ID: 926181357

View in Genome Browser
Species Human (GRCh38)
Location 2:10646713-10646735
Sequence GTGGTGGCCCTGAGCAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 7, 3: 31, 4: 280}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926181357_926181363 20 Left 926181357 2:10646713-10646735 CCTCCCTTGCTCAGGGCCACCAC 0: 1
1: 0
2: 7
3: 31
4: 280
Right 926181363 2:10646756-10646778 CTGACAGTCTACCAATTCCAAGG 0: 1
1: 0
2: 2
3: 72
4: 1119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926181357 Original CRISPR GTGGTGGCCCTGAGCAAGGG AGG (reversed) Intronic
900088672 1:909964-909986 GTGGGGGTCCTGGGCAGGGGCGG + Intergenic
900385667 1:2409499-2409521 GTGGTGGTACAGAGCAGGGGCGG - Intronic
900609000 1:3536557-3536579 GTGGCGGCACTGAGTAGGGGAGG - Intronic
901017838 1:6242039-6242061 GTGGTGGCCCTGGGAACGGCGGG + Intergenic
901129505 1:6953497-6953519 AAGGCGGCCCTGAGCAAGGAAGG - Intronic
901628878 1:10638740-10638762 GCGGTGGCCCTGCTCTAGGGAGG - Exonic
902621013 1:17651241-17651263 GTGGAGGCCGTCGGCAAGGGAGG + Intronic
902621715 1:17654697-17654719 GAGGTAGCCCTGTGGAAGGGAGG - Exonic
904312835 1:29640381-29640403 GTGGTGGACCTGGGCAGGAGGGG + Intergenic
904824525 1:33265779-33265801 GGGAGGTCCCTGAGCAAGGGAGG - Intronic
906932541 1:50183729-50183751 ATGGAGGCCCTTAGCAAGGCAGG - Intronic
908311843 1:62891983-62892005 ATGGTGTCCCTGACCTAGGGAGG - Intergenic
909251614 1:73364145-73364167 GTGGTTGCCCTGAGGATGAGGGG - Intergenic
911381547 1:97121175-97121197 GTGGAGCCCCTGAGCAGGTGAGG + Intronic
912812971 1:112807707-112807729 GAGGGTGCCCTGAGCAAGTGGGG + Intergenic
915303206 1:154963109-154963131 CAGGAGGCACTGAGCAAGGGAGG + Exonic
916295685 1:163216782-163216804 GTGATGGCCCTGAGAAAGGGTGG + Intronic
916942745 1:169693255-169693277 GTGACGGCACTGAGGAAGGGTGG - Intronic
917854773 1:179091381-179091403 GTGGTGGTCCTGAAGATGGGAGG + Intronic
918021996 1:180703168-180703190 GTGGTGGCAGTGGGCAAGGTGGG + Intronic
918130024 1:181619347-181619369 GTGAAGGCCCTGAGGAAGGAGGG + Intronic
919781482 1:201224155-201224177 GTGGTGACCCTGAGCAGGGTGGG - Intronic
919914975 1:202133663-202133685 GTGGGGGCCCTGGGGAGGGGCGG + Exonic
920698061 1:208196790-208196812 GTGTTGTCCCTGAGAATGGGTGG + Intronic
920766644 1:208840032-208840054 GTGGTTGCCCTGTGAAAGGCAGG + Intergenic
921152889 1:212415646-212415668 GTGTTGGCCCTGTGGCAGGGTGG + Intergenic
921294740 1:213691150-213691172 GGGGTGGCCCTGAGCCAGGGAGG - Intergenic
922769795 1:228175672-228175694 CTGGGGCCCCTGAGCATGGGTGG - Exonic
923113675 1:230914099-230914121 CAGGAGGCCCAGAGCAAGGGAGG + Intronic
923540328 1:234884167-234884189 GTGAAGGCCCCGAGAAAGGGTGG + Intergenic
1063157182 10:3390733-3390755 ATGGATGCCCTGAGCAAGCGAGG - Intergenic
1063974049 10:11401446-11401468 GTGGTGGCCCTGTGGCTGGGCGG - Intergenic
1069583013 10:69577924-69577946 GAGGCGGCCCTGAGCAGGGAGGG - Intergenic
