ID: 926178140

View in Genome Browser
Species Human (GRCh38)
Location 2:10615823-10615845
Sequence CTTTAGGCATGGTGGGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 172}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926178140_926178152 30 Left 926178140 2:10615823-10615845 CCAAATCCCCACCATGCCTAAAG 0: 1
1: 0
2: 0
3: 9
4: 172
Right 926178152 2:10615876-10615898 AACCAAAGCTGCCCTATGTGCGG 0: 1
1: 0
2: 2
3: 15
4: 119
926178140_926178146 -1 Left 926178140 2:10615823-10615845 CCAAATCCCCACCATGCCTAAAG 0: 1
1: 0
2: 0
3: 9
4: 172
Right 926178146 2:10615845-10615867 GAGACCAGAAGATAATTCTCTGG 0: 1
1: 0
2: 0
3: 30
4: 179
926178140_926178149 5 Left 926178140 2:10615823-10615845 CCAAATCCCCACCATGCCTAAAG 0: 1
1: 0
2: 0
3: 9
4: 172
Right 926178149 2:10615851-10615873 AGAAGATAATTCTCTGGAGGAGG 0: 1
1: 0
2: 2
3: 27
4: 244
926178140_926178147 2 Left 926178140 2:10615823-10615845 CCAAATCCCCACCATGCCTAAAG 0: 1
1: 0
2: 0
3: 9
4: 172
Right 926178147 2:10615848-10615870 ACCAGAAGATAATTCTCTGGAGG 0: 1
1: 0
2: 0
3: 16
4: 152
926178140_926178151 7 Left 926178140 2:10615823-10615845 CCAAATCCCCACCATGCCTAAAG 0: 1
1: 0
2: 0
3: 9
4: 172
Right 926178151 2:10615853-10615875 AAGATAATTCTCTGGAGGAGGGG 0: 1
1: 0
2: 1
3: 32
4: 261
926178140_926178150 6 Left 926178140 2:10615823-10615845 CCAAATCCCCACCATGCCTAAAG 0: 1
1: 0
2: 0
3: 9
4: 172
Right 926178150 2:10615852-10615874 GAAGATAATTCTCTGGAGGAGGG 0: 1
1: 0
2: 4
3: 27
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926178140 Original CRISPR CTTTAGGCATGGTGGGGATT TGG (reversed) Intronic
901946993 1:12712134-12712156 CCTTAGGTATGGAGGGAATTGGG + Intergenic
906489267 1:46255323-46255345 CTTTAGCCTTGGTGGGGAGGAGG + Intronic
908510562 1:64847282-64847304 CCTTAGGAAAGGTGGGGGTTGGG + Intronic
909931232 1:81502492-81502514 GTTTGGCCATGATGGGGATTCGG - Intronic
912127248 1:106554514-106554536 CCTTGGGCCTGGTGGAGATTGGG + Intergenic
916088527 1:161289052-161289074 CTGAAGGCCTGGTGGGGGTTGGG + Intergenic
917694553 1:177508560-177508582 GTTTAGGAATGGTGGGGTGTGGG - Intergenic
918635909 1:186773699-186773721 CTTTAGGTATGACGGGGTTTTGG + Intergenic
918683802 1:187389781-187389803 CTTTAGTCAGGGATGGGATTAGG - Intergenic
923104322 1:230842956-230842978 CTTTAGGACTGGTCTGGATTTGG - Intronic
923975225 1:239255542-239255564 CTTCTGGGATGGTGGGGACTTGG - Intergenic
1063446670 10:6122466-6122488 CGTTCAGCATGGTGGGCATTGGG + Intergenic
1064694351 10:17950677-17950699 CTTCTGGGATGGTGGGGACTTGG - Intergenic
1065078563 10:22105029-22105051 CTTTATGGGTGGTGGGGATGGGG + Intergenic
1066002839 10:31120288-31120310 CTTTTGCCATGGTGGGGGTTGGG + Intergenic
1067356724 10:45535357-45535379 CTTTTGGCATGGTAGGTATAGGG - Exonic
1067582018 10:47452062-47452084 CTTCAGGCATGGTGGGGAGAGGG + Intergenic
1070175637 10:73967091-73967113 CTTCAGGTATGGAGGGTATTAGG + Intergenic
