ID: 926180706

View in Genome Browser
Species Human (GRCh38)
Location 2:10640662-10640684
Sequence TTTAATTAGCATGAGTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926180706_926180708 -8 Left 926180706 2:10640662-10640684 CCCTCATACTCATGCTAATTAAA 0: 1
1: 0
2: 1
3: 13
4: 194
Right 926180708 2:10640677-10640699 TAATTAAAGTCACCATTACTTGG 0: 1
1: 0
2: 0
3: 15
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926180706 Original CRISPR TTTAATTAGCATGAGTATGA GGG (reversed) Intronic
904242873 1:29161220-29161242 TTTAATAGGCATTAGTAGGATGG - Intronic
909369528 1:74868041-74868063 TTAAAATACCATGATTATGAAGG - Intergenic
910142539 1:84041800-84041822 TTTAATTAGCATAATGTTGAGGG - Intergenic
910180028 1:84472631-84472653 GTTAATTAGCTTGATTATGGTGG - Intergenic
910861515 1:91746954-91746976 TTTTATTAACATGAGGCTGAGGG - Intronic
911819476 1:102399358-102399380 TGTTATTACCATGAATATGAAGG - Intergenic
914226896 1:145728159-145728181 TTTGATTGGCTAGAGTATGATGG - Intronic
915769115 1:158399872-158399894 TTTAATTAGCATTATTGTAAAGG + Intergenic
916397729 1:164410469-164410491 TTTAATAAGGATTAGTATTAGGG + Intergenic
917187948 1:172382718-172382740 TTTAATTAGGATTTGTTTGAAGG + Intronic
917569947 1:176254863-176254885 TTTAATTTGCATAAGCATGGGGG + Intergenic
917605696 1:176626721-176626743 TGTAATTAGCATGAGGATTAGGG + Intronic
918748351 1:188236969-188236991 TTTAATGAGAATAAGTATTATGG - Intergenic
919130917 1:193449410-193449432 TTTAATTCGCAAGACTCTGAAGG - Intergenic
920382670 1:205544601-205544623 TTGAATTAGGATGAGGAAGAGGG - Intergenic
921071617 1:211663705-211663727 TTTGATAAGTATAAGTATGAAGG - Intronic
921280091 1:213557821-213557843 TTTGATTAGAATGAGTCTGATGG - Intergenic
921588917 1:216980692-216980714 TTTAAGTAACATGAGTATTGTGG - Intronic
923640300 1:235751471-235751493 TTTGATCAGCATGGGGATGATGG + Intronic
924142014 1:241034789-241034811 TCTATTTAACATTAGTATGATGG - Intronic
924480804 1:244432431-244432453 TTTATTTAGCGTAAGTAGGATGG - Intronic
1062937754 10:1400811-1400833 TTTAATTTGCTTGAGTGGGAGGG + Intronic
1066036634 10:31495061-31495083 TTAAATGAGCAAGAGTGTGATGG + Intronic
1070082359 10:73201622-73201644 TGTCATTAGCCTGAGTAGGAAGG + Intronic
1071810284 10:89172460-89172482 TTTCATCAGCATGAGGATAATGG - Intergenic
1072300808 10:94060066-94060088 TTTAACTTGCATGATTTTGATGG + Intronic
1076906161 10:133362504-133362526 TTTAATCAGCATCTGTATGAAGG + Exonic
1077764245 11:5140643-5140665 ATTTATTAGCATGAGTACTAAGG - Intergenic
1082141298 11:48612480-48612502 TTTGATTAGCATTTGTCTGATGG + Intergenic
1082680621 11:56163856-56163878 GATAATTAGCATGCATATGAAGG - Intergenic
1082900269 11:58241641-58241663 TTTCATTAGCCTGAGTAGAAAGG - Intergenic
1083185176 11:61013531-61013553 TTTAATTCTCAAGAGGATGAAGG - Exonic
1088899741 11:114106337-114106359 TTTAAGAAGCATCATTATGATGG + Intronic
1089950559 11:122521678-122521700 ATTAATTAGCAAGAAAATGATGG - Intergenic
1090983389 11:131744420-131744442 TTTTATTAACTTGAGTAGGAAGG - Intronic
1093215999 12:16361713-16361735 ATAAATTGGCATAAGTATGAGGG + Intronic
