ID: 926179578

View in Genome Browser
Species Human (GRCh38)
Location 2:10629702-10629724
Sequence CTTAAGATATAGATTGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926179578 Original CRISPR CTTAAGATATAGATTGAGAG AGG (reversed) Intronic
904534707 1:31191502-31191524 TTGAAGAAATAGATTCAGAGAGG - Intronic
904796816 1:33062481-33062503 CTTACCATATGGAATGAGAGCGG - Intronic
904797699 1:33069828-33069850 CTTACAATATAGAATGAGAGTGG - Intronic
905430204 1:37916992-37917014 CTTAAAATATGGCTTGAGACCGG + Intronic
906915012 1:49999668-49999690 CTTATGATATAGTTTGAGGTTGG - Intronic
907367968 1:53978360-53978382 CTCAATATATACATAGAGAGAGG - Intergenic
908325533 1:63019893-63019915 GGTAAGATAAAGATTGATAGAGG + Intergenic
908876078 1:68677746-68677768 AATAATATATAAATTGAGAGAGG - Intergenic
909030148 1:70529835-70529857 CTGAAGATACAAATTAAGAGGGG - Intergenic
909120454 1:71596690-71596712 CTTAAAATGTGGATTGAGACTGG - Intronic
909430982 1:75587657-75587679 CTTAATATATACTTTGAAAGAGG - Intronic
909562663 1:77023652-77023674 CTTCACAGTTAGATTGAGAGTGG + Intronic
909754406 1:79205336-79205358 CTGAAGATTTATATTGGGAGAGG + Intergenic
909827976 1:80149826-80149848 CTTAAAATATAGTTTGAAATAGG + Intergenic
913053353 1:115136096-115136118 TATAAGATATAGATTGAGGTAGG + Intergenic
913442409 1:118911907-118911929 ATTAAGAGGTAGAGTGAGAGTGG - Intronic
914678923 1:149925653-149925675 CTTAAGAAATGGATTCAGGGTGG + Intronic
918053099 1:180991651-180991673 AATAGGATAGAGATTGAGAGAGG + Intronic
919000705 1:191827664-191827686 CTAAATATATAGCTTGAAAGAGG - Intergenic
920268678 1:204746293-204746315 CTTAAGAGAAAGAGAGAGAGAGG + Intergenic
924287141 1:242499427-242499449 ATGAAGATATAGATAGAGAAAGG - Intronic
1065372136 10:24998103-24998125 CATGAGATATGGGTTGAGAGAGG + Intronic
1071013170 10:80963172-80963194 ATTTAGATATATATTGAGTGTGG - Intergenic
1071353144 10:84767017-84767039 CTGAGTATATGGATTGAGAGAGG + Intergenic
1071619378 10:87105000-87105022 TTTAAAATAAAGATTAAGAGAGG - Intronic
1071687137 10:87770774-87770796 CTTAGGATAGAAATAGAGAGTGG + Intronic
1071741906 10:88368799-88368821 CTTAAGATAGATATTGAAAGTGG + Intronic
1071932295 10:90485690-90485712 CATAAAATAGAGATTGTGAGGGG + Intergenic
1074829376 10:117238051-117238073 CTTAAGGGATGGATAGAGAGGGG - Intergenic
1079661314 11:23040322-23040344 CTTGATATATATATGGAGAGGGG + Intergenic
1082612591 11:55319550-55319572 CTTTATATGTAGAGTGAGAGTGG + Intergenic
1082722310 11:56693537-56693559 CTAAAAATATGGATGGAGAGAGG - Intergenic
1086248464 11:84784430-84784452 CTTAATACAAAGAATGAGAGAGG - Intronic
1087342579 11:96926745-96926767 CTTAGAATTGAGATTGAGAGAGG - Intergenic
1087353095 11:97058745-97058767 CTTAAAATATAGATTTATCGTGG + Intergenic
1087559544 11:99769463-99769485 ATCAAGTTATAGAGTGAGAGAGG - Intronic
1088264719 11:107978217-107978239 CCTAATATATATATAGAGAGAGG - Intergenic
