929078179 2:38095821-38095843 CGTCTTCATGTTTCTTCCCATGG - Intronic
931620336 2:64204040-64204062 CACCCTCATTCCTGTCCCCATGG - Intergenic
932493292 2:72134541-72134563 CACCCTCCCTTCTCTCCCCATGG - Intronic
937429291 2:121825072-121825094 CACCTGCATTTTTCTTCCCAAGG + Intergenic
937998836 2:127715906-127715928 CTTCCTCCTTTCTCCTCCCAGGG - Intronic
938411097 2:131065239-131065261 CCCCCACATTTCACTCCCCATGG - Intronic
941898336 2:170653332-170653354 TGCCTTCCTTTCTCATCCCATGG + Exonic
943044098 2:182837704-182837726 TGCCCTAATGTCTCTTCACAAGG - Intronic
946299293 2:218812770-218812792 CACCCCCATCTCTCTTCCCTGGG - Intronic
948253327 2:236548512-236548534 CTCCCTCGTTAATCTTCCCAGGG + Intergenic
948711729 2:239829300-239829322 CCCCTCCATTTCCCTTCCCAGGG - Intergenic
1169866097 20:10201716-10201738 CTTCCTCATTTCTCTACCCCAGG - Intergenic
1170731747 20:18982283-18982305 TGGCCTCATTTCTCACCCCAAGG + Intergenic
1174611894 20:51804472-51804494 CGCCTTGTTTTATCTTCCCATGG + Intergenic
1175702415 20:61149452-61149474 CACCCTCCTGCCTCTTCCCAGGG + Intergenic
1181348953 22:22241747-22241769 CTCCCTCATTTCACATCCGAAGG - Intergenic
1181761494 22:25061881-25061903 CTCCCTCTTTTCTCATCCCTTGG + Intronic
1183208352 22:36434539-36434561 TTCACTCATTTCTTTTCCCAGGG + Intergenic
1184468936 22:44684670-44684692 CGCCCCCAGCTCTCTGCCCAGGG + Intronic
1184783511 22:46660733-46660755 CGCCCTCTGTTCTCTTCTCAGGG + Intronic
949576576 3:5344391-5344413 CTCCCCTGTTTCTCTTCCCAGGG + Intergenic
949781092 3:7689534-7689556 CACCATCATTTCTCTCGCCAAGG + Intronic
949797931 3:7871195-7871217 GGCATTCATTTCACTTCCCAGGG + Intergenic
950626148 3:14248598-14248620 TGCCCTGATTCCTCTTCCCTTGG + Intergenic
952865482 3:37852587-37852609 CTCCTTCTTTTCTCTTACCAAGG + Intergenic
953190735 3:40685092-40685114 TGCCCTCATTCCACTCCCCAGGG + Intergenic
955077555 3:55628106-55628128 TACCCCCATTTTTCTTCCCAAGG + Intronic
957034880 3:75284544-75284566 CACCCACATTTCTCAACCCATGG - Intergenic
958013110 3:87905923-87905945 TGCCTTCATTTTTCTTCCAATGG - Intergenic
959590626 3:108075920-108075942 TGCCCTCATTTCTTGCCCCATGG - Intronic
961360910 3:126366492-126366514 TGCCCTCCTTCCTCTCCCCAGGG - Intergenic
966440783 3:179942244-179942266 GGGCCTCATTTCTCCTCCGAGGG + Intronic
967910848 3:194541483-194541505 TGCCTTCCTTTCTCTTCCCAAGG + Intergenic
968036817 3:195554577-195554599 TGCCATCATTTCTCTTCCCGTGG + Intergenic
970172649 4:13305062-13305084 CACCATCATTTATCTCCCCATGG + Intergenic
972629247 4:40829146-40829168 CCCCCTGATTTCTCTTCACATGG - Intronic
972786680 4:42332793-42332815 AGCCCCCATTTCTCCTTCCATGG + Intergenic
974822133 4:67080743-67080765 TTCTCTCATTTCTCTTCTCAGGG - Intergenic
975643006 4:76519044-76519066 AGCTCTCAGTTCTCTTCCAAGGG - Intronic
980320647 4:131268666-131268688 CACCCTCATATCTCTTCACATGG + Intergenic
980435989 4:132774455-132774477 GGTACTCATTTCTTTTCCCAAGG + Intergenic
982480869 4:155908342-155908364 CACCCTGCTTTCTCTTGCCATGG + Intronic
986032699 5:3908968-3908990 TGCCCTCATTTCCTTTCTCATGG + Intergenic
990862948 5:60348140-60348162 CACCCTGAATTCTCTCCCCATGG - Intronic
991361319 5:65823829-65823851 CCACCTCCTCTCTCTTCCCATGG - Exonic
991361542 5:65826157-65826179 CTGCCTCCTGTCTCTTCCCATGG - Exonic
993383335 5:87233294-87233316 CTTCCCCATTTCTCCTCCCAAGG + Intergenic
996039382 5:118793225-118793247 TGCCCTCATTACTCAGCCCAGGG - Intergenic
997724503 5:136109308-136109330 CCCCCTTCTTTTTCTTCCCATGG + Intergenic
1001037648 5:168309187-168309209 CTCCCTCTTTGCTCTTCCCTAGG + Intronic
1001037738 5:168309775-168309797 CTCCCTCTTTGCTCTTCCCTAGG + Intronic