1094026260 12:25962356-25962378 TTTAATTCGCATGACGATAAGGG - Intronic
1098575733 12:72039969-72039991 TAGAATTAGCATGAGTCTTAAGG + Intronic
1100056447 12:90517002-90517024 TTTAATGACCATGAGTTTGCTGG - Intergenic
1100082543 12:90870541-90870563 TTTAAACAACATGAGTATAATGG - Intergenic
1106882292 13:34144566-34144588 TTTAATTAGCATCTTTATTATGG + Intergenic
1109406564 13:61908011-61908033 TTTACTTAGCATAAATATAAAGG - Intergenic
1109619525 13:64884104-64884126 TTTAAAAAGTATGTGTATGAAGG - Intergenic
1110029617 13:70590772-70590794 TTTAATTCTCATGAGTAAGTAGG + Intergenic
1111387357 13:87544394-87544416 TTTGATTTGCATGTGTCTGATGG - Intergenic
1111547552 13:89762190-89762212 TTTAATTTGCATTATTCTGATGG + Intergenic
1112454497 13:99546358-99546380 TTTAATTCTCATTAGTAGGAAGG + Intronic
1115428943 14:33293822-33293844 ATTAATTAGCCAGAGTATTAAGG + Intronic
1116056188 14:39866537-39866559 TTTAGTTACCATGGGTATTATGG - Intergenic
1116631039 14:47333699-47333721 TTAAATTTGTGTGAGTATGAAGG - Intronic
1116912097 14:50479422-50479444 GTTAATTAACATGTGTCTGATGG - Intronic
1117381584 14:55169323-55169345 TTTAAGTAGCAGGAGTAAAATGG - Intronic
1117741435 14:58823098-58823120 TTCAATTACCATGAGCTTGATGG + Intergenic
1118796151 14:69146951-69146973 TTTAATTAGAATGAATTTGTTGG - Intronic
1124972358 15:34500628-34500650 TTTAATTAGGTTGAATATAATGG + Intergenic
1127486678 15:59424439-59424461 TTTGATTAGCATTAGTATACAGG - Intronic
1128202248 15:65818849-65818871 TTTAATTAGGAATAGTTTGATGG + Intronic
1128443340 15:67734883-67734905 TTTAATTTGCAAGAGTTTAAAGG + Intronic
1135108019 16:19667770-19667792 GTTAATTAGTATGATTATGTTGG + Intronic
1135619413 16:23942619-23942641 TTTAATTATCCTCAGTATGTAGG - Intronic
1137981816 16:53076285-53076307 TTTAATTAGGCTGGGTGTGATGG + Intronic
1143805215 17:9420587-9420609 CTTAGTAAGCATGAGCATGAAGG - Intronic
1145228817 17:21155304-21155326 TTTAATTAGTGTTAGTATGGTGG - Intronic
1145848740 17:28069605-28069627 TTTAATTTGCATTACCATGATGG + Intronic
1150016799 17:61565284-61565306 TTGAATTAGCATTAGTAGTAGGG + Intergenic
1150523718 17:65898721-65898743 TTTAATTTGCATGATACTGATGG + Intronic
1151244406 17:72783438-72783460 CTCAATTTCCATGAGTATGAAGG - Intronic
1152986131 18:322922-322944 TTTAAAAAAAATGAGTATGAAGG + Intronic
1153328688 18:3849386-3849408 TTCTAATAGGATGAGTATGAGGG + Intronic
1156602300 18:38623864-38623886 TTTAATAAGCATGAAAATGTAGG + Intergenic
1156683950 18:39621833-39621855 TTTAATGTGCAGGAGTACGAGGG - Intergenic
1157035155 18:43962881-43962903 TTTTACTAGCAGGAGTATTATGG - Intergenic
1158844453 18:61426977-61426999 TTTAAGAAGCAACAGTATGAAGG + Intronic
1159096402 18:63907094-63907116 TTTCATTTGCATGTGTATGGAGG - Intronic
1159193787 18:65084805-65084827 TTTAATTATCATATTTATGAAGG + Intergenic
1159444096 18:68518897-68518919 TTTGATTTGCATGAACATGATGG - Intergenic
1165272215 19:34720305-34720327 ATTAATTACCTTGAGTATGGTGG + Intergenic
924959944 2:25665-25687 TTTAATTCTCTTCAGTATGAAGG + Intergenic
925153984 2:1636377-1636399 TTTAATTGACATGAGTAAGTGGG - Intronic