1092174299 12:6392421-6392443 CTTTAGACATAAAATGAGAGAGG + Intergenic
1093629618 12:21392871-21392893 CTTAAGATACATTTTCAGAGAGG - Intronic
1094384092 12:29874807-29874829 TTTAAGATGGAGATTCAGAGAGG - Intergenic
1094505191 12:31055538-31055560 CTGAGGATAAAGATGGAGAGAGG - Intergenic
1098607496 12:72409859-72409881 GATAACATATATATTGAGAGGGG + Intronic
1099729938 12:86488015-86488037 CACAAGATATAGATTAAGAAAGG + Intronic
1100058698 12:90544954-90544976 GTTGAGAAATAGATTGACAGAGG + Intergenic
1106433547 13:29704727-29704749 CTTAAAATCTAGATTCAGACTGG - Intergenic
1106510313 13:30407539-30407561 TTTAAGATATATATTGCGGGGGG - Intergenic
1108699040 13:52928028-52928050 CTTGAACTATAGATTGGGAGGGG + Intergenic
1109354895 13:61223543-61223565 CCTAATATATAGTTTGTGAGGGG + Intergenic
1110184082 13:72653316-72653338 CTTAAAATATACATTGTAAGTGG + Intergenic
1112960818 13:105123911-105123933 CCTAAAATATCCATTGAGAGTGG - Intergenic
1113038875 13:106082779-106082801 ATTCAGATAAAGTTTGAGAGGGG + Intergenic
1113098581 13:106692554-106692576 CTTAAAATATTGATTTAGTGAGG + Intergenic
1116069756 14:40028837-40028859 GTAAAGATAGAGATTGAGGGAGG - Intergenic
1116285201 14:42961927-42961949 CTTCAGATGTAGATTGACTGAGG - Intergenic
1116738141 14:48720466-48720488 CTTAACATATAGTGTCAGAGGGG - Intergenic
1117379028 14:55141539-55141561 CTAGAGATGTAGATTGAGACTGG + Intronic
1117593457 14:57301039-57301061 CATAAAAAATAGATTGAGGGTGG - Intergenic
1120090925 14:80332733-80332755 CTTTATATATATATGGAGAGTGG - Intronic
1120694267 14:87626662-87626684 CATAAAATATAGAGGGAGAGAGG - Intergenic
1122871603 14:104641312-104641334 CTTAAGGGATGGAGTGAGAGCGG - Intergenic
1123190686 14:106566472-106566494 CTTGAGATATGGAGTGTGAGTGG - Intergenic
1123629336 15:22250323-22250345 CTTAAGACTTTGTTTGAGAGTGG - Intergenic
1123645825 15:22437080-22437102 CTTAACATAAACATTGACAGCGG - Intergenic
1124521295 15:30408227-30408249 CTGAACATATAGAAGGAGAGAGG - Exonic
1124537367 15:30557990-30558012 CTGAACATATAGAAGGAGAGAGG + Exonic
1124761288 15:32449597-32449619 CTGAACATATAGAAGGAGAGAGG - Exonic
1124777346 15:32599466-32599488 CTGAACATATAGAAGGAGAGAGG + Exonic
1125455432 15:39854372-39854394 CTTATGATATAGTATTAGAGAGG - Intronic
1125989280 15:44089933-44089955 TTTATGATAAAGAGTGAGAGAGG - Intronic
1126055399 15:44725461-44725483 CTAAAGATAAAGATTTAGAGGGG - Intergenic
1126993981 15:54418508-54418530 CATAAGATATAGATAAAGAAGGG - Intronic
1127794575 15:62426960-62426982 CTTAAGCTATAAATGGAGAGGGG - Intronic
1130260172 15:82348518-82348540 CTTAACATAGACATTGACAGTGG - Intronic
1130268559 15:82430915-82430937 CTTAACATAGACATTGACAGTGG + Intronic
1130472432 15:84236670-84236692 CTTAACATAGACATTGACAGTGG + Intronic
1130479923 15:84351241-84351263 CTTAACATAGACATTGACAGTGG + Intergenic
1130491847 15:84436888-84436910 CTTAACATAGACATTGACAGTGG - Intergenic
1130503461 15:84515928-84515950 CTTAACATAGACATTGACAGTGG - Intergenic