1071291785 10:84194341-84194363 CTTAAGTCCTGGTGGGGCTTGGG - Intergenic
1074404006 10:113165271-113165293 ATTTGGGCATGGTGGGGCATGGG + Intronic
1075018866 10:118932833-118932855 CCTTAATCATGGTGGGAATTGGG + Intergenic
1076893143 10:133294914-133294936 CTTTAGGGATGGTAGACATTGGG - Intronic
1078537826 11:12189247-12189269 CTTTACACATAGTGGGGACTGGG - Intronic
1085779667 11:79396728-79396750 CTTCAGGCATGGTGGCCACTGGG + Intronic
1087016036 11:93555405-93555427 CTTGAGGAATGGGTGGGATTTGG - Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1093371693 12:18374145-18374167 CTTTGGGCATGCTTGGGCTTTGG - Intronic
1096100151 12:48965944-48965966 CTTTAGGGGTGGTGGGGGTCAGG - Exonic
1097483212 12:60158455-60158477 CTTTAGGCATAGAGAGGTTTAGG + Intergenic
1101985504 12:109442970-109442992 CTCTCTGCATGATGGGGATTTGG - Intronic
1102572333 12:113834504-113834526 CTTTAGGCTTGGTGGGCCATAGG + Intronic
1103863975 12:124036933-124036955 CATTAGTCATGGTGGGTATTCGG - Intronic
1104895566 12:132162079-132162101 CATGAGCCATGGTGGGGCTTCGG - Intergenic
1106228904 13:27806770-27806792 CTTAAGGCATTTTGGGGATACGG + Intergenic
1107198504 13:37683704-37683726 CTTTAGGGACGATGGGGAATGGG - Intronic
1107274493 13:38662905-38662927 CTTGAGTGATGGTGGGGATGGGG - Intergenic
1109948038 13:69463612-69463634 CTCTAGGCTTGGTAGTGATTTGG + Intergenic
1110230631 13:73163768-73163790 CTTTAGATAGGGTGGGTATTTGG + Intergenic
1110690779 13:78428101-78428123 CCTTAGGGATGTTTGGGATTAGG + Intergenic
1112323861 13:98430488-98430510 CTGGAGTCATGGTGGGGATGGGG - Intronic
1113030566 13:105989814-105989836 CTTGAGGGATTGTGAGGATTAGG - Intergenic
1114634297 14:24178671-24178693 CTGTAAGAATGGTGGGGGTTGGG + Exonic
1115568930 14:34649037-34649059 CTTTAGGTTTGGAGGGAATTGGG + Intergenic
1116939906 14:50780923-50780945 TCTGAGGCATGGTGGGGATGGGG + Intronic
1117414784 14:55484739-55484761 CCTTAGGCAAGGAGGGGAGTGGG - Intergenic
1122574550 14:102733400-102733422 CAAGAGGAATGGTGGGGATTAGG - Intergenic
1124372620 15:29112056-29112078 CACTGGGCATGGTGGGGATGGGG - Intronic
1126600334 15:50421975-50421997 GTTTAAGAGTGGTGGGGATTAGG - Intergenic
1126822449 15:52518112-52518134 CTCTTGGGATGGTGGGGATGGGG - Intronic
1128260727 15:66231222-66231244 CTTGGGGGATGGTGGGGGTTGGG - Intronic
1128552800 15:68609125-68609147 CTCCAGGGATGGTTGGGATTTGG + Intronic
1129294025 15:74589833-74589855 GTTTGGCCATGATGGGGATTCGG - Exonic
1129720417 15:77875028-77875050 CCTGAGGCATGGAGGGGATGCGG - Intergenic
1130859639 15:87874981-87875003 TTGTAGCCATGGTTGGGATTTGG - Intronic
1137773308 16:51035823-51035845 CTAAAGGGCTGGTGGGGATTGGG - Intergenic
1139452522 16:67042065-67042087 CTTCAGGCATGGTGGTGCTGGGG - Intronic
1140709576 16:77664263-77664285 CTTAGGTCATGGTAGGGATTTGG + Intergenic
1141477143 16:84281599-84281621 CTTTAGGCACGTTAGGGAATTGG - Intergenic
1141703243 16:85651848-85651870 CTTTAGGCCTGGTGTTCATTGGG + Intronic
1144418005 17:15069934-15069956 CTTTGGGTATAGTGGGGAATAGG - Intergenic
1145752142 17:27362849-27362871 CTTCAGGCATGGTGGGTTTCTGG + Intergenic
1146601941 17:34225013-34225035 CTTGAGGCAGTGTGGGGGTTGGG + Intergenic
1147430479 17:40367472-40367494 CTTTAGGCATGGCCGAGAATGGG - Intergenic
1150245359 17:63670679-63670701 CCTTAGGCATGAATGGGATTTGG + Intronic
1151320572 17:73350026-73350048 GATTGGGCATGGTGGGGACTGGG + Intronic
1152166619 17:78712265-78712287 TTTTATGTATGGTGGAGATTGGG - Intronic
1153493445 18:5673447-5673469 CATTTGTAATGGTGGGGATTGGG - Intergenic
1156166194 18:34424115-34424137 CTTGAGGCCTGTTGGGGGTTGGG - Intergenic
1156545641 18:37961203-37961225 CTTTAGCCAGGGTGGGCATGTGG + Intergenic
1158051090 18:53220857-53220879 TTTTAGGAAGGGTGGGGAGTAGG + Intronic
1159584942 18:70274953-70274975 CTTGCGGGATGGTGGGGATGAGG - Intergenic
1160184631 18:76665951-76665973 GGTTAGGGATGGTGGGGATAGGG + Intergenic
1162934667 19:13975803-13975825 CTTTGGCCAGGGTGGGGATAGGG + Intronic
1164583813 19:29452727-29452749 CTTTATCCATGATGGGCATTTGG - Intergenic
1164817471 19:31216258-31216280 CTTGAGACATGGTGGGGGCTGGG - Intergenic
1166650918 19:44574587-44574609 CTTTATGTCAGGTGGGGATTTGG - Intergenic
926178140 2:10615823-10615845 CTTTAGGCATGGTGGGGATTTGG - Intronic
927174545 2:20396342-20396364 CAGTGGGCACGGTGGGGATTTGG - Intergenic
930670698 2:54147304-54147326 CTTGAGGAATGGTGGTGACTGGG + Intronic
931588432 2:63854280-63854302 CTTTAGACATAGAGTGGATTGGG - Intronic
931673449 2:64670691-64670713 CTTTATGCATGGTTCCGATTAGG - Intronic
931845796 2:66202704-66202726 CATTAAGCATGGTGGGGTATTGG + Intergenic
931878991 2:66546473-66546495 CTTTGGTCATGGTGAGGCTTAGG + Intronic
932130386 2:69182054-69182076 CTTGAGGTCTGGTGGGGATATGG + Intronic
932341150 2:70963287-70963309 CGTTGGGCATGGTGAGGATGGGG - Exonic
933381194 2:81548218-81548240 CTTTAAGAATGGTTGGAATTTGG - Intergenic
933444677 2:82364897-82364919 CTTTAAGCAGGGAGGGGATGTGG + Intergenic
934474916 2:94587420-94587442 CTCCAGGCAGGGTGGGGATGGGG + Intergenic
935932489 2:108143028-108143050 CTTTACGGATGCTGGGTATTAGG - Intergenic
936906210 2:117537746-117537768 CTTTAGAGATGGAGGGTATTTGG + Intergenic
937640259 2:124203736-124203758 TTTTAGCCATGGTTGGGATGCGG + Intronic
940824569 2:158396356-158396378 TATGAGGCATGGTGGGGACTGGG - Intronic
940917913 2:159277909-159277931 CTAAAGGCAGGGTGGGGATGTGG + Intronic
942462127 2:176175611-176175633 CTTTGGGGAAGGTGGGGATCAGG + Intergenic
942944585 2:181658435-181658457 CTTTATGTTTGGTAGGGATTTGG - Intronic
947735817 2:232454815-232454837 CCCTAGGCGTGGTGGGGAGTGGG + Intergenic
1169256855 20:4106252-4106274 CTTTAGGCAGGGGAGGGATGAGG + Intergenic
1172152309 20:32799096-32799118 CTGAAGGCTTGATGGGGATTGGG - Intronic
1172539548 20:35700000-35700022 CTTTAGGCAAGTTGGAGACTGGG + Intronic
1173790476 20:45824703-45824725 CTCTAGGCAGGGTGGGGGTTGGG - Intronic