925422313 2:3722965-3722987 TTTTGTTACCATGAGTATGCAGG + Intronic
926180706 2:10640662-10640684 TTTAATTAGCATGAGTATGAGGG - Intronic
926201192 2:10799373-10799395 TTTAATCAGCATGAAGCTGAGGG + Intronic
926686701 2:15703803-15703825 CTTACTTAGCATGAAGATGAGGG - Intronic
926888663 2:17620297-17620319 TTTAAGTAGCATGGGTAGGATGG + Intronic
931778261 2:65558175-65558197 TTTCATCTGCATGAGAATGATGG - Intergenic
931981292 2:67696140-67696162 CTCAATTAGAATCAGTATGAAGG + Intergenic
934533449 2:95112443-95112465 GTTACTTAGCATGATTAAGAGGG - Intronic
935828502 2:106975119-106975141 TGTAATTTGCATGAGCATCAGGG + Intergenic
937721799 2:125106840-125106862 TTTATTAAGGATGAGTCTGATGG + Intergenic
939489359 2:142858380-142858402 TTTTATTGGCATAAGAATGAAGG - Intergenic
941014158 2:160335661-160335683 TTTAATTGGCATGACTATATGGG - Intronic
943277581 2:185887275-185887297 TCTATTTTGCATTAGTATGAAGG - Intergenic
943917958 2:193662157-193662179 TTTAATACGCATTAGTAAGATGG + Intergenic
945629019 2:212248201-212248223 TTTAATTTTGATGATTATGAAGG - Intronic
945785435 2:214229428-214229450 TTTAATTTTCATTATTATGAAGG + Intronic
946552612 2:220819724-220819746 TTTAAATAGCATTTCTATGATGG + Intergenic
1171374550 20:24683523-24683545 TTTAATTGGTATGAGTTTAAAGG - Intergenic
1171740543 20:28880439-28880461 TTTGATTTGCATTACTATGATGG - Intergenic
1172284322 20:33730599-33730621 TTTAATTACAATGTGTATGCCGG - Intergenic
1173403294 20:42743619-42743641 TCTAATTAGCAGGAGAATGAAGG + Intronic
1174976649 20:55343293-55343315 TTTAAAAAGCATGTGTATGAAGG - Intergenic
1177907136 21:26985572-26985594 TTTATTTAGCTTAAATATGATGG + Intergenic
1178210645 21:30527459-30527481 ATTAATTGGCATGAGTTTGAAGG + Intergenic
1181880624 22:25976819-25976841 TTAAATGAGCTTGAGTAAGAAGG - Intronic
949653951 3:6194774-6194796 TTTGATTGGCATGGGTATGTGGG - Intergenic
952539711 3:34355052-34355074 AATAATTAGGAAGAGTATGAGGG - Intergenic
955258543 3:57360336-57360358 TTTATTTTGCATGAATGTGATGG - Intronic
956477569 3:69639142-69639164 TTAAAATAGCATGAGTTAGATGG + Intergenic
959109848 3:102109461-102109483 TTTAATTTGCATTTGTCTGATGG + Intronic
959130568 3:102350994-102351016 TTTACTAAGCATGAGTATCCTGG + Intronic
959744849 3:109764541-109764563 TTTAATTTGCATGTCTCTGATGG - Intergenic
960483626 3:118224273-118224295 TTTAATTTGCATTTGTCTGATGG + Intergenic
963271371 3:143289146-143289168 TGTAATTAGCATGGGTGGGAGGG + Intronic
965250642 3:166339934-166339956 TTTAATTAATATGTGTATCATGG - Intergenic
965434116 3:168625946-168625968 CTTACTTAGCATGAGAATGAGGG + Intergenic
965727774 3:171737116-171737138 TTTATTTAGCATGAAAATGTTGG - Intronic
967656784 3:192060208-192060230 TTTAATTAAAATGAATCTGAAGG + Intergenic
970258412 4:14195822-14195844 ATTAATTTGTATTAGTATGATGG - Intergenic
970739143 4:19212625-19212647 TTTAATGAGTATGTGTATTAAGG - Intergenic
971037468 4:22709826-22709848 TTTAATTTGCATGAATATTCTGG + Intergenic
971104817 4:23512799-23512821 TGTATTTAGCATGATGATGAGGG + Intergenic
972087425 4:35236673-35236695 TTTAATTGGCATGTGTATTCTGG + Intergenic
973141785 4:46778113-46778135 CTTAACTGGCATGAGTCTGAAGG + Intronic
