ID: 926195512

View in Genome Browser
Species Human (GRCh38)
Location 2:10761417-10761439
Sequence GAGGGTAACCAGGAGGATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 386}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926195512_926195527 29 Left 926195512 2:10761417-10761439 CCGCCATCCTCCTGGTTACCCTC 0: 1
1: 0
2: 3
3: 34
4: 386
Right 926195527 2:10761469-10761491 GGGCCTGTACCCTTGCTACAAGG 0: 1
1: 0
2: 0
3: 4
4: 106
926195512_926195520 8 Left 926195512 2:10761417-10761439 CCGCCATCCTCCTGGTTACCCTC 0: 1
1: 0
2: 3
3: 34
4: 386
Right 926195520 2:10761448-10761470 CCCTGCTCTTACTTCCACCCCGG 0: 1
1: 0
2: 0
3: 17
4: 241
926195512_926195522 9 Left 926195512 2:10761417-10761439 CCGCCATCCTCCTGGTTACCCTC 0: 1
1: 0
2: 3
3: 34
4: 386
Right 926195522 2:10761449-10761471 CCTGCTCTTACTTCCACCCCGGG 0: 1
1: 0
2: 1
3: 19
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926195512 Original CRISPR GAGGGTAACCAGGAGGATGG CGG (reversed) Intronic
900300849 1:1976382-1976404 GAGGGGAAGCAAGAGGGTGGAGG - Intronic
900551119 1:3256102-3256124 GAGGTTAACCAGGAGGGACGAGG + Intronic
900961435 1:5923610-5923632 GAGGATTACCAGGTGGCTGGAGG - Intronic
901229040 1:7631782-7631804 GAGGGTAGCCAGGAGGCAGGGGG - Intronic
902142398 1:14367577-14367599 AAGGGTGACCAGTAGGCTGGAGG - Intergenic
902743232 1:18455036-18455058 GAGGGTACACAGGAGGGAGGTGG - Intergenic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903223651 1:21882986-21883008 GATGGTGACCAGGAGGGAGGAGG - Intronic
904039335 1:27575298-27575320 GAGGGAAACCAGGCGGCTGGGGG + Intronic
904417671 1:30373116-30373138 GCCAGTCACCAGGAGGATGGGGG - Intergenic
904601336 1:31674216-31674238 GAGGGTGGCCAGGATGAGGGGGG + Intronic
905109836 1:35587263-35587285 GAGGCTAAGCAGGAGGATGGAGG + Intronic
905204080 1:36332998-36333020 TGGGGTAACAAGGAGGAGGGGGG - Intergenic
905602718 1:39268213-39268235 GAAGGTAACGTGGAGGAAGGAGG - Intronic
906096505 1:43227822-43227844 GAGGGAAAACTGGAGGAAGGGGG - Intronic
906140218 1:43530005-43530027 GAGGGTGAACATGAGGATGAAGG + Intronic
906323079 1:44828542-44828564 GAGGGCAGCCATGAGGAAGGCGG + Exonic
907270802 1:53289934-53289956 GAGGGGAAGCAGGAGTGTGGTGG - Intronic
907859522 1:58338279-58338301 GAGGGAGAGCAGGAGGAGGGAGG - Intronic
907923743 1:58936614-58936636 TAGGGTGACAGGGAGGATGGAGG + Intergenic
909550109 1:76889069-76889091 GATGGTTACCAGAGGGATGGGGG - Intronic
911102513 1:94105660-94105682 GAGGGAAGCCAGGAGAATGTAGG + Intronic
911530218 1:99035555-99035577 GATGGTTGCCAGGAGGCTGGGGG + Intergenic
912804009 1:112741785-112741807 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
916051857 1:161042042-161042064 GAAGGGAATCAGTAGGATGGGGG - Intronic
916260168 1:162833991-162834013 GAGGGTAAGCAGGAGGTGGCAGG + Intronic
916273441 1:162968388-162968410 GAGGGTAGCCCAGAGCATGGAGG - Intergenic
916479428 1:165201814-165201836 GTGGGGAACCAGGGGGATGTGGG - Intergenic
916865473 1:168851966-168851988 TAGGGTAACCTGGAGGTTGGAGG - Intergenic
917243579 1:172975776-172975798 GGGGGTAAACAAGAGGAGGGTGG - Intergenic
917564373 1:176196927-176196949 GAGTGAAACCAGCAGGAGGGAGG + Intronic
919298773 1:195734825-195734847 GAGGGCAACCAGGAGGGCGCTGG - Intergenic
919773667 1:201179302-201179324 GAGAGTCACATGGAGGATGGAGG - Intergenic
920654711 1:207867081-207867103 AAGGGTAACTAGAAGGATGGTGG - Intergenic
923563968 1:235062868-235062890 GAGGGTCTGTAGGAGGATGGGGG - Intergenic
924428883 1:243979552-243979574 GAAGGTACCCACGAGGGTGGCGG + Intergenic
924428908 1:243979612-243979634 GAAGGTACCCAGGAGGGTGGCGG + Intergenic
924428955 1:243979732-243979754 GAAGGTACCCACGAGGGTGGCGG + Intergenic
924681378 1:246237529-246237551 GAGATTAACCAGGAAGCTGGTGG - Intronic
1062834384 10:626418-626440 GAGGGTAACACCGAGGATGGGGG - Intronic