1132029645 15:98429378-98429400 ATTAAGCTAAAGATTGTGAGAGG - Intergenic
1132433826 15:101781167-101781189 CTTAACATAGACATTGACAGTGG - Intergenic
1141123867 16:81386076-81386098 CTAGAGATGTAGATGGAGAGAGG - Exonic
1141743063 16:85907093-85907115 TTTAAGAAATAGTTTTAGAGGGG + Intronic
1141974216 16:87504113-87504135 CTTAAGACTTTGTTTGAGAGTGG + Intergenic
1144103143 17:11961844-11961866 CTGAAGATAAAGAATGGGAGGGG - Intronic
1144401951 17:14913254-14913276 CAAAATATAAAGATTGAGAGAGG + Intergenic
1144497163 17:15755675-15755697 ATAAAGATATAGATAGATAGGGG + Intergenic
1144904466 17:18629230-18629252 ATAAAGATATAGATAGATAGGGG - Intergenic
1149490627 17:57082709-57082731 CTTAAGATATATTTTGAAAGAGG - Intergenic
1155745041 18:29345613-29345635 CTTAAGAGAAAGAATGAAAGAGG + Intergenic
1155990534 18:32274786-32274808 CATTAAATATAGATGGAGAGTGG - Intronic
1158249176 18:55467572-55467594 TTTAAGATATGGAGTGAGAGAGG - Intronic
1162403056 19:10457622-10457644 CATCAGATATGGATGGAGAGTGG - Intronic
1164483691 19:28636666-28636688 TTGTAGATAGAGATTGAGAGGGG + Intergenic
1166244768 19:41517584-41517606 CATAATATATAGAGGGAGAGAGG - Intergenic
925467770 2:4124715-4124737 GTTAAGATACAGATAGAGAAAGG + Intergenic
926179578 2:10629702-10629724 CTTAAGATATAGATTGAGAGAGG - Intronic
926819357 2:16835583-16835605 CTTATTATATGGATGGAGAGGGG - Intergenic
928588516 2:32788622-32788644 GTTAAAGTATAGATTTAGAGGGG - Intronic
932550647 2:72766015-72766037 CTTAAGCTATACAAAGAGAGAGG + Intronic
936625272 2:114141762-114141784 TTTAAAATATAAATTGTGAGAGG + Intergenic
938907549 2:135853113-135853135 CTTCAGGTATAGTTTTAGAGTGG - Intronic
941209538 2:162620208-162620230 ATTAAAATATATATAGAGAGAGG + Intronic
943049505 2:182897898-182897920 CTTTTGATATAGAATGAGAAAGG - Intergenic
943308747 2:186300436-186300458 CTTGACATATAGAGTGTGAGAGG + Intergenic
943890522 2:193280295-193280317 ATTAAGATATAGCATGAGATAGG + Intergenic
944116432 2:196191924-196191946 TTTAACATATAGATTTTGAGAGG + Intergenic
946565004 2:220954654-220954676 ATTTAGAAATAGATTTAGAGAGG - Intergenic
946624421 2:221595294-221595316 TTTAAGATATAGAATGATACGGG + Intergenic
946811112 2:223526768-223526790 CATCAGAGAAAGATTGAGAGAGG + Intergenic
947785215 2:232812126-232812148 TTTAAGATATAGATATACAGTGG + Intronic
1169997176 20:11571464-11571486 ATTAAGATATAGACAAAGAGGGG - Intergenic
1174605985 20:51762000-51762022 CATAAGAGAAAGATTGGGAGAGG - Intronic
1182175077 22:28277103-28277125 TGGAAGATAGAGATTGAGAGTGG - Intronic
1183022570 22:35039095-35039117 CTTGATAAATAGAGTGAGAGAGG - Intergenic
951694369 3:25430049-25430071 CTTAAGAAAAAGTTTCAGAGAGG - Intronic
952284153 3:31952355-31952377 GTTAAGATCTAGGGTGAGAGAGG - Intronic
954936608 3:54332860-54332882 GTTAAGATCTAGATTTATAGCGG + Intronic
955701344 3:61685069-61685091 CTTAAGAAAGAGAATGAGAGAGG - Intronic