1001227543 5:169958165-169958187 GGCCCTCATTTCTCACCACAGGG - Intronic
1002342723 5:178527412-178527434 CCCCCTCATCTCTCTTCCCTGGG + Intronic
1003614915 6:7646293-7646315 CCCCCTCATTTCTACTTCCAGGG - Intergenic
1006150307 6:31983494-31983516 CCCCCACAGTCCTCTTCCCAGGG + Intronic
1006156608 6:32016232-32016254 CCCCCACAGTCCTCTTCCCAGGG + Intronic
1013180959 6:107716649-107716671 CTCCCTCCTTTTTCCTCCCATGG - Intronic
1014777121 6:125523997-125524019 CTCCCTCATCTCTCTGCCCTTGG + Intergenic
1014937917 6:127405423-127405445 CCCCCTCATTTATCTTAGCAGGG + Intergenic
1018778695 6:167043297-167043319 CGCCATCAGTTCTCTGTCCATGG + Exonic
1019488150 7:1298916-1298938 AGCTCTCATTCCCCTTCCCAGGG - Intergenic
1020413309 7:7916865-7916887 TGCCCTCCTTTCTCCTCCCTTGG - Intronic
1022048468 7:26642999-26643021 TGCCCTCCTTTTTCTCCCCAAGG + Intronic
1031507695 7:122606871-122606893 TGCCCTCTTTCCTCTTCCCCTGG - Intronic
1036118585 8:5988671-5988693 AGACCTCATTTCTGTTCTCAAGG - Intergenic
1036148221 8:6274617-6274639 CGCCCCCTGTTCTCTTCTCAAGG + Intergenic
1037752927 8:21694359-21694381 CGCCCTCAAATCTCATCGCATGG - Intronic
1039563460 8:38531514-38531536 CTTCCTCCTTCCTCTTCCCAAGG - Intergenic
1041713669 8:60914665-60914687 CTCCCTCATATTTCTTCCCAAGG - Intergenic
1042367093 8:67950107-67950129 TGCCCTAAATTCTCTTACCAAGG - Intergenic
1045493533 8:102688930-102688952 CGCCCACATTCCTCTGCTCATGG - Intergenic
1045749663 8:105468210-105468232 CTCCCTCAGGACTCTTCCCAGGG + Intronic
1046840472 8:118850718-118850740 GGCCTTCATTTTTCTTCCCCAGG + Intergenic
1048456695 8:134584787-134584809 CGCCCTCTTTCCCCTTCCCCCGG - Intronic
1049536702 8:143185932-143185954 CGCCGTAATTTCCCTTCCCGGGG - Intergenic
1049721522 8:144117961-144117983 CACCCTCCTTTTTCTCCCCAAGG - Exonic
1051696624 9:19774771-19774793 AGCCCTCATTACTCCTCCAAAGG + Intronic
1052161368 9:25264020-25264042 GGCCCACATTTCTTTTCTCAGGG + Intergenic
1052591557 9:30503238-30503260 TGCCCTCATTTATCTTCAAAAGG + Intergenic
1052747207 9:32452394-32452416 CCCCCTCATTTCTTCTGCCATGG + Exonic
1053589383 9:39496251-39496273 TTGCCTCCTTTCTCTTCCCATGG - Intergenic
1054576916 9:66869038-66869060 TTGCCTCCTTTCTCTTCCCATGG + Intronic
1054887734 9:70217162-70217184 CGCCATCTTTTCTCTTCCCGTGG + Intronic
1056470716 9:86902780-86902802 GGCCCTCTTTCCTCTTCCCCCGG + Intergenic
1056709888 9:88983858-88983880 CCCCCACACTGCTCTTCCCACGG + Intergenic
1057546110 9:96021425-96021447 CGCCCTCCCTTCTCTCCCCGCGG - Intergenic
1057693405 9:97307257-97307279 CGCCCACGCTTTTCTTCCCAGGG - Intergenic
1059759968 9:117328641-117328663 TGGCCTCATTTTTCATCCCAGGG + Intronic
1061764994 9:132875992-132876014 CCTCCTCATTTCTCTGCCTAGGG - Intronic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1061927708 9:133814129-133814151 TGCCTTCATGTCTGTTCCCAGGG - Intronic
1062281784 9:135755100-135755122 CTGCCTCCTTTCTCTTCCCAGGG + Exonic
1186977040 X:14918549-14918571 AGTCCTCATTCCTCTTCCCCAGG - Intronic
1187092727 X:16114246-16114268 TGCCCCCATTTCTGATCCCATGG - Intergenic
1192545028 X:72006080-72006102 CCTCCTCATTTCTGTTCCCATGG + Intergenic
1196054373 X:111339367-111339389 AGCCATCAGTTCTCCTCCCATGG - Intronic
1196818554 X:119684908-119684930 CCCCCACATTTCTCTTTCCCAGG - Intronic
1197205820 X:123789626-123789648 AGCCCTCATTTTTCTTACCTAGG - Intergenic
1198253586 X:134905460-134905482 CACCCCCATTTCTCTCTCCAGGG - Intronic
1198321892 X:135526386-135526408 CGCCCTCTCTTCTCTTCTCATGG + Intronic
1200755886 Y:6989599-6989621 AGCCCTGCTTTCTATTCCCAAGG + Intronic