1062834407 10:626471-626493 GAGGGTAACCCCGGGGACGGGGG - Intronic
1063892743 10:10647154-10647176 AACGGGAACCAGGAGGATAGGGG - Intergenic
1064965436 10:21011476-21011498 GAGGGGAACCAGGAAGCAGGAGG - Intronic
1065046616 10:21752049-21752071 TCGGGTATCCAGGAGGATGAGGG + Intergenic
1068470046 10:57448782-57448804 GAGGGTGACCTGAAGCATGGTGG - Intergenic
1068515417 10:58019894-58019916 GAGGGCAATCAGGAAGATGAGGG - Intergenic
1069069587 10:63979505-63979527 GAGAGTAGCCAGGAGGGAGGAGG - Intergenic
1070412743 10:76158273-76158295 GAAGGTTACCAGGAAGAAGGAGG - Intronic
1070535232 10:77372226-77372248 GAGTGATTCCAGGAGGATGGGGG - Intronic
1070799873 10:79239068-79239090 GAGGTTGACCAGGATGAGGGGGG + Intronic
1071820140 10:89271542-89271564 GAGGGTAAGGAGGAGTATGGTGG + Intronic
1073503519 10:103964556-103964578 GAGGGTAACTATGAGTAGGGGGG + Intergenic
1075845776 10:125544207-125544229 AATGGGAACCAGGAGGCTGGGGG - Intergenic
1076623914 10:131810167-131810189 GAGGAAAAGCAGGATGATGGAGG + Intergenic
1076639044 10:131901419-131901441 GAAGGCAGGCAGGAGGATGGGGG + Intronic
1076921121 10:133455326-133455348 GAGGGTGATGAGGAGGCTGGGGG + Intergenic
1077168314 11:1153542-1153564 GAGGGTTCCCAGGAGGCAGGTGG + Intergenic
1078160067 11:8832543-8832565 GAAGGTAACCAGGAGTTTGAAGG - Intronic
1078432403 11:11298133-11298155 CAGGGTATCCTGCAGGATGGGGG - Intronic
1078803251 11:14668941-14668963 GAGGGTCCCCAGGAGCAGGGAGG - Intronic
1078920672 11:15827234-15827256 AAGTGTAAACAGGAGGTTGGGGG - Intergenic
1079045693 11:17100669-17100691 GAGGGTAGGAAGGGGGATGGTGG - Intronic
1080661068 11:34296321-34296343 GAGGGAGACAAGGAGGAGGGTGG + Intronic
1081252436 11:40851431-40851453 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1083407084 11:62465001-62465023 GAGGAAAGCCAGGAGGATGTGGG - Intronic
1083664608 11:64267704-64267726 GAGGGGCCCCAGGAGGATGAAGG - Intronic
1083883790 11:65560894-65560916 GAGGAAAACCAGGAGTGTGGTGG + Intergenic
1085430008 11:76439718-76439740 GAGCGTAACCTGGAGGCTTGAGG + Intergenic
1087131897 11:94675889-94675911 AGGGGTAACCAGGAAGATTGAGG - Intergenic
1087733794 11:101809088-101809110 GAAGGTAAGCAGCAGAATGGAGG + Intronic
1087831057 11:102820212-102820234 GAGGGTAAGCAGGAGCAGGGTGG - Intergenic
1088238343 11:107749034-107749056 GAGGGAAATTAGGAGGATGAAGG + Intergenic
1089156442 11:116406535-116406557 GAGGGTAGCCAGGAGTGGGGAGG - Intergenic
1089281885 11:117380539-117380561 GAGAGCCAGCAGGAGGATGGAGG + Intronic
1090464838 11:126924802-126924824 GAGGCTAACCAGGAGGGTTGAGG - Intronic
1090725713 11:129525645-129525667 GAGGGGAAAGAGGAGGCTGGGGG + Intergenic
1091156966 11:133383075-133383097 CAGGGTGACCAGGAGGATGTTGG - Intronic
1091454684 12:598339-598361 GAGGGCAAGGAGGAGGGTGGGGG - Intronic
1095342429 12:41107195-41107217 GATGGTTACCAGTAGGATGATGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097493341 12:60297186-60297208 GAGGGCAACCTGGAGGAGGCTGG - Intergenic
1098185360 12:67890681-67890703 GAGTGGACACAGGAGGATGGTGG + Intergenic
1098205095 12:68100564-68100586 GAGGGTAACACGGAGAAGGGTGG + Intergenic
1098522391 12:71448050-71448072 GAGGGAGACGAGGAGGAAGGGGG - Intronic
1098711646 12:73770102-73770124 AAGGATAACCTGGTGGATGGGGG - Intergenic
1099851219 12:88099750-88099772 GAGGGAAAACAGGAGGCTGAGGG + Intronic
1101321508 12:103677010-103677032 GAGCCTCACCAGGAGGCTGGAGG - Intronic
1101725884 12:107387902-107387924 GAGGGGAAGCAGGAAGATGAGGG - Intronic
1102535526 12:113577775-113577797 GAGGGGAGCCAGGTGGGTGGGGG - Intergenic
1102916999 12:116761523-116761545 GAGGACATGCAGGAGGATGGTGG - Intronic
1103934396 12:124467688-124467710 GAGGGTGATAAGGATGATGGAGG - Intronic
1103934535 12:124468262-124468284 GAGGGTGATGAGGATGATGGGGG - Intronic