958683190 3:97357145-97357167 CCAAAGATATAGATTGAAAGTGG - Intronic
959328117 3:104964017-104964039 ATTAATATATAGAGAGAGAGAGG - Intergenic
960796514 3:121494034-121494056 CTTAAGAAAGAGAGAGAGAGAGG - Intronic
962500925 3:135991392-135991414 CTTAAAATATAGCTAGACAGAGG + Intronic
963597422 3:147346051-147346073 CTTAACATAAAGATGGAGATGGG + Intergenic
963820569 3:149888057-149888079 CTTAAAATACACCTTGAGAGAGG + Intronic
964102915 3:153008092-153008114 ATTGAGATATAAACTGAGAGGGG + Intergenic
965697753 3:171427138-171427160 ATGAAGATATAGATTAACAGTGG - Intronic
965839922 3:172893146-172893168 TTTAACATATAAATTTAGAGGGG - Intronic
966356438 3:179084781-179084803 CTTATGATATAGTTTGAGGTTGG - Intergenic
967030173 3:185598313-185598335 CTTTTGATAAAAATTGAGAGAGG + Intronic
967392594 3:188971917-188971939 CTTACTACATGGATTGAGAGTGG + Intronic
968613699 4:1568088-1568110 CGTAAAATACAGATTAAGAGGGG - Intergenic
970177090 4:13350446-13350468 CTTATGATATAGCCTGAGAAAGG + Intergenic
970215869 4:13759663-13759685 TTGAAGATATAGAGTGAAAGGGG + Intergenic
970643079 4:18089199-18089221 TTTGATATATGGATTGAGAGTGG + Intergenic
972389360 4:38599902-38599924 CTAAACCTATAGATTCAGAGAGG + Intergenic
974585274 4:63866276-63866298 TTTAAAATATTGAATGAGAGTGG - Intergenic
975090573 4:70397862-70397884 GTTAAGAGAAAGGTTGAGAGAGG - Exonic
976633955 4:87268658-87268680 CTTCAGATTCAGATTGAGAAGGG + Intergenic
980315197 4:131190385-131190407 CTTGTGCTATAGATTTAGAGAGG - Intergenic
982790982 4:159591328-159591350 CTTATGTTCTAGATTTAGAGCGG + Intergenic
983481567 4:168280747-168280769 CTTAAGTTATAAATTAACAGAGG - Intronic
983516516 4:168663023-168663045 TTTAAAATATATATGGAGAGAGG - Intronic
984174495 4:176399437-176399459 CTTTAGATTTAAAGTGAGAGTGG - Intergenic
987582263 5:19809370-19809392 CTTAAGATATAGAATTAGAATGG + Intronic
992952361 5:81872873-81872895 CTAAAGAGAAAGATAGAGAGAGG - Intergenic
994501336 5:100581939-100581961 CTTAAGATATGGTTTCAGAAAGG - Intronic
995909453 5:117168194-117168216 CCTAATATATAGATTGAGTGGGG + Intergenic
996615278 5:125433975-125433997 CTTAAGAAATAGATAAAGAATGG + Intergenic
997750131 5:136336380-136336402 GTGAAGAAATAGACTGAGAGTGG - Intronic
998056091 5:139078806-139078828 TTTAAGAGATACAGTGAGAGAGG + Intronic
998594806 5:143517437-143517459 CTTAAGAAATAGCTGAAGAGTGG - Intergenic
1002994042 6:2265829-2265851 CTCAGGAAATAGAGTGAGAGAGG - Intergenic
1003001011 6:2333495-2333517 CTAAAGAAAGAGAATGAGAGAGG + Intergenic
1004501143 6:16211213-16211235 ATAAAGAGATAGATAGAGAGAGG - Intergenic
1005122860 6:22409883-22409905 CCTATGATATTGATGGAGAGAGG + Intergenic
1005615996 6:27573936-27573958 CTTAAAATATAGATAAGGAGAGG - Intergenic
1007158636 6:39770880-39770902 CTGAACATAGAAATTGAGAGTGG - Intergenic
1010653308 6:78480218-78480240 TTTAAGAAATATGTTGAGAGTGG - Intergenic
1011272295 6:85592386-85592408 CTTAAGATAAAGAGTAAGAATGG + Intronic