1069997035 10:72348710-72348732 GGGGTTGCTCTGAGTAAGGGAGG + Intronic
1070361739 10:75697081-75697103 GTGGTGGCCATGAGGCAGTGAGG + Intronic
1070737297 10:78871996-78872018 GTAGTGGCCCTGGGAAGGGGTGG - Intergenic
1070820355 10:79350642-79350664 GTGGAAGTCCTGAGCCAGGGTGG + Intronic
1070842427 10:79496511-79496533 GTGTTAGCCCTGAGCAGGGCAGG - Intergenic
1071515696 10:86295326-86295348 GTGATGGCCTGGAGCAAAGGAGG + Intronic
1071991648 10:91105504-91105526 GTGCTGGCCCTGTGCAGGGAGGG + Intergenic
1072561990 10:96585840-96585862 GTGGTAGACTTGAGCAAGGCAGG - Intronic
1075581264 10:123620237-123620259 CTGGTGGCCCAGAGGAAAGGAGG + Intergenic
1076370770 10:129951682-129951704 GTGGTGGCCCTGACCCACCGCGG + Intronic
1076700014 10:132266710-132266732 GGGGAGGCGCTGGGCAAGGGAGG + Intronic
1076733945 10:132450555-132450577 GGGGTGCCTCTGAGCACGGGAGG - Intergenic
1076785080 10:132745655-132745677 GTGGTGGCCCTGGGCATGGTGGG + Intronic
1076785131 10:132745809-132745831 GTGGTGGCCCTGGGTATGGTGGG + Intronic
1076888783 10:133274227-133274249 GTGCAGGCCCTGAGCGAGGAGGG + Exonic
1077154349 11:1084785-1084807 CTGGGGGCCCTGAGCACGGGTGG + Intergenic
1077562536 11:3272885-3272907 GTGAGAGCTCTGAGCAAGGGAGG - Intergenic
1077568429 11:3318704-3318726 GTGAGAGCTCTGAGCAAGGGAGG - Intergenic
1077865330 11:6217520-6217542 GAGGTGGCATTGAGCAATGGGGG - Exonic
1078301204 11:10133557-10133579 CTGCTGGCCCTGGGCAATGGGGG - Intronic
1078413592 11:11147575-11147597 GAGGTGGCCTTTTGCAAGGGAGG - Intergenic
1078663286 11:13304257-13304279 GGGCTGGCCCTGAGCCGGGGTGG + Intronic
1079332628 11:19546354-19546376 GTGGTGGCTGTGACCAATGGAGG + Intronic
1080123526 11:28704614-28704636 GAGGTGAGCCTGAGGAAGGGTGG + Intergenic
1081486187 11:43531290-43531312 GTGGTGGCACAAAGAAAGGGTGG - Intergenic
1081658036 11:44870255-44870277 GTGGTGGCCCGGGGCTGGGGTGG - Intronic
1081794337 11:45809278-45809300 GTGGGAGCTCTGGGCAAGGGAGG + Intronic
1081840533 11:46197943-46197965 GTGGCTGCCTTGAGCAGGGGAGG - Intergenic
1083155808 11:60822138-60822160 GTGGTGGCCCAGAGACAGAGAGG + Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1083474797 11:62908916-62908938 GTGGTGGCTGTGAGCCAGGAGGG + Exonic
1084484117 11:69438121-69438143 AGGGTGGTCCTGAGGAAGGGTGG + Intergenic
1084955568 11:72689492-72689514 GTGGTGGCTGGGAGCAATGGTGG - Intronic
1088297550 11:108317021-108317043 GAGGTGCCCTTGAGCCAGGGAGG - Intronic
1089215514 11:116832391-116832413 CTGGTGGCTCTGAGCAGGGTAGG - Intronic
1089492620 11:118893373-118893395 GTGGTGGTGCTGATGAAGGGAGG - Intronic
1091010692 11:131998004-131998026 GGGGTTGCCTTGAGCAAAGGTGG - Intronic
1091695856 12:2627679-2627701 GGGGTGGCGCTGAGGGAGGGAGG - Intronic
1091950810 12:4591507-4591529 GGAGTGGCTCTGGGCAAGGGCGG + Intronic
1092649639 12:10619881-10619903 GTGGTGGACCTGTGCAAAGGAGG - Exonic
1094377722 12:29809229-29809251 GTGATTGCCTAGAGCAAGGGAGG + Intergenic