1103934648 12:124468729-124468751 GAGGGTGATGAGGATGATGGGGG - Intronic
1105273888 13:18903791-18903813 GAGGGTGGCAAGGAGGAGGGGGG - Intergenic
1105683267 13:22751917-22751939 GAGGGTGGCCAGGAGGAATGGGG - Intergenic
1105806734 13:23955810-23955832 GAGGGTGGCAAGGAGGAGGGGGG + Intergenic
1106419315 13:29572409-29572431 GAGGCCACCCAGGAGGATGCTGG + Intronic
1106909716 13:34450562-34450584 GAGAGTAAACAGGCGGGTGGTGG - Intergenic
1107418709 13:40225217-40225239 GAGGAAAACCAGCAGGGTGGGGG + Intergenic
1107688416 13:42927443-42927465 GAGGGCTAGCAGGAGGAGGGAGG - Intronic
1108502881 13:51084400-51084422 GAGGGTCTCCATGAGAATGGTGG - Intergenic
1110612088 13:77500198-77500220 GAGGCTACCCAGAAGGGTGGTGG + Intergenic
1113048699 13:106184901-106184923 CACTGCAACCAGGAGGATGGGGG - Intergenic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1113843245 13:113371799-113371821 GAGGGGCCTCAGGAGGATGGAGG - Intergenic
1114190405 14:20436080-20436102 GAGGGTGACTAAAAGGATGGGGG - Intergenic
1115642361 14:35342684-35342706 GAGGAGAAACAGGATGATGGTGG - Intergenic
1117624134 14:57618382-57618404 GAGGGTAAGCAGAAGCAGGGTGG + Intronic
1117737777 14:58785007-58785029 TAGGGGAAGCATGAGGATGGTGG - Intergenic
1120224841 14:81779031-81779053 GAGGGAAGCAAGGAGCATGGTGG - Intergenic
1120520124 14:85517597-85517619 GAGGGAAATAAGGAGGATTGAGG - Intergenic
1120833167 14:89016121-89016143 GAGGGTGACTAGGAAGATGGAGG + Intergenic
1120899906 14:89566864-89566886 GAGGGTAAGGAAGAGGAGGGGGG - Intronic
1121013173 14:90533738-90533760 GAGGGAGACGAGGAGGGTGGTGG + Exonic
1121473910 14:94175978-94176000 GAGGGTCACTGGGAGGTTGGGGG + Intronic
1121902307 14:97704827-97704849 GAGAGTAACCAGGATGAAAGGGG - Intergenic
1122114038 14:99518791-99518813 GAGGGAAGCCAGGAGCGTGGGGG + Intronic
1122389008 14:101367745-101367767 GCTGGGAGCCAGGAGGATGGAGG + Intergenic
1125517710 15:40332001-40332023 GAGGGCACACAGGAGGAGGGAGG - Intronic
1128038447 15:64547871-64547893 GAGGCAAAGCAGGAGGACGGGGG + Intronic
1128249209 15:66152862-66152884 GAGGGTATCCAGGCTGAAGGAGG + Intronic
1128733597 15:70036954-70036976 GAGGGTCAGCAGGTGGAGGGAGG - Intergenic
1129803634 15:78436691-78436713 TTGGGCAACCAGGTGGATGGTGG + Intergenic
1131144569 15:90002443-90002465 GAGGGCGACGAGGAGGAAGGGGG - Intronic
1132678485 16:1130370-1130392 GAGGCTGCCCAGGAGGCTGGGGG + Intergenic
1132710312 16:1263417-1263439 CAGGGTGACCATGAGGATAGGGG + Intergenic
1132984274 16:2756175-2756197 TTGGGAGACCAGGAGGATGGTGG + Intronic
1133230148 16:4362531-4362553 TAGGGTACACAGGAGGATGACGG + Intronic
1135008873 16:18855253-18855275 GAAGAAAACCAGGAGAATGGTGG - Intronic
1135610414 16:23861498-23861520 GAGCCTAACAAGGAGGCTGGTGG + Intronic
1136044094 16:27601934-27601956 GATGGAAATCAGGTGGATGGAGG + Intronic
1136085484 16:27881926-27881948 GAGGCCAACCAGGAGGCTGCAGG - Intronic
1137265574 16:46866526-46866548 GAGTGTCACCAGCAAGATGGTGG + Intergenic
1138044164 16:53703780-53703802 GTGAGTACCCGGGAGGATGGGGG - Intronic
1138352145 16:56351822-56351844 GAGGGTGACCAGGAGGAAGGGGG - Intronic
1141516637 16:84549229-84549251 GAGGAGAGGCAGGAGGATGGAGG + Intronic
1141766870 16:86064610-86064632 GAGGGAAACCTGAAGGAGGGGGG - Intergenic
1142237902 16:88931289-88931311 GCTGGAAACCAGGAGGGTGGAGG + Intronic
1142469569 17:155862-155884 GGGGGTAGCCAGGAGGCTGGGGG - Intronic
1143519351 17:7436878-7436900 AGGGGTAGCCAGGAGGACGGTGG - Exonic
1143741278 17:8955725-8955747 GTGGGGAACAAGGAAGATGGAGG + Intronic
1143902003 17:10181430-10181452 AAGGGTAAAGAAGAGGATGGGGG + Intronic
1144767606 17:17741191-17741213 GAGGGGACTCAGGAGGGTGGTGG - Intronic
1145059965 17:19726688-19726710 GAGGAGAACGAGGAGGAGGGGGG + Intergenic
1145754479 17:27380748-27380770 GTGGGGAGCCAGGGGGATGGCGG + Intergenic
