ID: 926195130

View in Genome Browser
Species Human (GRCh38)
Location 2:10759100-10759122
Sequence TAAATGCCCCCGGAGGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926195130_926195135 -1 Left 926195130 2:10759100-10759122 CCTATCTCCTCCGGGGGCATTTA 0: 1
1: 0
2: 0
3: 11
4: 62
Right 926195135 2:10759122-10759144 AGGGCACCACTGCCTGCAGCCGG 0: 1
1: 0
2: 0
3: 32
4: 296
926195130_926195137 9 Left 926195130 2:10759100-10759122 CCTATCTCCTCCGGGGGCATTTA 0: 1
1: 0
2: 0
3: 11
4: 62
Right 926195137 2:10759132-10759154 TGCCTGCAGCCGGTCAGACCTGG 0: 1
1: 0
2: 0
3: 11
4: 133
926195130_926195141 27 Left 926195130 2:10759100-10759122 CCTATCTCCTCCGGGGGCATTTA 0: 1
1: 0
2: 0
3: 11
4: 62
Right 926195141 2:10759150-10759172 CCTGGTCCAAAAGTCACTTCTGG 0: 1
1: 0
2: 0
3: 10
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926195130 Original CRISPR TAAATGCCCCCGGAGGAGAT AGG (reversed) Intronic