1094666704 12:32527374-32527396 GTGGTGCCCCTGGTCAAGTGAGG - Intronic
1096214820 12:49793072-49793094 GGAGGGGCCCTGAGTAAGGGTGG - Intronic
1096392271 12:51238743-51238765 CTGGAGGCCCGGAGCAGGGGCGG + Intronic
1096493852 12:52027732-52027754 CTGGTGGCCCTGGGCACAGGGGG + Intronic
1100603270 12:96130537-96130559 GAGCTGGCACTGAGCTAGGGTGG - Intergenic
1101576519 12:106002041-106002063 GTGGTTGGAGTGAGCAAGGGAGG + Intergenic
1102766820 12:115440604-115440626 GTCCAGGCCCTGAGCCAGGGAGG + Intergenic
1103937445 12:124484044-124484066 GGGGTGGTCCGTAGCAAGGGAGG - Intronic
1104071522 12:125350018-125350040 GTGGTGCCCCCGAGCAGGGCTGG - Exonic
1105306134 13:19170317-19170339 TTGGTGGCCCTGAGGTAGCGAGG - Intergenic
1106037463 13:26057098-26057120 GTGCTGGCACAGAGCAAAGGAGG + Intergenic
1110497796 13:76189983-76190005 GTGGTCGCCCAGAGCGAGCGAGG - Intergenic
1110549607 13:76797831-76797853 GGGGTGGCACTGAGCCTGGGAGG - Intergenic
1113729285 13:112628086-112628108 GAGGCAGCCCTGAGCAAGGCTGG - Intergenic
1113834581 13:113320297-113320319 GTGGAGGACCTGAGCTAGGGTGG + Intronic
1113859602 13:113472708-113472730 TTGGCAGCCCTGAGCAAGGCTGG + Intronic
1114725654 14:24933250-24933272 GAGGATCCCCTGAGCAAGGGAGG + Intronic
1116656953 14:47665638-47665660 CTGCCGGCCCTGAGCAATGGGGG + Intronic
1119756972 14:77126163-77126185 GTGGTGACCCTGGGCAGGGCAGG - Intronic
1122887386 14:104716168-104716190 GGGCTGGCTCTGAGCAAGGCTGG - Intronic
1123469073 15:20536762-20536784 CTGGGGGCCCTTAGCATGGGTGG - Intronic
1123551790 15:21386391-21386413 GGGGTGCCCCTGAGCGAAGGGGG - Intergenic
1123648988 15:22463929-22463951 CTGGGGGCCCTTAGCATGGGTGG + Intronic
1123729348 15:23131750-23131772 CTGGGGGCCCTTAGCATGGGTGG - Intronic
1123747516 15:23329232-23329254 CTGGGGGCCCTTAGCATGGGTGG - Intergenic
1124279877 15:28353084-28353106 CTGGGGGCCCTTAGCATGGGTGG - Intergenic
1124302821 15:28558520-28558542 CTGGGGGCCCTTAGCATGGGTGG + Intergenic
1124371813 15:29108398-29108420 GTGGTGGCCCAGAGCAGGAGGGG - Intronic
1127265135 15:57355047-57355069 GTGTTGGCCCTGGGCAGGGAGGG + Intergenic
1129598594 15:76983791-76983813 GAGGTGGCCCTCAGCAGTGGAGG + Intergenic
1129714120 15:77837092-77837114 ACGGTGGCCCAGAGAAAGGGAGG + Intergenic
1129906508 15:79191304-79191326 GGGGCGGCACTGTGCAAGGGCGG + Intergenic
1132544055 16:524940-524962 GTGGTGGCCCAGAGAAAGGCGGG + Intergenic
1132758216 16:1496239-1496261 AGGGTGCCCCTGAGCGAGGGAGG - Intronic
1133662599 16:7933538-7933560 GCGGTGTCCCCGAGGAAGGGCGG - Intergenic
1134423429 16:14115887-14115909 ATGGTGGCCCAGAGCATGGAGGG - Intronic
1136231467 16:28888095-28888117 GAGGTTGCACTGAGCAAGGCCGG - Intronic
1137781030 16:51098036-51098058 GTGTTGGCAGTGAGCAGGGGAGG + Intergenic
1138552560 16:57755503-57755525 GATGAGGCCCTGTGCAAGGGTGG - Intronic
1139581657 16:67877427-67877449 GTGGTGGGACTGAAGAAGGGTGG + Intronic