1146635373 17:34500224-34500246 GAGGGTAGCCATGTGGATGCTGG - Intergenic
1146826056 17:36024056-36024078 GAGGGTGAGCAGGAGCAGGGTGG - Intergenic
1146943856 17:36861208-36861230 GAGGCCAATCAGGAGGCTGGTGG + Intergenic
1147933711 17:43999146-43999168 GGGGGTATCGAGGAGGAGGGAGG + Intronic
1150096616 17:62381682-62381704 GAGGGCAGCCAGCAGGAGGGAGG - Intronic
1152304649 17:79513513-79513535 GGGGGTCCACAGGAGGATGGGGG - Intronic
1152624005 17:81380057-81380079 GGGGGGAGCCAGGGGGATGGGGG - Intergenic
1152696539 17:81800505-81800527 GAAGGGAAACAGGAGGGTGGTGG - Intergenic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1155534553 18:26803574-26803596 GAGGATAACCAAGAGGGTGACGG - Intergenic
1156915698 18:42463080-42463102 GAGGGAAACAAGGAGGATTTGGG - Intergenic
1156950849 18:42895910-42895932 GATAGAAACCAGGAAGATGGGGG + Intronic
1158746208 18:60202535-60202557 GAGGGTAGCAAGGAGCATGCAGG - Intergenic
1159118262 18:64139942-64139964 GAGGGCAAGAGGGAGGATGGAGG - Intergenic
1160991512 19:1862246-1862268 GAGGGGAACCGGGAGCCTGGTGG - Intronic
1161058106 19:2200639-2200661 GAGGGGAGCAGGGAGGATGGCGG - Intronic
1161085440 19:2332963-2332985 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161085461 19:2333024-2333046 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161085499 19:2333145-2333167 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161150295 19:2704031-2704053 GAGGGCAAGCAGGGAGATGGAGG - Intergenic
1161378343 19:3951266-3951288 GAGGCTGACCAGGGGGACGGGGG + Intergenic
1162465345 19:10836182-10836204 GAGGGTGACCCGGATGATGGCGG - Exonic
1162979348 19:14228598-14228620 GCGGGTGGGCAGGAGGATGGAGG + Intergenic
1163223700 19:15939809-15939831 GAGGGGAACCAAGAGGATATGGG + Intergenic
1164156656 19:22601461-22601483 GAGGGAGCCCAGGAGGAAGGGGG + Intergenic
1165149756 19:33753690-33753712 GAGGGTTGGTAGGAGGATGGTGG - Intronic
1165325851 19:35114435-35114457 GAGGGAAACTGGGAGGCTGGAGG - Intergenic
1166228570 19:41412272-41412294 GTGGGCAAGCAGGTGGATGGTGG - Intronic
1166698862 19:44870302-44870324 GAGGGCGGCCAGGAGGATGTGGG + Intronic
1166750841 19:45163379-45163401 GTGAGTAACCAGGAGCATGAGGG + Intronic
1167608200 19:50492902-50492924 GAGGGAAAGGAGGAGGAAGGAGG + Intergenic
1168405312 19:56107588-56107610 GAGGGTCACCAGGAGGGCCGAGG + Intronic
1168471951 19:56647125-56647147 GAAGTAAACCAGGATGATGGAGG - Intronic
1168481692 19:56725332-56725354 AATGGTAACCAGGAGTCTGGAGG + Intergenic
1168639262 19:58019964-58019986 AAGGAAAACCAGGATGATGGTGG + Intergenic
925332437 2:3069154-3069176 GGGGGTTGCCAGGAGGCTGGGGG + Intergenic
925585662 2:5461563-5461585 GAGAGTCACCAGGAGGAAAGAGG + Intergenic
925627946 2:5860864-5860886 GAGGGCAAGCAGGAGCAGGGTGG - Intergenic
926195512 2:10761417-10761439 GAGGGTAACCAGGAGGATGGCGG - Intronic
927777346 2:25912443-25912465 GAGTGTACCATGGAGGATGGTGG + Intergenic
927792345 2:26020222-26020244 GAGGGTCACCAGGAGGAAAGAGG - Intergenic
928249290 2:29660615-29660637 GAGGGAAACCAGGAGAAGGTGGG + Intronic
931809478 2:65840938-65840960 GGCGGTCACCAGGAGGTTGGGGG - Intergenic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
934987864 2:98900370-98900392 GAGGGGAGGCAGGGGGATGGAGG + Intronic
934987874 2:98900401-98900423 GAGGGGAGGCAGGAGGATGGAGG + Intronic
935347390 2:102121247-102121269 GAGAGAAACCAGGGGGTTGGGGG - Intronic
935396304 2:102613029-102613051 GATGGTGATCATGAGGATGGTGG - Intergenic
935535349 2:104286931-104286953 AATGGAAACCAGGAGGGTGGTGG + Intergenic
935848469 2:107192668-107192690 GAGGGTAACCACCAGGAGGTGGG + Intergenic
936024150 2:109018475-109018497 GGGTTTAATCAGGAGGATGGTGG - Intergenic
936229960 2:110692051-110692073 GAGGGTCACAAGGTGCATGGTGG - Intergenic
936891439 2:117374406-117374428 GAGGGCAACCAGCCTGATGGAGG + Intergenic
