ID: 926195130

View in Genome Browser
Species Human (GRCh38)
Location 2:10759100-10759122
Sequence TAAATGCCCCCGGAGGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926195130_926195137 9 Left 926195130 2:10759100-10759122 CCTATCTCCTCCGGGGGCATTTA 0: 1
1: 0
2: 0
3: 11
4: 62
Right 926195137 2:10759132-10759154 TGCCTGCAGCCGGTCAGACCTGG 0: 1
1: 0
2: 0
3: 11
4: 133
926195130_926195135 -1 Left 926195130 2:10759100-10759122 CCTATCTCCTCCGGGGGCATTTA 0: 1
1: 0
2: 0
3: 11
4: 62
Right 926195135 2:10759122-10759144 AGGGCACCACTGCCTGCAGCCGG 0: 1
1: 0
2: 0
3: 32
4: 296
926195130_926195141 27 Left 926195130 2:10759100-10759122 CCTATCTCCTCCGGGGGCATTTA 0: 1
1: 0
2: 0
3: 11
4: 62
Right 926195141 2:10759150-10759172 CCTGGTCCAAAAGTCACTTCTGG 0: 1
1: 0
2: 0
3: 10
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926195130 Original CRISPR TAAATGCCCCCGGAGGAGAT AGG (reversed) Intronic
902180319 1:14683394-14683416 TAGGAGCCCCCGGAGGAGAATGG - Intronic
902763976 1:18602828-18602850 TACAGGCCCCTGAAGGAGATGGG - Intergenic
906263538 1:44410981-44411003 TAAAGGCCCCCGGAACAAATTGG - Intronic
907105062 1:51875464-51875486 TAAATTCCACCGGGGGAGAAAGG - Intronic
909876035 1:80804843-80804865 TAAAGGCCACCTGAGGAAATTGG + Intergenic
918238869 1:182604414-182604436 TAAATCCCCTCGGAGGAGCGGGG + Intergenic
919411938 1:197256567-197256589 TAAATGCCCACTGAGCAGAAGGG + Intergenic
921698969 1:218245621-218245643 TAAATCCCCCCTGATGATATGGG + Intergenic
1063864010 10:10344663-10344685 CAAATGCCCTTGGAGGAGATTGG + Intergenic
1074392688 10:113071344-113071366 TAAATGCTGCAGGAGGACATGGG + Intronic
1076490586 10:130858776-130858798 GAAATGTCCCTGGAGGAGAAAGG + Intergenic
1078643615 11:13118417-13118439 CAAAAGCCCTCAGAGGAGATAGG + Intergenic
1082699895 11:56415741-56415763 AAAATTCACCTGGAGGAGATTGG - Intergenic
1083510510 11:63205187-63205209 TAAATGCCCACAGAGGAAAGTGG + Intronic
1084777995 11:71389756-71389778 TAAATTCTCCTGGAGGAGAGTGG - Intergenic
1085076308 11:73596275-73596297 TAAATACACCAGGAGGAGAGGGG + Intronic
1085181428 11:74540167-74540189 TAAATGCCCCAGTAGGAGACCGG + Intronic
1091019224 11:132083641-132083663 TAAAAGCCCCCTGGGGATATTGG - Intronic
1093850533 12:24031405-24031427 TAAATGGACCTGGAGGAGCTAGG + Intergenic
1094211818 12:27901167-27901189 AAAATGCACCCGGAGGAGACTGG + Intergenic
1094813709 12:34164655-34164677 AAAATGCAGCAGGAGGAGATGGG + Intergenic
1103212666 12:119178438-119178460 TCAATGCCCTCTGGGGAGATTGG - Intergenic
1116853200 14:49928864-49928886 TAAATTCCCCCTGAGGAGAAAGG - Intergenic
1124841236 15:33244062-33244084 TAAATGCCCCCACAGGCCATGGG + Intergenic
1124970825 15:34488699-34488721 GAAATGTCCCAGGAGTAGATGGG + Intergenic
1126850326 15:52792703-52792725 TAAATGCCCTTGGGGGAGAGGGG - Intergenic
1127673043 15:61213659-61213681 AAAATGCCCCGAGAGGAGTTAGG - Intronic
1130297367 15:82656766-82656788 AAAATGCCCCCGGGGGATGTGGG + Intergenic
1133985080 16:10662246-10662268 CAAATGCCCCTGGGGGAAATGGG + Intronic
1139621173 16:68144407-68144429 TAAATGCCCCAGAGTGAGATTGG - Intronic