974921487 4:68246054-68246076 TTTCATCTGCATGAGAATGATGG - Intergenic
975130901 4:70831733-70831755 TTTTATTAGTATGTGAATGATGG - Intronic
975238454 4:72029015-72029037 CTTAATTAGCATGCATATGACGG - Intergenic
975364340 4:73511185-73511207 ATTATTTAGCATGAGGATAATGG - Intergenic
976343843 4:83976924-83976946 TATAATCAGAATGAGTTTGAAGG - Intergenic
976731778 4:88269260-88269282 TTTAATTAGGTTGGCTATGATGG + Intronic
980049589 4:128025817-128025839 TTTAATTAACTTAAGCATGAGGG + Intronic
981409466 4:144411895-144411917 TTTGGTTAGTAAGAGTATGAAGG - Intergenic
983041204 4:162929896-162929918 TATCATTGGCATGTGTATGAGGG + Intergenic
984075253 4:175169023-175169045 CTTAATTAGGATGTGTATAATGG + Intergenic
984422667 4:179544672-179544694 TTTCATTAGGATGATTATAATGG + Intergenic
988932743 5:36052878-36052900 TTCAATTAGCTTGAGTATGAGGG - Intronic
991291716 5:65039453-65039475 TTTCATAAGAATGACTATGAGGG + Intergenic
991339967 5:65598173-65598195 TTTAATTACCATGTATATTATGG + Intronic
992111072 5:73494495-73494517 TCTATTTAACAAGAGTATGATGG + Intergenic
993657062 5:90591102-90591124 TTTAATGAGGCTGAGCATGATGG + Intronic
996706825 5:126506332-126506354 TCTAAATAGCATGGGTATGTAGG - Intergenic
996861839 5:128076032-128076054 TTTTAAAAACATGAGTATGAAGG - Intergenic
997297985 5:132780634-132780656 TTTAAATAGCATCTGTATTATGG - Intronic
999592757 5:153166894-153166916 CTTAATTAACACGAGTATTAGGG - Intergenic
1000541000 5:162539975-162539997 TTTAAATAGGATGATTATGGTGG + Intergenic
1000675054 5:164111520-164111542 TTTAATTTTCATGGTTATGATGG - Intergenic
1002954586 6:1849337-1849359 TTTGATCAGCATGCGTATGGTGG - Intronic
1003155877 6:3593609-3593631 TTTAATTAGCACCAGTGTCAAGG + Intergenic
1005216837 6:23538906-23538928 TTTAATTCTCATGAATAGGAAGG - Intergenic
1005225940 6:23642014-23642036 TTTATTTAGCATGTGTATCTAGG - Intergenic
1005297384 6:24439625-24439647 TTTAATTTGCATGATTGAGAAGG - Intronic
1005452482 6:25987110-25987132 TTTAAATAGTATGAGTGTGAAGG - Exonic
1011630538 6:89319654-89319676 TTTAATTTGCATTTCTATGATGG - Intergenic
1012101844 6:95099427-95099449 TTTAAATAGCATGACATTGAAGG - Intergenic
1012127547 6:95449943-95449965 TTTACTTAGCCTGAGAGTGAAGG - Intergenic
1012219289 6:96628814-96628836 TTTAATCAACAAGAGTATAAAGG + Intergenic
1012642780 6:101641075-101641097 TTGAATTAGCTTTAATATGAAGG + Intronic
1012711834 6:102616864-102616886 TTTGATGAGTATGAGTTTGATGG - Intergenic
1013255682 6:108382407-108382429 TTTATTTAGTATGAATATGCTGG - Intronic
1016101931 6:140113663-140113685 TGAAATTAGGATGAGTTTGATGG - Intergenic
1016818383 6:148324755-148324777 CCTAGTTAGCCTGAGTATGAGGG + Intronic
1017381241 6:153833315-153833337 TCTGATGAGCATGAGAATGAAGG - Intergenic
1021686232 7:23189460-23189482 AAAAATTAGCCTGAGTATGATGG + Intronic
1022405001 7:30080770-30080792 TCTGATTAGTATGAATATGATGG + Exonic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022760016 7:33338849-33338871 TCTACCTGGCATGAGTATGAAGG + Intronic
1024083512 7:45875026-45875048 ATAAATTAGAATGAGTCTGAGGG + Intergenic