937682613 2:124660194-124660216 AAGGTTAACCATGTGGATGGAGG + Intronic
938317822 2:130342148-130342170 GAGGGTGACAAGGAAGAAGGTGG - Exonic
938952399 2:136267035-136267057 GAGGGTGAGCAGGAGCAGGGTGG - Intergenic
941211255 2:162642809-162642831 GTGGATAGCCAGGAGGCTGGAGG + Intronic
941360086 2:164540665-164540687 GAGGGAAAGCAGGAGGAAAGAGG - Intronic
941747157 2:169098956-169098978 GAGGCTAATGAGGAGTATGGTGG - Intergenic
942724467 2:178991534-178991556 GAGGGTAAGAAGGAAGAAGGAGG + Intronic
943345885 2:186736221-186736243 GAGAGTAACCAGGCAGATGTAGG + Intronic
947855259 2:233319637-233319659 CAGGGCACCCAGGAGGAAGGTGG - Intronic
948570869 2:238916429-238916451 GAGGGAAAGAAGGAGGAGGGAGG + Intergenic
1168739234 20:174071-174093 GAGGGAAAGAAGGAGGATGTGGG - Intergenic
1168850084 20:970363-970385 GAGGGTTATCAGCAGGATGTGGG - Intronic
1168938711 20:1690759-1690781 GAGGGTAAGCAGAAGCAGGGTGG + Intergenic
1169108507 20:3017873-3017895 GTTGGTAACCATGACGATGGTGG - Exonic
1170146896 20:13185423-13185445 GAGGGTGACAAGGAGGAAGAAGG - Intergenic
1170662665 20:18358243-18358265 GAGGATGAACAGGAGGATGAAGG + Intergenic
1170989316 20:21287518-21287540 GAGGATAAGCATGAGGTTGGTGG + Intergenic
1171093288 20:22306477-22306499 GAGGGTAATGAAGAGGATGTTGG - Intergenic
1171298770 20:24041376-24041398 GGGGGTAGCCAGGAGGCTGGAGG - Intergenic
1172591296 20:36119901-36119923 GAGGGTACAGAGGAGGAGGGCGG - Intronic
1172873938 20:38152859-38152881 GAGGCCAAGCAGGAGGAAGGGGG + Intronic
1174265129 20:49325767-49325789 GAGGGCAAGAAGGAGGAGGGAGG - Intergenic
1174625663 20:51912472-51912494 GAGGTTGACCAGGAGTTTGGTGG - Intergenic
1175327174 20:58137869-58137891 GATGGGGACTAGGAGGATGGAGG - Intergenic
1175851792 20:62097696-62097718 GAGGGTTCCCAGGAAGAGGGTGG + Intergenic
1176019706 20:62956419-62956441 GAGGGTGACCAGGAGATGGGTGG - Intronic
1176159223 20:63640219-63640241 GACGGTCAGCTGGAGGATGGCGG - Exonic
1176271905 20:64239698-64239720 GAGGACCCCCAGGAGGATGGGGG + Intronic
1179581650 21:42348098-42348120 CAGGGAAACCAGGCAGATGGTGG - Intronic
1179639300 21:42736729-42736751 GAGGGCAGCCAGGAGGACTGAGG - Intronic
1179828346 21:43981089-43981111 GAGGGGAGACAGGAGAATGGTGG - Exonic
1179896433 21:44366115-44366137 GAGGGTCTCCTGGAGGACGGGGG + Intronic
1180045244 21:45302140-45302162 GAGGGTAACCAGGGTGGTGTGGG + Intergenic
1181019626 22:20092547-20092569 GAGGGGCAGCAGGAGGCTGGGGG - Intronic
1181119723 22:20657798-20657820 GAGGGTGACAAGCAGGAGGGGGG + Intergenic
1181185237 22:21098623-21098645 GAGGGCCACCAGGAAGATGCTGG + Intergenic
1181236031 22:21448172-21448194 CAGGGGAACCATGAGGAGGGTGG + Exonic
1181889917 22:26053486-26053508 GACGGTGACCAGGATGATAGGGG - Intergenic
1182118931 22:27774511-27774533 GTGGATAGCCAGGAGGGTGGGGG - Intronic
1182496511 22:30712177-30712199 GAGGGTAAGGAGGAAGCTGGAGG - Intronic
1183599059 22:38829569-38829591 GGGGGAATCCAGGAGGATGGTGG - Intronic
1183617347 22:38953777-38953799 GAGGTTGACCAGGAGCATGGGGG + Intronic
1183631984 22:39039081-39039103 GGGGGTCACCAGGTGCATGGTGG + Intergenic
1183688893 22:39377168-39377190 GGGGCAAACCAGAAGGATGGGGG - Intronic
1184300037 22:43553275-43553297 GAGCAGAACCAGGAGGAAGGAGG + Intronic
1184482999 22:44759064-44759086 GAGGTGAACGAGGTGGATGGTGG + Intronic
1184597536 22:45523281-45523303 AAGGGTAACCAGGTGGCTGAGGG + Intronic
1184982728 22:48105739-48105761 AAGGGTAAACGGGGGGATGGAGG - Intergenic
1185015052 22:48338338-48338360 GGGGGTGGCCATGAGGATGGGGG + Intergenic
949229375 3:1732439-1732461 AAGGGAAAACAGGAAGATGGAGG - Intergenic
950167799 3:10814875-10814897 GAGGGGAAACGGGAAGATGGTGG + Intergenic
950307038 3:11923960-11923982 GAAGGCAATCAGGAGGGTGGAGG - Intergenic
950387419 3:12671079-12671101 GAGGGGCACCAAGAGGAGGGAGG + Intergenic