1140508741 16:75492159-75492181 GCAGTGGCTCTGAGCCAGGGAGG - Intronic
1141570197 16:84929528-84929550 GCTGTGGCCATGAGCGAGGGTGG + Intergenic
1141657182 16:85422472-85422494 GGGGTGGGGCTGAGCAAGGAAGG + Intergenic
1141701234 16:85643024-85643046 GGGGTGGGCCTGAGCCTGGGTGG + Intronic
1142281490 16:89150508-89150530 CTGGTGTCCCTGGGCAGGGGCGG - Intronic
1142594074 17:1021105-1021127 GTGGTGGCCCTGCCCAAGGCAGG + Intronic
1143325415 17:6095268-6095290 GTGGTGGTCCTGAGAGAGGGGGG + Intronic
1143674503 17:8422078-8422100 GTGGGAGCCCTGAGAAAAGGTGG + Intronic
1143779983 17:9224343-9224365 GTGGCCGCCCTGGGCAATGGGGG + Intronic
1143790942 17:9295129-9295151 GTGTTGGCCAAGAGCCAGGGAGG - Intronic
1144055450 17:11536697-11536719 GAGGTGGATATGAGCAAGGGTGG - Intronic
1144675277 17:17158006-17158028 TTCTTGGCCCTGAGCAAGGCAGG + Intronic
1147617037 17:41835875-41835897 GTGGGCGCCCTCCGCAAGGGCGG - Exonic
1147637764 17:41974376-41974398 GTGGTGGCTCTGAGAAGGGGAGG + Exonic
1148786202 17:50147399-50147421 GTGGGGCCCCTGTGCCAGGGTGG + Intronic
1149654761 17:58304466-58304488 CAGGTGGCCCTGCGCAGGGGTGG + Intronic
1150802609 17:68293691-68293713 GTGGAGGCACTGAGCACTGGAGG + Intronic
1151324111 17:73368378-73368400 GAGGGGGCCCTGAGGAGGGGAGG - Intronic
1151948520 17:77332695-77332717 GTGGTTGCCCTGGGGAAGGTGGG - Intronic
1152316534 17:79583848-79583870 GTGGTGGCCATGGGAAAGGAGGG + Intergenic
1152409971 17:80118241-80118263 GCTGTGGCCCTGACCAAGGGTGG + Intergenic
1152897683 17:82922729-82922751 GTGGGGGCCATGAGCAGAGGAGG - Intronic
1154452703 18:14489783-14489805 GGGGTGCCCCTGAGCGAAGGCGG - Intergenic
1155774091 18:29737365-29737387 GTGGTGGCACTGGGCAGGGTTGG + Intergenic
1157769074 18:50328686-50328708 GTGGTTGCCCAGAGCCAAGGAGG - Intergenic
1158254490 18:55530546-55530568 GAGGTGGCCCTGAAAAGGGGGGG + Intronic
1158291970 18:55953437-55953459 GTGATGGCCCTGAGTATGGGAGG + Intergenic
1158490542 18:57906097-57906119 GTGGTGGTGCTGAGGAAGGCCGG + Intergenic
1160811214 19:1013744-1013766 GTGGTGGCCTTGGGCACTGGTGG - Intronic
1160929893 19:1565709-1565731 CTGGTGGCCGTCAGCAAGGCAGG - Intronic
1163020672 19:14479474-14479496 GTTGTGGGCCAGAGCCAGGGCGG + Exonic
1163505806 19:17705474-17705496 GGTGTAGCCCTGAGCTAGGGCGG - Intergenic
1163729904 19:18942879-18942901 GTGGTGGCGCTGAGCCTGGAAGG - Intergenic
1164526134 19:29014936-29014958 GAGGCTGCCCTGAGCAAGGAGGG - Intergenic
1165120437 19:33555382-33555404 GTGGTGGCCCTATGGAAGGATGG - Intergenic
1165375192 19:35436992-35437014 GTGCTGACCCTGAGCCAGGGAGG - Intergenic
1165382233 19:35489616-35489638 GTGGTGTCACTGAGCTGGGGGGG - Intronic
1166675426 19:44737958-44737980 GTTGTGGCCTTGAGTAGGGGAGG + Intergenic
1167821455 19:51932153-51932175 ATGGTGGCCCTCAGCAAAGCTGG + Intronic
925611372 2:5705767-5705789 GTGGAGGACCTGAGAAGGGGTGG + Intergenic
926130155 2:10297936-10297958 GTGGTGGTCCACAGCAGGGGAGG + Intergenic