1015849957 6:137561163-137561185 TTAAAGATATATATTGAGGGAGG - Intergenic
1017366180 6:153642600-153642622 GTTTAGATATATAGTGAGAGTGG - Intergenic
1017381528 6:153837046-153837068 GATAAGATATATATTGAGAAAGG + Intergenic
1019805109 7:3117816-3117838 GTTAAAAGAGAGATTGAGAGAGG + Intergenic
1021408322 7:20299905-20299927 CCTAAGCTATAGTATGAGAGGGG - Intergenic
1022452129 7:30525385-30525407 CTTAACATAGACATTGACAGTGG - Intronic
1022732781 7:33046217-33046239 TTTAAGAAATACATTGAGATGGG - Intronic
1023295782 7:38713860-38713882 CAAACTATATAGATTGAGAGGGG - Intergenic
1026863062 7:73806150-73806172 CTTAAGAAGTAGATTGGGTGGGG - Intronic
1027338376 7:77178942-77178964 ATTAATATATAGGTAGAGAGAGG + Intronic
1029777352 7:102691860-102691882 ATTAATATATAGGTAGAGAGAGG - Intergenic
1031488461 7:122358663-122358685 CTTAAGAGACAGCTTCAGAGAGG + Intronic
1031783941 7:126005104-126005126 CTTGAGTTATAGATTCACAGTGG - Intergenic
1031841988 7:126753847-126753869 CTTAAAATGTAGATTCGGAGGGG - Intronic
1032205721 7:129863459-129863481 CTTCAGAAATAGAGTAAGAGTGG - Intronic
1033853072 7:145521616-145521638 CTAAAGAGATTGATAGAGAGAGG - Intergenic
1034947644 7:155273679-155273701 CATAAGAGAGAGATGGAGAGAGG + Intergenic
1035815564 8:2536267-2536289 CTTAAAATATAGATCGAAAGGGG - Intergenic
1036946172 8:13097040-13097062 CTTAGTATATAGAATGTGAGGGG - Intronic
1038364611 8:26918448-26918470 TTGAAGATAAAGATGGAGAGTGG - Intergenic
1039531683 8:38268711-38268733 TTTAAGATCCTGATTGAGAGAGG - Intronic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1040010503 8:42657421-42657443 TTTAACATATAAATTGGGAGGGG + Intergenic
1047204839 8:122794795-122794817 CTTAAGAGAAAGAATGAAAGGGG - Intronic
1047487646 8:125346331-125346353 CTCAAGATAAAGATGGAGAATGG + Intronic
1048624332 8:136168074-136168096 CCTAAGATATATAATGACAGAGG - Intergenic
1050902812 9:10967214-10967236 CTTAATATACAGGTTGAAAGAGG + Intergenic
1054994870 9:71374413-71374435 CTTAATACATAGTTTGAGAGTGG - Intronic
1058624647 9:106922278-106922300 CTTAGGATATACATTAAGATAGG + Intronic
1059879646 9:118676157-118676179 CAGAATATATAGATTGAGAGTGG + Intergenic
1185956454 X:4496092-4496114 CTCAAGATATAGCTTGGGTGAGG + Intergenic
1188658350 X:32728021-32728043 CTGAAAATATTGATTGATAGAGG - Intronic
1191782635 X:64885300-64885322 CTTAAGAGAGAGAGAGAGAGAGG + Intergenic
1192682253 X:73264015-73264037 CTTTAAAGATAGATTGGGAGGGG + Intergenic
1193731804 X:85110955-85110977 GTAAAGAAACAGATTGAGAGAGG + Intergenic
1196501173 X:116384503-116384525 CTTGATAGAAAGATTGAGAGAGG + Intergenic
1197110567 X:122769243-122769265 TTTAAAATATAGATTTAGGGGGG - Intergenic
1197454857 X:126666413-126666435 CTTATGACATAGATTGAAATGGG - Intergenic
1198158097 X:133982774-133982796 CTTAAAATATGGATGCAGAGGGG + Intronic
1199802189 X:151262491-151262513 CTAAAGGTAAAGATTGAAAGAGG - Intergenic
1200794080 Y:7324875-7324897 GTTAAGATATAGATGTAGACAGG - Intergenic