950474495 3:13206987-13207009 GTGGCTAACCAGGAGGCGGGAGG - Intergenic
951120022 3:18915741-18915763 GAGGGGAACCAGGAAGTTGTAGG - Intergenic
951315570 3:21185899-21185921 GGGGGTCACCAGGTGCATGGTGG + Intergenic
951577507 3:24128747-24128769 GAGGGTAACAAGCTGGGTGGGGG + Intronic
951775603 3:26307168-26307190 GAGGGTCACAAGGTGCATGGTGG + Intergenic
953238662 3:41128156-41128178 GAGGGTGAGCAGGGGGACGGGGG + Intergenic
953397760 3:42586608-42586630 GAGGAAAACCAGGAGAGTGGGGG - Intronic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
955286645 3:57647839-57647861 GAGGGTATCCATGGGGGTGGGGG + Intronic
955286822 3:57649808-57649830 GAGGGTATCCATGGGGGTGGGGG - Intronic
957993338 3:87654169-87654191 GAGGGCAAGCAGAAGCATGGTGG - Intergenic
958644268 3:96849520-96849542 GTGGGAAACCAGGAGAATGCAGG + Intronic
960871596 3:122255117-122255139 GAGGACAACCAGGATGATGACGG - Intronic
962956368 3:140270606-140270628 GTGTGTAGACAGGAGGATGGGGG + Intronic
964004429 3:151811371-151811393 TGGGGTGACAAGGAGGATGGGGG - Intergenic
964201266 3:154121554-154121576 GAGGGTACCCATGATGAGGGCGG + Intronic
964515576 3:157504264-157504286 GAGGGTAACAGGGAGGGTGGGGG + Intronic
966291108 3:178360956-178360978 GAGGGCAAGCAGAAGCATGGTGG + Intergenic
966724673 3:183099065-183099087 GAGGGGAGCCTGGAGGATGGCGG + Intronic
967842648 3:194019216-194019238 AAGTGTAACCAGGAGGGTGATGG - Intergenic
968614907 4:1573392-1573414 GAGAGAAACCAGGAAGAGGGAGG - Intergenic
969060656 4:4431730-4431752 GTGGGTCATCAGGAGGAGGGAGG - Intronic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
971371605 4:26023875-26023897 GAGGGTCCCCAGCAGGATTGAGG - Intergenic
971449155 4:26784033-26784055 CAGGGCTTCCAGGAGGATGGAGG - Intergenic
972565794 4:40268039-40268061 GAGGGTAGCTTGGAGGGTGGTGG - Intergenic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
976212279 4:82683129-82683151 GAGAGAAAACAGGAGCATGGCGG + Intronic
977791828 4:101113797-101113819 TTGGGTAACCAAGAAGATGGAGG - Intronic
978342009 4:107728923-107728945 CAGGGTGAACAGGATGATGGTGG + Intergenic
982010631 4:151102629-151102651 GAGGGTAGAAAGGAGGAGGGAGG + Intronic
982714336 4:158791077-158791099 GAGGGTAACAAGGGAGGTGGAGG + Intronic
985702705 5:1383243-1383265 GAGGGTGAGCAGGGGGTTGGGGG - Intergenic
986694107 5:10336939-10336961 GAGGGTTACCAGGAGCTTGGAGG + Intergenic
986805126 5:11301966-11301988 GTGGGTAAACTGGAGGAGGGTGG + Intronic
987353218 5:17039917-17039939 GAGGAGAAGGAGGAGGATGGGGG - Intergenic
987920377 5:24272662-24272684 GAGGGGGACAAGGTGGATGGAGG - Intergenic
993077647 5:83254381-83254403 AAGGGTAATGAGGAGGAGGGTGG - Intronic
994300483 5:98141227-98141249 GAGGGCAACAAGGAGGGTAGTGG - Intergenic
995301833 5:110594151-110594173 GAGGGCAAGCAGAAGCATGGTGG + Intronic
995468078 5:112471232-112471254 GTGGGTAGCCATGAGGCTGGAGG - Intergenic
995742035 5:115365549-115365571 GATGGTAAGAAAGAGGATGGTGG + Intergenic
997692200 5:135834509-135834531 GAGGATAACCCGGAGAAGGGAGG + Intergenic
998679935 5:144455677-144455699 GAAGGTTAGCAGGAGGGTGGAGG + Intronic
999135250 5:149314404-149314426 GAGGGTAACTAGAATGTTGGGGG + Intronic
999231488 5:150064744-150064766 GAGGGGATCAAGGAGGATGGAGG + Intronic
999545273 5:152622500-152622522 AAGGGTGACCAGGATGATGATGG - Intergenic
999840974 5:155426096-155426118 GAGGCAAACCAGGGGAATGGAGG + Intergenic
1001402278 5:171452527-171452549 GAGGGTAGCAAGGAGAAGGGGGG - Intronic
1001797209 5:174512662-174512684 GATGGGAACCAAGAGGCTGGTGG + Intergenic
1002058283 5:176610741-176610763 GAGGGTATCCAGGGGGAGGGGGG - Intergenic
1002181926 5:177435142-177435164 GAGGGAACCCAGGAGGCTAGTGG - Intronic
1004022473 6:11787955-11787977 TGGGGTGACAAGGAGGATGGGGG - Intronic