926181357 2:10646713-10646735 GTGGTGGCCCTGAGCAAGGGAGG - Intronic
927010154 2:18895785-18895807 CTGGTGGCCCTGGGGAAAGGAGG - Intergenic
927856362 2:26530204-26530226 GAGATGGCCCTGTGAAAGGGAGG + Intronic
931641674 2:64386128-64386150 GTTGAGGCCCTGACCAAGTGTGG + Intergenic
932119851 2:69088559-69088581 GTGGTTGCCATGACCAAGGGAGG - Intronic
933105036 2:78313762-78313784 GAGGTGGCCTTGAACCAGGGAGG + Intergenic
933728484 2:85439442-85439464 ATGGAGGCTCTGAGCAGGGGTGG + Intergenic
934948505 2:98559769-98559791 GTGGTTGACCTGAGGTAGGGAGG + Intronic
935276121 2:101476593-101476615 ATGGTGTCCCTGTGGAAGGGAGG - Intergenic
935725528 2:106020839-106020861 GTGGAGGCCCTGAGAAACGTCGG - Intergenic
936061267 2:109297135-109297157 GTGGGGGCAGTGAGCTAGGGAGG + Intronic
936427841 2:112435150-112435172 GTGGTGGTCGAGAGCGAGGGAGG - Intergenic
937090766 2:119204881-119204903 GTGGTGGCCCTGCACAGGGACGG + Intergenic
937220967 2:120343286-120343308 ATGGTGGCCTTGAGCCAGGCTGG - Intergenic
937773795 2:125752089-125752111 GTGGAGACCCAGATCAAGGGAGG - Intergenic
938295056 2:130172757-130172779 TTGGTGGCCCTGAGGTAGGGAGG - Intronic
938299766 2:130201614-130201636 GTTGGAGCCCTGAGGAAGGGGGG - Intergenic
938461571 2:131501078-131501100 TTGGTGGCCCTGAGGTAGGGAGG + Intergenic
940015673 2:149101587-149101609 ATGTTGGCCTGGAGCAAGGGAGG + Intronic
942089398 2:172474243-172474265 GTGGTGGACCTCAACAAGGATGG + Exonic
942092592 2:172508403-172508425 GGTGTGGCCCAGTGCAAGGGTGG + Intergenic
943591568 2:189804176-189804198 TTGGTGTCACTGAGCAAAGGCGG - Intronic
945437013 2:209830814-209830836 GAGGTGGCTCTGAGGAAGAGGGG + Intronic
1168835292 20:873619-873641 ATGGGGGCCCAGAGGAAGGGAGG - Intronic
1168995788 20:2132218-2132240 CTGGTGGCCCTGAGACAGTGCGG - Intronic
1171053398 20:21882964-21882986 GTGGTAGCTCAGAGCAAGGGAGG + Intergenic
1172474370 20:35226444-35226466 GGGGTAGCCCTGAGCAGGAGGGG - Intergenic
1175421365 20:58836188-58836210 GTGGTGTGCGTGAGCAAGTGGGG - Intergenic
1175847430 20:62065963-62065985 GTGGCGGCCCTGCGCAGGCGCGG + Intergenic
1175905559 20:62377835-62377857 GTGGTGGCGCTGTGGGAGGGAGG + Intergenic
1175997730 20:62818939-62818961 CTGCTGGCCCTTAGCCAGGGAGG + Intronic
1176048158 20:63103189-63103211 GTTGGGGCCCTGAGCGAGGCTGG - Intergenic
1176302675 21:5105999-5106021 GTGCTGGCCCAGAGCCAAGGCGG - Intergenic
1179171568 21:38976935-38976957 GTGGTGGGTCTGAGTTAGGGTGG + Intergenic
1179854350 21:44155924-44155946 GTGCTGGCCCAGAGCCAAGGCGG + Intergenic
1180072761 21:45444655-45444677 GTGGAGGCTGTGAGCCAGGGAGG + Intronic
1180127681 21:45803415-45803437 GGGGTGGTCCTGAGGAAAGGAGG + Intronic
1181001785 22:19991173-19991195 GGGGTGGCCCTGTGAAATGGAGG - Intronic
1181288518 22:21772505-21772527 GTGCTGGCCCTGAGGATGGCCGG - Intronic
1182130221 22:27845161-27845183 TTGGTGGCCCGGAGCCAGGCTGG + Intergenic
1182144644 22:27989999-27990021 CTGGTGGAGCTGAGGAAGGGGGG + Exonic