1152710249 17:81867715-81867737 TAAATGCCCCTGAAGGAGCTGGG - Exonic
1160188455 18:76694871-76694893 TGAATGCCCACTGAGGAAATTGG - Intergenic
1165362144 19:35343407-35343429 AAAATACCCCTGGAGGAGATGGG - Intronic
1166418772 19:42617406-42617428 TAAAAGCCCCAGGAGGAGACTGG + Intronic
926195130 2:10759100-10759122 TAAATGCCCCCGGAGGAGATAGG - Intronic
926743830 2:16134506-16134528 TAAATGCCACTGGAGAAGGTTGG - Intergenic
931642262 2:64392308-64392330 TAGATGCCCCTGGAGGAAAGGGG + Intergenic
933129176 2:78651641-78651663 TAAATGCCTCTGGAGGTGAAGGG - Intergenic
933818990 2:86092500-86092522 TAAAACGCCCTGGAGGAGATTGG - Intronic
941229626 2:162895409-162895431 TAAATGCACAAGGAGGAGATGGG - Intergenic
944385997 2:199165186-199165208 TGAAAGCCCTCAGAGGAGATAGG - Intergenic
946810144 2:223514863-223514885 TACATGCCCACTGAGAAGATGGG - Intergenic
1172474722 20:35227618-35227640 TAAAAGCTCTCGGAGGGGATTGG + Intronic
1176245885 20:64096489-64096511 TAAATTCCCCCTGAAGAGCTTGG + Intronic
1180953080 22:19729539-19729561 AAAAGGCCCCAGCAGGAGATAGG + Intergenic
1181309155 22:21934324-21934346 ACAATGCCCCGGGAGGTGATGGG - Intronic
1183719743 22:39555782-39555804 AAAATGTCCCTGGAGGAGAATGG + Intergenic
953827036 3:46262424-46262446 TAAATGCTGCATGAGGAGATTGG + Intronic
959776070 3:110165032-110165054 TAAATGGCTCCAGGGGAGATGGG - Intergenic
962981305 3:140492878-140492900 AAACTGCCCCCGCAGGAGACAGG + Intronic
963852454 3:150222252-150222274 TAAATCCCCCCAGAGGACTTGGG - Intergenic
964016974 3:151959940-151959962 CAAAAGCCCCTGGAAGAGATAGG + Intergenic
965027960 3:163327239-163327261 TAAAAGCCCCGTGGGGAGATTGG + Intergenic
966891461 3:184410298-184410320 TGAGGGCCCTCGGAGGAGATAGG - Intronic
976779038 4:88738270-88738292 TAAAAGCCAGCAGAGGAGATGGG + Intronic
990727636 5:58774340-58774362 TAAATGATCCCAGAGGAGAGGGG - Intronic
995468347 5:112474345-112474367 AAAGTGCCCCTGGAGGAGATGGG - Intergenic
998365743 5:141629660-141629682 TAAGTAGCCCAGGAGGAGATGGG - Intronic
1002455223 5:179342403-179342425 TAAATATCCCTGGAGGAGCTGGG - Intronic
1005840323 6:29740938-29740960 TAAGTGACCCCTGGGGAGATTGG - Intergenic
1020042114 7:5012172-5012194 TAGGTGCCCCAGGAGGAGAGGGG - Intronic
1023326055 7:39058275-39058297 TCAATGCCCCCGGATGAATTTGG + Intronic
1028019650 7:85754177-85754199 TAAATGCCCACAGAGAAAATGGG + Intergenic
1030988751 7:116274028-116274050 TAAGTGACCCAGGAGGAGAAGGG + Intergenic
1036393846 8:8349677-8349699 AACATGCCCCCAGAGAAGATTGG - Intronic
1039992579 8:42502235-42502257 TAAAGGTCTCAGGAGGAGATGGG - Intronic
1047191316 8:122681481-122681503 AAAATGCAGCCGGAGGAGATGGG - Intergenic
1047408806 8:124607333-124607355 TAAATGACCCCAGATGAGTTTGG - Intronic
1047924064 8:129665562-129665584 TAAAGGCACAGGGAGGAGATGGG + Intergenic
1049966621 9:785820-785842 TAAATGCTCCCAGTGGAAATGGG - Intergenic
1051527387 9:18061622-18061644 TAGATGCCCCCAGAGAAGCTGGG + Intergenic
1189895384 X:45650123-45650145 CAAAAGCTCTCGGAGGAGATAGG - Intergenic
1196312655 X:114186499-114186521 TAAATGCCCCTGGAGAAAATGGG + Intergenic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic