ID: 926185924

View in Genome Browser
Species Human (GRCh38)
Location 2:10690521-10690543
Sequence CTGCCTCGCCCCCGCCCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 269}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926185924_926185929 13 Left 926185924 2:10690521-10690543 CCTCCCGGGCGGGGGCGAGGCAG 0: 1
1: 0
2: 2
3: 19
4: 269
Right 926185929 2:10690557-10690579 CCCAGCGAATGAAGGCGACCAGG 0: 1
1: 0
2: 1
3: 2
4: 43
926185924_926185932 30 Left 926185924 2:10690521-10690543 CCTCCCGGGCGGGGGCGAGGCAG 0: 1
1: 0
2: 2
3: 19
4: 269
Right 926185932 2:10690574-10690596 ACCAGGGTGCGAATTCCGAGTGG 0: 1
1: 0
2: 0
3: 4
4: 43
926185924_926185927 5 Left 926185924 2:10690521-10690543 CCTCCCGGGCGGGGGCGAGGCAG 0: 1
1: 0
2: 2
3: 19
4: 269
Right 926185927 2:10690549-10690571 CGAGTGAACCCAGCGAATGAAGG 0: 1
1: 0
2: 0
3: 2
4: 52
926185924_926185931 14 Left 926185924 2:10690521-10690543 CCTCCCGGGCGGGGGCGAGGCAG 0: 1
1: 0
2: 2
3: 19
4: 269
Right 926185931 2:10690558-10690580 CCAGCGAATGAAGGCGACCAGGG 0: 1
1: 0
2: 0
3: 5
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926185924 Original CRISPR CTGCCTCGCCCCCGCCCGGG AGG (reversed) Intergenic