1024116512 7:46199299-46199321 TTTAATTAGCTGGATTATGTTGG - Intergenic
1024909150 7:54425048-54425070 ATAAATTATCTTGAGTATGAAGG + Intergenic
1027715728 7:81667722-81667744 TTTAATTAGTATGTGAATCAGGG - Intergenic
1027898262 7:84074169-84074191 TTTGATTAGCAGAAGAATGAGGG - Intronic
1028196262 7:87911452-87911474 GTTAATTAGCATCAGCATGGAGG - Intergenic
1029031352 7:97470808-97470830 TTAAATAAACTTGAGTATGAAGG + Intergenic
1029045761 7:97626456-97626478 TTTAATAAGTATGTGAATGATGG + Intergenic
1030508231 7:110451360-110451382 ATTAATTATCAGGAGCATGAAGG - Intergenic
1032239619 7:130150545-130150567 TTTAAGTAGCATGAATATCACGG - Intergenic
1032973753 7:137196832-137196854 TTTACTTAGCAGGAGGATTAGGG + Intergenic
1034066571 7:148142606-148142628 GTTATATAGCATGAGCATGATGG - Intronic
1034755162 7:153610050-153610072 TTATTTTAGCATGAGTATGTAGG - Intergenic
1034933047 7:155178986-155179008 TTTAATTTGCATGTCTCTGATGG - Intergenic
1037005115 8:13768476-13768498 TGAAATAAGCATGAGAATGAAGG + Intergenic
1041196411 8:55406160-55406182 TTTAATTAATATGATAATGAGGG + Intronic
1045461380 8:102428705-102428727 GTTAATTAGCATCAGTATATGGG - Intergenic
1046278963 8:111999784-111999806 TTTAATGAGCATGGGTTAGAAGG - Intergenic
1046737502 8:117792747-117792769 TTTAATTTGGATTAGTATTAAGG + Intergenic
1052181002 9:25527675-25527697 TTTGAGTAGCTTGAGGATGAAGG - Intergenic
1052395814 9:27936704-27936726 TTTCTTTACCATGAGTAGGAAGG - Intergenic
1052635997 9:31105111-31105133 TTTAATTAGGTTGTTTATGATGG + Intergenic
1053012815 9:34644681-34644703 TTTAATTAGCATGATTCAGGGGG + Intronic
1055026512 9:71728076-71728098 TTCATTTAGCCTGAGTATGGTGG + Intronic
1055851528 9:80636579-80636601 TTGGAATAGCATGAGAATGAGGG - Intergenic
1056172340 9:83997946-83997968 TTTAATTAGCCTGAGCATGGTGG - Intronic
1056603318 9:88063825-88063847 TTTCATTATAATGAGTGTGATGG - Intergenic
1056955861 9:91080546-91080568 TTTAATTTGCATGCCCATGAAGG - Intergenic
1058736078 9:107895318-107895340 TATGTTTAGCATGAATATGAAGG - Intergenic
1058974540 9:110113845-110113867 TTTAAAAAGCATGAATATGTTGG + Intronic
1185737865 X:2506773-2506795 TTTAAATAGGAAGAGTATGCTGG - Intergenic
1187048509 X:15673923-15673945 TCTAATTAGCAGGAGTATTTTGG - Intergenic
1188802144 X:34545605-34545627 TTTAATTTGCTTGAATTTGATGG - Intergenic
1189205197 X:39232083-39232105 TTTATTTAGCATGGGTCTGTGGG - Intergenic
1191655115 X:63587539-63587561 TTTAATTTGCATGTCTCTGATGG + Intergenic
1193268312 X:79499541-79499563 TTTAATTTGTATGTGTCTGATGG - Intergenic
1193691405 X:84649229-84649251 TTTGCTAAGCATGAGCATGAGGG - Intergenic
1195478088 X:105309969-105309991 TTTGAGTATCATGATTATGATGG + Intronic
1196644544 X:118102671-118102693 TTTAATTAGCCTTACTATGTAGG - Intronic
1197195987 X:123701036-123701058 TTTTATAAGCAAGATTATGACGG - Intronic
1198224783 X:134635250-134635272 TTTAATTAGAATAAGGATGAAGG + Intronic
1198224966 X:134636712-134636734 TTTAATTAGAGTAAGGATGAAGG - Intronic
1199228217 X:145405087-145405109 TGTCCTTAGAATGAGTATGAAGG + Intergenic
1199256571 X:145724813-145724835 TTTACTTAGGATGAATATGTGGG + Intergenic