1005330489 6:24745302-24745324 GTGGCTAATCAGGAGGCTGGTGG - Intergenic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007373891 6:41443501-41443523 GAGGGGAAGCGGGAGGGTGGGGG + Intergenic
1007593860 6:43039499-43039521 GTGGGTGACGGGGAGGATGGAGG - Intronic
1008372064 6:50744189-50744211 GAGGGTAAAAAGTAGGAGGGTGG - Intronic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1009482904 6:64182841-64182863 GAGGGTAGACAGGAGTAGGGTGG - Intronic
1010054207 6:71545457-71545479 GAGGGGAACCAGGTGCATAGAGG - Intergenic
1011488599 6:87868585-87868607 GAAGGAATCCAGGAGGTTGGTGG - Intergenic
1011590001 6:88963095-88963117 GAAGGTAGACAGGAGGTTGGTGG - Intronic
1012049076 6:94316655-94316677 TAGGGTAACCAGGCAGGTGGTGG + Intergenic
1012523651 6:100151043-100151065 GAGGAAAACCTGGAGGATGCTGG + Intergenic
1013024956 6:106262703-106262725 GAGGGTGACCAGAAGCAGGGTGG + Intronic
1014177111 6:118342838-118342860 GAGGGCAAGCAGAAGCATGGTGG - Intergenic
1015219478 6:130787829-130787851 GAGAGTAACCAGGGGAAGGGAGG - Intergenic
1015392771 6:132701793-132701815 TGTGGTAACCTGGAGGATGGGGG - Intronic
1016040943 6:139431537-139431559 GAGGGGATCCAGAGGGATGGGGG - Intergenic
1018310552 6:162503817-162503839 GTGGGTAAACAGGAGGGTGATGG + Intronic
1019203753 6:170341775-170341797 GAGGGTGACCAGAAGCAGGGTGG - Intronic
1019415337 7:924345-924367 CAGTGTAACCCGGAGGGTGGGGG - Intronic
1019498917 7:1354814-1354836 GAGGGTAACCAGGGGCAACGTGG - Intergenic
1019635762 7:2074820-2074842 GAGGGGAAACCGGAGGCTGGGGG + Intronic
1020339071 7:7089572-7089594 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1020411546 7:7897145-7897167 GAGGGTAACATGGAAGAGGGTGG - Intronic
1023316469 7:38942886-38942908 GAGGGGACCCAGGAAGATGGAGG + Intergenic
1023984896 7:45088718-45088740 GAGGGGGGCCAGGGGGATGGGGG + Intronic
1024615171 7:51105764-51105786 GAGGGAACCCAGGAGGACAGAGG - Intronic
1026191930 7:68136553-68136575 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
1026389731 7:69888351-69888373 GAGAGGAAACAAGAGGATGGGGG + Intronic
1026823640 7:73567183-73567205 GAAAGTAGCCAGGAGGAGGGTGG + Intergenic
1027598427 7:80206967-80206989 GAGTGAAACCAGGAGTAAGGGGG + Intronic
1027923023 7:84420313-84420335 GAGGGAAACCAGGAAAATGATGG + Intronic
1028839504 7:95412704-95412726 GAGAGTAATCAGAAGGTTGGTGG + Intronic
1029550413 7:101234387-101234409 GAGGAAGCCCAGGAGGATGGCGG + Exonic
1031136260 7:117887503-117887525 GAGGGTAACAGGGAGGTTGAAGG - Intergenic
1031169842 7:118279183-118279205 TAGGGTAAAAAGGAGGCTGGTGG + Intergenic
1031401253 7:121328651-121328673 GAGGGTAACCCAGATGTTGGTGG + Intronic
1031555966 7:123176772-123176794 GAGGAGAACCAGGAGGGTGTGGG - Intronic
1032715778 7:134508073-134508095 GAAGGAAACCAGGAAGATGTTGG - Intergenic
1032721600 7:134554631-134554653 GAGGCTTGCCAGGAGGAAGGTGG + Intronic
1033599645 7:142879710-142879732 GAGGGTTAGCAGGAGCAAGGAGG - Intronic
1034267095 7:149786319-149786341 GAGGGAGACCAGGAGGAGGGAGG - Intergenic
1035105559 7:156439561-156439583 GAGCGGACCCAGGAGGCTGGAGG - Intergenic
1035984531 8:4412283-4412305 GAGAGCAACCGAGAGGATGGTGG - Intronic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1037815639 8:22110224-22110246 GAGGGTGACGACAAGGATGGAGG - Intergenic
1039759827 8:40562548-40562570 GACAGCACCCAGGAGGATGGAGG - Intronic
1040672124 8:49704424-49704446 CAGGGTGACCTGGGGGATGGTGG - Intergenic
1041104477 8:54427826-54427848 GAGGATGACCATGAGGGTGGAGG - Intergenic
1042390889 8:68232173-68232195 GAGGGGAACCAGGATGAAGAAGG + Exonic
1044297813 8:90548694-90548716 GAGGGTAGCGGAGAGGATGGAGG + Intergenic
1044958527 8:97506352-97506374 AAGGGTGACCAGGAAGATGGAGG + Intergenic
1045761138 8:105609249-105609271 GAGGCAAGCCAGGAGCATGGAGG + Intronic
1047198842 8:122746514-122746536 GAGGGTGACCAGCAGAATGCAGG - Intergenic