1181431540 22:22884699-22884721 ATTTAGGGATGGTGGGGAGTGGG + Intronic
1181639752 22:24190308-24190330 CTCCAGGCATGGTGGGGCTGAGG + Intergenic
1183432567 22:37774586-37774608 CTTTAGGAAGGGTGGGGTGTGGG - Exonic
1184164603 22:42720264-42720286 CCTTAGGGAGGGTGAGGATTTGG - Intronic
950276474 3:11665610-11665632 CTTCAGGCATGGTCAGGACTTGG - Intronic
951797126 3:26551847-26551869 CTTTAGGCAAAGTTGGAATTAGG - Intergenic
955192485 3:56774221-56774243 CTTTAGGCAAGATGGGGAAAAGG - Intronic
959825973 3:110796304-110796326 GGTTAGGGATGGTGGGGAGTGGG + Intergenic
959830948 3:110861937-110861959 CTTTGGACAAGGTGGGGGTTAGG - Intergenic
960235062 3:115272662-115272684 CTTTTGGAATGGTTGGGGTTTGG + Intergenic
962471149 3:135710498-135710520 CTTTGGGCAAGGTGGGGCTAGGG + Intergenic
968350647 3:198049256-198049278 ATTTAATCATGGTGGGGAGTGGG - Intergenic
970490934 4:16572976-16572998 CTTTAGAGAAGGTGAGGATTCGG - Intronic
971183184 4:24349784-24349806 CTTGAGGGATGGTGTGAATTGGG - Intergenic
971709156 4:30089147-30089169 CTTTTGACATGGCTGGGATTAGG - Intergenic
975104004 4:70548226-70548248 CTTTAAGAATGTTGGGGAATTGG - Intergenic
975323439 4:73034184-73034206 CTTTAATCATGGTGGGGATGAGG - Intergenic
977590777 4:98824158-98824180 ATTTTGTAATGGTGGGGATTGGG - Intergenic
978588829 4:110302278-110302300 CTGGAGGCAAGGAGGGGATTGGG - Intergenic
978932365 4:114330566-114330588 GTGAAGGCATGCTGGGGATTTGG - Intergenic
981195184 4:141911461-141911483 CTCAAGGCATTGTGGGGATGAGG + Intergenic
983122859 4:163910216-163910238 TTTTAGGCTTGGTGGGCAATGGG + Intronic
984549512 4:181144064-181144086 ATGAAAGCATGGTGGGGATTGGG - Intergenic
985069174 4:186151215-186151237 CTTGAGGGATGGTGGTGAGTGGG - Intronic
986884376 5:12215746-12215768 CTTGAAGCAGGGTGGGGAGTTGG + Intergenic
988677232 5:33444865-33444887 GTTTACACATGGTAGGGATTGGG + Intronic
990425256 5:55681942-55681964 CTTTAGGCTTTGTGGGCATACGG - Intronic
990602638 5:57376419-57376441 CTGAAGGCATGTTGGGGTTTTGG + Intergenic
993693243 5:91028496-91028518 CTTAGGGCAGGGTGTGGATTGGG - Intronic
994576952 5:101590410-101590432 TTTTTGGCATGGGTGGGATTGGG - Intergenic
995310111 5:110700880-110700902 CTTTAGGAAAGGTGGGGTTGAGG - Intronic
997355359 5:133259321-133259343 CTTGAGGCAGGGTGGGGGCTTGG + Intronic
997750293 5:136337913-136337935 CCTTCTGCATGATGGGGATTAGG - Intronic
998501934 5:142640731-142640753 CTTTTGGTTTGGTGGGGATGAGG - Intronic
1001340682 5:170841981-170842003 CTTTGGTCATGCTGGGGATATGG + Intergenic
1002075097 5:176703650-176703672 CCCTGGGCATGGTGGGGTTTGGG + Intergenic
1005331267 6:24752868-24752890 CTTGAAACATGGTGGGGACTAGG + Intergenic
1011461188 6:87606139-87606161 TTTTAGGCAGGGTGAGGTTTGGG + Intronic
1012068886 6:94586178-94586200 ATTGTGTCATGGTGGGGATTGGG - Intergenic
1014758727 6:125330598-125330620 CTTTATCCTTGGTTGGGATTAGG + Intergenic
1016811083 6:148261853-148261875 AATTAGGCATGGTGGGGGATGGG + Intergenic
1019056000 6:169223983-169224005 GTTGTGGCATGGTGGGGAGTGGG + Intronic
1021609681 7:22445114-22445136 CTTTGGGCAGGGTTGGCATTGGG + Intronic
1023178969 7:37461937-37461959 CCTTAGGCATGGCAGGGATGTGG + Intergenic
1025709184 7:63891560-63891582 CTTTGGGGAGGGTGGGGATGTGG - Intergenic
1032091053 7:128911752-128911774 CTTTAAGCTTGGTGGAGAGTGGG - Intergenic
1033894589 7:146054976-146054998 CTTTAGGGATATTTGGGATTAGG + Intergenic
1033952709 7:146805061-146805083 CTTTGGGCATAGTGGCCATTGGG + Intronic
1034547026 7:151795681-151795703 CTTCAGGCCTGCTGCGGATTGGG - Intronic
1036678886 8:10856041-10856063 CTTTATGCATGGTGGGGGAGGGG - Intergenic
1037042016 8:14247480-14247502 CTTTAGCCATGGGTGGGCTTAGG + Intronic
1037095451 8:14980934-14980956 AATGAGGCATGGTGGGGAGTAGG - Intronic
1038528298 8:28295993-28296015 CTTGAGGAATGGAGGGGAGTAGG - Intergenic
1041494700 8:58472465-58472487 CATTAGGCATTGTGGGCAGTTGG + Intergenic
1042017170 8:64327126-64327148 CTTTAACCATGGTTGGGGTTTGG + Intergenic
1042207161 8:66340898-66340920 CTTTAGGGATTGTGGTGACTCGG - Intergenic
1043715791 8:83484547-83484569 CTTTGGGTCTGGTGGGGACTTGG + Intergenic
1045664423 8:104469643-104469665 CTTTAGGCATGGTGGGATTCAGG - Intergenic
1046023927 8:108699383-108699405 TTTTAGGCATGGTCGAGAGTAGG - Intronic
1046376178 8:113384080-113384102 TTTTAAGTATGGTGGGAATTTGG - Intronic
1046699515 8:117384094-117384116 CTTTCTGCATGGTGGGATTTGGG - Intergenic
1048608373 8:135994490-135994512 CCTTAGGACTTGTGGGGATTTGG - Intergenic
1052780824 9:32781010-32781032 CATTAGGGATTGTGGGGTTTGGG - Intergenic
1052855138 9:33402340-33402362 CTCCAGGCAGGGTGGGGATGGGG - Intronic
1052963829 9:34323165-34323187 CTTAAGGCAAGATGTGGATTTGG + Intronic
1053683157 9:40498681-40498703 CTCCAGGCAGGGTGGGGATGGGG - Intergenic
1054280557 9:63126247-63126269 CTCCAGGCAGGGTGGGGATGGGG + Intergenic
1054296258 9:63334179-63334201 CTCCAGGCAGGGTGGGGATGGGG - Intergenic
1054394274 9:64638684-64638706 CTCCAGGCAGGGTGGGGATGGGG - Intergenic
1054428924 9:65143883-65143905 CTCCAGGCAGGGTGGGGATGGGG - Intergenic
1054501456 9:65877652-65877674 CTCCAGGCAGGGTGGGGATGGGG + Intronic
1057502076 9:95603896-95603918 ATTTTATCATGGTGGGGATTGGG + Intergenic
1059677171 9:116550550-116550572 GTGTGGGCAAGGTGGGGATTGGG + Intronic
1189739087 X:44100364-44100386 CATTGTGCATGGTGGGGATGTGG + Intergenic
1190105793 X:47560638-47560660 CTTTAGGAATGGGGTTGATTAGG - Intergenic
1191888923 X:65920647-65920669 CTTTTGCTATGGTGGGGGTTGGG + Intergenic
1192229946 X:69257709-69257731 CTTTGGGCTTGGTGGAGGTTGGG + Intergenic
1194130566 X:90075895-90075917 CTTCATGCTTGGAGGGGATTTGG + Intergenic
1195464928 X:105169855-105169877 CTTTATGGATGGTAGGGATTTGG + Intronic
1196553121 X:117054110-117054132 CTCTAGGCATTGTGGGGACAGGG - Intergenic
1199534137 X:148882973-148882995 CTTGTTGCATGGTGGGGATGTGG + Intronic
1201463955 Y:14259212-14259234 CCTTAGGCATGGTGATGATTTGG - Intergenic