1182420532 22:30246509-30246531 GTGGCGGCCCGGAGCGAGCGCGG - Intronic
1183712568 22:39514049-39514071 GAGGTGGCCCAGAGCCGGGGTGG - Exonic
1184347340 22:43921933-43921955 ATGGAGGCCCAGAGCAAGGCAGG - Intergenic
1184528552 22:45040118-45040140 GTGTTGGGCCTGAGCATGGCAGG - Intergenic
1184931164 22:47682325-47682347 GTGGTGCCCCTCAGCAAGGGTGG - Intergenic
1185028797 22:48430879-48430901 GGGGAGGGCCTGAGCAAGAGAGG - Intergenic
949883228 3:8677155-8677177 ATGGGCGTCCTGAGCAAGGGGGG - Intronic
952316762 3:32238665-32238687 GTGGAGGCCCGGAGGAGGGGAGG - Exonic
953376506 3:42432767-42432789 GTGATGTCCGTGAGAAAGGGTGG - Intergenic
953517712 3:43612429-43612451 GTGGTATCCCTGAGAAAGGCAGG - Intronic
953880448 3:46688595-46688617 GAGGAGGCCCAGAGCCAGGGGGG - Intronic
954194205 3:48986669-48986691 GGAGTGGCCCTGAGCATGGGTGG - Intergenic
954610708 3:51943261-51943283 GTGCTGGCCCAGGGCAGGGGTGG + Intronic
955107604 3:55913755-55913777 ATGATGGGCATGAGCAAGGGAGG - Intronic
961455017 3:127019742-127019764 GAGCTGGCCCTGAGCAGGGTGGG + Intronic
962100739 3:132339665-132339687 GTGGTGGTCCTGAAGAAGGCAGG - Intronic
962398759 3:135039681-135039703 CTGCTGGCCCCGAGCAAGGGGGG - Intronic
962853303 3:139323861-139323883 GTGATGACCCTGAGGAGGGGTGG - Intronic
963076786 3:141354603-141354625 GTGCTGACCATGAGCAAGGGAGG - Intronic
965792852 3:172408300-172408322 GTGGAGGGCCTCAGCAAGGGTGG - Intergenic
965939218 3:174157114-174157136 GTGGTGGACCTGAGGATGTGTGG + Intronic
966651331 3:182304216-182304238 GCTGTGGCCTGGAGCAAGGGTGG + Intergenic
966987341 3:185193311-185193333 GTTTTGGTCCTGACCAAGGGTGG + Exonic
967377837 3:188825642-188825664 GTGGTGACCCTGGGCTGGGGAGG - Intronic
967751560 3:193121607-193121629 GTGGTGGCTCTCAGCAAGACGGG + Intergenic
967966410 3:194963671-194963693 AAGATGGCCCTGAGCAATGGGGG + Intergenic
968456715 4:704150-704172 GGGGTGGCCCAGTGCAGGGGAGG - Intergenic
969296999 4:6276114-6276136 GCTGTGGCCCTGAGCTTGGGAGG + Intronic
969595687 4:8148215-8148237 GTGGGGGCCCTGGGCCAGGCAGG + Intronic
969619584 4:8272387-8272409 GAGGTGGCCGTGAGCGTGGGGGG + Intronic
976188779 4:82469220-82469242 GTTTTGGTCCTGAGCAAGGAGGG + Intergenic
976970268 4:91094722-91094744 GCGATGGCCCTGAGTATGGGCGG - Intronic
977237759 4:94528953-94528975 GTGGTGGCCCTCTGTCAGGGAGG + Intronic
977878675 4:102178987-102179009 GTGATGGCTCTGAGCAGGGTGGG - Intergenic
980108209 4:128608490-128608512 GTGGAAGCCCTGAGCAAGAGAGG + Intergenic
984286147 4:177731046-177731068 GTGGTAGCCCTGGACATGGGTGG - Intronic
984619565 4:181937088-181937110 GAGGTGGCCCTGGGCAAAGCAGG + Intergenic
985692894 5:1323360-1323382 GTGCTGGCCCTGAGCCAAGAGGG - Intronic
986669138 5:10127468-10127490 GTGGTGGCGCTGGGGAAGCGAGG + Intergenic
988833044 5:35005568-35005590 GTGCTGGCCCAGAGCAAGGTCGG - Intronic
989011338 5:36876422-36876444 GTGGTGGTCGTGAGCGTGGGGGG - Intergenic
990819797 5:59825407-59825429 GTGGTGGCACTGCACATGGGTGG + Intronic