1047767666 8:128002636-128002658 GAGAGGACACAGGAGGATGGAGG - Intergenic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1048149896 8:131884038-131884060 GAAGATAACCAGAAGGATGAAGG + Intergenic
1048790868 8:138102089-138102111 GAGGTAAATCAGAAGGATGGAGG + Intergenic
1049346683 8:142142921-142142943 GATGGTAACCATGGTGATGGTGG + Intergenic
1049346730 8:142143163-142143185 GATGGTAACCATGGTGATGGTGG + Intergenic
1049471052 8:142775182-142775204 GAGGGTGGCCAGGAGGATGGGGG + Intronic
1049499243 8:142952700-142952722 GAGGGGAACCTGGGGGATGGTGG - Intergenic
1049533931 8:143169361-143169383 GAGGGTAAGCAGTAGGATGATGG - Intergenic
1049558182 8:143294084-143294106 GAGGGGCAGCAGGAGGAGGGGGG - Intronic
1049855048 8:144856463-144856485 TGAGGTAACCAGGAAGATGGAGG - Intergenic
1051695895 9:19767597-19767619 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1054728422 9:68676289-68676311 GAGAGGAAGCAGGTGGATGGAGG - Intergenic
1054958253 9:70938415-70938437 GAGGGTATCTAGGAGGAAGGTGG - Intronic
1054971273 9:71090479-71090501 GAGGGTGACCAGGTTGGTGGTGG - Intronic
1056300177 9:85232237-85232259 GTGGGTCATGAGGAGGATGGTGG - Intergenic
1057096824 9:92318194-92318216 GTGGGCAAGCACGAGGATGGTGG - Intronic
1057211996 9:93205491-93205513 GGGGCTGACCAGCAGGATGGGGG - Intronic
1058026324 9:100144855-100144877 GAGGGAAAGAAGGAGGATTGGGG + Intronic
1059235591 9:112758217-112758239 CAGGGTCTCCAAGAGGATGGGGG - Intronic
1060423594 9:123486767-123486789 GAGGGTGCCCAGAAGGTTGGGGG - Intronic
1060546536 9:124465173-124465195 GAGAGAGACCAGGAGGATGGAGG - Intronic
1060617752 9:125034193-125034215 AAGGGTCAGCAGGAGGTTGGAGG - Intronic
1060620126 9:125057684-125057706 GAGGGCACCCATGAGGGTGGAGG + Intronic
1060696096 9:125710421-125710443 GAAGGAAAGCAGAAGGATGGAGG + Intergenic
1061449036 9:130658946-130658968 GAGGGTGAGCTGGAGGCTGGAGG + Intergenic
1061831584 9:133299740-133299762 GAGGTTCCCCAGGAGGGTGGGGG + Intergenic
1061878057 9:133554690-133554712 CGAGGTAACCAGGAGGAGGGAGG + Exonic
1061884321 9:133583991-133584013 GAGGGGAGGCAGGAGGGTGGAGG - Intronic
1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415665 9:136448355-136448377 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG + Intronic
1062473021 9:136714496-136714518 GAGGACAGCCAGGAGGAGGGAGG - Intronic
1062707045 9:137951517-137951539 GAGAGAAACCAGGAGGGTGGTGG - Intronic
1062725583 9:138071595-138071617 GAGAGAAGCCAGGAGGAAGGGGG + Intronic
1186195805 X:7109405-7109427 GAGGGCAGGCAGGACGATGGAGG + Intronic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186497592 X:10024085-10024107 CATTGTAACCAGGTGGATGGAGG - Intronic
1188200096 X:27286419-27286441 GGGGGTCACAAGGTGGATGGTGG + Intergenic
1188798199 X:34492831-34492853 GAGGAGAACCACGAGTATGGAGG + Intergenic
1189847105 X:45148088-45148110 GAGGGTTAGCAGGTGGCTGGCGG + Intergenic
1190939926 X:55030385-55030407 GAGGGAAACTAAGAGGATGTGGG - Intronic
1191809865 X:65175174-65175196 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1192007468 X:67232658-67232680 GAGGAGAAGGAGGAGGATGGAGG - Intergenic
1193341384 X:80352970-80352992 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1194116077 X:89900007-89900029 GAGGGTGCCCAAGATGATGGGGG + Intergenic
1195387209 X:104324568-104324590 GGAAGTAACCAGGAGGTTGGTGG - Intergenic
1195954070 X:110310286-110310308 CTGGGGAACCATGAGGATGGTGG - Intronic
1196811848 X:119635151-119635173 TTGGGCAACCAGGTGGATGGTGG + Intronic
1198376715 X:136048164-136048186 GATTGTAACCAGAAGGATGAAGG + Intergenic
1200153016 X:153960435-153960457 GAGGTCAGCAAGGAGGATGGAGG + Intronic
1200468875 Y:3557132-3557154 GAGGGTGCCCAAGATGATGGGGG + Intergenic
1201304819 Y:12541545-12541567 GAGGGGAAGCGGGAGGAAGGGGG - Intergenic