991035591 5:62124454-62124476 GTGGGGGCCCTGAGCAACGGAGG + Intergenic
991702928 5:69332806-69332828 GTGGTGGCCCGGAGGACGCGCGG - Intronic
992084459 5:73265506-73265528 ATGGTATCCCTGGGCAAGGGTGG + Intergenic
994043552 5:95284463-95284485 GGGGTGGGCAGGAGCAAGGGCGG - Exonic
1001633924 5:173196450-173196472 GAGGTGGCCCTGGACAGGGGCGG - Intergenic
1001789515 5:174443881-174443903 GTGGAGGCACGGAGTAAGGGAGG - Intergenic
1002474162 5:179454470-179454492 GTGGGGGCCATGAGCAGAGGAGG - Intergenic
1002596747 5:180328668-180328690 GTGCTGTCCCTGAGCAGGGCAGG - Intronic
1003506838 6:6746657-6746679 GTGGTGGCACAAAGCAAGGACGG - Intergenic
1003911552 6:10748157-10748179 GAGGCGGCACTGAGTAAGGGAGG - Intronic
1004731903 6:18366775-18366797 GTGTTGGCCCAGATCGAGGGTGG - Intergenic
1005888654 6:30117745-30117767 GTGGTGGCCCTGTGCACTGTAGG + Intergenic
1006090529 6:31626041-31626063 TTGGTGGCCCTGAGCCTCGGGGG - Exonic
1011143687 6:84189477-84189499 CTGCTGGCCCTGGGCAATGGGGG + Intronic
1011585812 6:88924021-88924043 CTGGAGGCCCTGAGGAGGGGTGG + Intronic
1011637531 6:89388177-89388199 ATGGGGGCCCTGAGCCAGGGTGG - Intronic
1011664551 6:89622009-89622031 GAGGTGGCCCAAAGCAAGGTGGG + Exonic
1014101928 6:117520486-117520508 GCGTTGCCCCTGAGCTAGGGAGG - Intronic
1014822755 6:126010833-126010855 GTTGTGACCATGAGGAAGGGAGG - Intronic
1016372895 6:143392932-143392954 GAGGTCGCCCTGAGCAAGTCAGG + Intergenic
1016995370 6:149958832-149958854 GTGGGGGCCATGAGCAAGACTGG - Intergenic
1017003241 6:150010672-150010694 GTGGGGGCCATGAGCAAGACTGG + Intergenic
1017012852 6:150074710-150074732 GTGGGGGCCATGAGCAAGACTGG + Intergenic
1017766600 6:157612043-157612065 GGGCTGGCCCTCAGCAAGGTGGG - Intronic
1018068724 6:160142333-160142355 CTGGTGGCTTTGAGCAGGGGTGG + Intronic
1018851743 6:167645254-167645276 GAGGTGTCGGTGAGCAAGGGCGG - Intergenic
1019573514 7:1725068-1725090 GTTCTGTCCCTGAGCAAGGTTGG + Intronic
1023822535 7:43988082-43988104 GTGGTGGCCCTCAGCAACGGTGG - Intergenic
1025224037 7:57141341-57141363 GTCTTGGCCCTGTGCAAAGGGGG - Intergenic
1025745624 7:64240079-64240101 GTGTTGGCCCTGTGCAAAGGGGG + Intronic
1026911152 7:74092699-74092721 GGGCTGGCCCTGGGCAAGGAGGG + Intronic
1029750798 7:102541497-102541519 GTGGTGGCCCTCAGCAACGGTGG - Exonic
1029768753 7:102640608-102640630 GTGGTGGCCCTCAGCAACGGTGG - Exonic
1033004455 7:137546276-137546298 CTGATGGGCCTGAGCAAGGGAGG - Intronic
1033097222 7:138442182-138442204 ATGTTGGCCCAGATCAAGGGTGG + Intergenic
1034501360 7:151452975-151452997 GTGGGGGCCCTGAGCTAAGCTGG - Intergenic
1034801669 7:154059320-154059342 ATGGGGGCCCTAAGCCAGGGGGG - Intronic
1034936027 7:155201543-155201565 GGGGTGCCTCTGAGCAAGGCAGG - Intergenic
1035278601 7:157763430-157763452 GCGGTGGCCCTGAGCCAGGCTGG + Intronic
1035450424 7:158973996-158974018 GTGGGGGGCCTGGGCGAGGGTGG - Intergenic
1035450443 7:158974036-158974058 GTGGGGGGCCTGGGCGAGGGTGG - Intergenic
1035461639 7:159042828-159042850 GGGGTGGCACTGAGGCAGGGAGG - Intronic
1036612500 8:10362509-10362531 GTGGTGGAACTGGGCATGGGAGG + Intronic
1036820190 8:11933900-11933922 GTGGTGGCCAAGAGTACGGGCGG - Intergenic
1039437189 8:37567673-37567695 GTGGGGGCCCCGGGCCAGGGTGG + Intergenic
1043358492 8:79441543-79441565 GTGGTGGCCCTTAAAAAGGGGGG + Intergenic
1044429744 8:92095280-92095302 GGGGTGGCCAGGAGGAAGGGGGG - Intronic
1044573791 8:93747353-93747375 TTTTGGGCCCTGAGCAAGGGGGG + Intergenic
1048306413 8:133287703-133287725 GGGGCTGCCCTGAGCACGGGAGG + Intronic
1049982863 9:920785-920807 GGGGTGACCCTGAGCAAGCCAGG + Intronic
1053268891 9:36736422-36736444 GTGGTGTACCTGAGCAAAGAGGG - Intergenic
1053738950 9:41120104-41120126 GTTGTGTCCCTAAGCACGGGTGG - Intergenic
1054689397 9:68311212-68311234 GTTGTGTCCCTAAGCACGGGTGG + Intergenic
1057022084 9:91707149-91707171 GTGGAGGCCATGACCAAGGAGGG - Intronic
1057139563 9:92718367-92718389 CTGGGGGCCCTGAGCAGGGGAGG + Intronic
1057208008 9:93184769-93184791 CTGGGGGCCCTGGGAAAGGGGGG - Intergenic
1058712880 9:107696268-107696290 GTGGTGTGCCTGAGAAAGGCAGG + Intergenic
1059479556 9:114578113-114578135 GTGGTTGCCAGGAGCAAGGCGGG - Intergenic
1060256596 9:122036103-122036125 GTGGGGGTCCGGAGCAAGGGCGG - Intronic
1060551047 9:124485586-124485608 GTGGTGACCCTGGGGAAGTGAGG - Intronic
1060951769 9:127608528-127608550 GTGCTGGCCCAGCGCAGGGGTGG - Intergenic
1061063490 9:128262982-128263004 CTGGGGGCCCTCAGCATGGGTGG - Intronic
1061416367 9:130449228-130449250 GTGGTGGCACTGAGCTGGGATGG + Intronic
1061682730 9:132250903-132250925 GGGGAGGCCCTGAGCAGGGCTGG + Intergenic
1061841908 9:133363527-133363549 GTGGTGGCCCTGGGCCCTGGGGG - Exonic
1062034608 9:134377353-134377375 CAGGTGGCCCAGAGCATGGGAGG + Intronic
1062566093 9:137164621-137164643 GTGGGGGCCAAGAGCAAGAGCGG - Intronic
1185603867 X:1355815-1355837 GGGTTGGCCCTGGGCAGGGGTGG + Intronic
1185909698 X:3970453-3970475 GTGATGGCCCCGAGTATGGGTGG + Intergenic
1186415526 X:9380296-9380318 GGGTTGGCCCTGAGCACAGGTGG - Intergenic
1186595666 X:10979104-10979126 ATGGTGGCCCTGAGGATGGATGG - Intergenic
1190702421 X:52998712-52998734 GGGTCGGCCCTGAGCAAGGATGG + Intergenic
1191617210 X:63182145-63182167 GTGGTGGCTCAGAGAAAGGAAGG - Intergenic
1191619088 X:63196778-63196800 GTGGTGGCTCAGAGAAAGGAAGG + Intergenic
1191740975 X:64434827-64434849 CAGGAGGCACTGAGCAAGGGAGG - Intergenic
1192182410 X:68924444-68924466 CTGGTGGCCATGAACAAGGGTGG - Intergenic
1192349595 X:70346395-70346417 GTGATGGCCATGAACAATGGTGG - Intronic
1195067926 X:101254304-101254326 ATGGTGGGCATGAGCAAGAGTGG + Intronic
1199363213 X:146946037-146946059 GTGGGGCACCTCAGCAAGGGAGG + Intergenic
1200072364 X:153535532-153535554 GAGGAGGCCCGGAGGAAGGGTGG - Intronic
1200780335 Y:7209897-7209919 CTGCTGGCCCTGAGGAAGGTGGG + Intergenic