ID: 926196357

View in Genome Browser
Species Human (GRCh38)
Location 2:10765811-10765833
Sequence CCCAGGGATGCCAGACTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 319}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926196345_926196357 20 Left 926196345 2:10765768-10765790 CCCTTCCCTGCCTCACCATGTGC 0: 1
1: 0
2: 0
3: 42
4: 571
Right 926196357 2:10765811-10765833 CCCAGGGATGCCAGACTCAGTGG 0: 1
1: 0
2: 2
3: 29
4: 319
926196348_926196357 14 Left 926196348 2:10765774-10765796 CCTGCCTCACCATGTGCCAATTT 0: 1
1: 0
2: 0
3: 13
4: 243
Right 926196357 2:10765811-10765833 CCCAGGGATGCCAGACTCAGTGG 0: 1
1: 0
2: 2
3: 29
4: 319
926196351_926196357 10 Left 926196351 2:10765778-10765800 CCTCACCATGTGCCAATTTGGGA 0: 1
1: 0
2: 0
3: 8
4: 151
Right 926196357 2:10765811-10765833 CCCAGGGATGCCAGACTCAGTGG 0: 1
1: 0
2: 2
3: 29
4: 319
926196346_926196357 19 Left 926196346 2:10765769-10765791 CCTTCCCTGCCTCACCATGTGCC 0: 1
1: 1
2: 2
3: 87
4: 619
Right 926196357 2:10765811-10765833 CCCAGGGATGCCAGACTCAGTGG 0: 1
1: 0
2: 2
3: 29
4: 319
926196347_926196357 15 Left 926196347 2:10765773-10765795 CCCTGCCTCACCATGTGCCAATT 0: 1
1: 0
2: 1
3: 24
4: 333
Right 926196357 2:10765811-10765833 CCCAGGGATGCCAGACTCAGTGG 0: 1
1: 0
2: 2
3: 29
4: 319
926196352_926196357 5 Left 926196352 2:10765783-10765805 CCATGTGCCAATTTGGGATTCTC 0: 1
1: 0
2: 0
3: 12
4: 182
Right 926196357 2:10765811-10765833 CCCAGGGATGCCAGACTCAGTGG 0: 1
1: 0
2: 2
3: 29
4: 319
926196353_926196357 -2 Left 926196353 2:10765790-10765812 CCAATTTGGGATTCTCTCAGTCC 0: 1
1: 0
2: 2
3: 14
4: 145
Right 926196357 2:10765811-10765833 CCCAGGGATGCCAGACTCAGTGG 0: 1
1: 0
2: 2
3: 29
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926196357 Original CRISPR CCCAGGGATGCCAGACTCAG TGG Intronic
901232188 1:7647455-7647477 CCCAGGGAAGCCTGACTCCCCGG + Intronic
901844627 1:11974150-11974172 CCCAGGGCTGCCTGACTCCAAGG + Intronic
902245473 1:15117849-15117871 GGCAAGAATGCCAGACTCAGAGG - Exonic
902283942 1:15394235-15394257 CCCAGGGCTGCCAGAAGCATGGG - Intronic
902988398 1:20169801-20169823 CCCAGTGTTGCCCGACTCTGAGG + Intronic
903224229 1:21885794-21885816 CCCAGAGATGCCAGCCCCACTGG - Intronic
903835745 1:26202319-26202341 CCCTGGGCTCCCAAACTCAGAGG + Intronic
904011277 1:27391990-27392012 CCCCGGGATGGCAGAGGCAGCGG - Intergenic
904482617 1:30803547-30803569 CCCAGGGCTGCCAGACTGTTTGG - Intergenic
904627413 1:31814822-31814844 CCCAGGGAGGCCAGAGACGGTGG - Exonic
904647115 1:31976118-31976140 CTCATGGAGGCCAGCCTCAGTGG + Intergenic
904754408 1:32760266-32760288 GCCAGGCAGGCCTGACTCAGGGG - Intronic
905292955 1:36935466-36935488 CCCAGTTATCCCAGATTCAGAGG - Intronic
907331726 1:53676209-53676231 CCCAAGGGTGTCAGCCTCAGTGG + Intronic
907861811 1:58361194-58361216 CCCTAGGAGGCCAGACCCAGGGG - Intronic
908021523 1:59903228-59903250 CCCAGGTATGACACACTCAGAGG + Intronic
908164459 1:61444378-61444400 CTCAGGCATTTCAGACTCAGAGG - Intronic
915972425 1:160364092-160364114 TCCTGGGATGCCAGATGCAGAGG + Intergenic
916259056 1:162822530-162822552 CCCAGGGATGCCAGCCTCCCGGG - Intergenic
918378948 1:183935738-183935760 ACCAAGGATGTCAGAGTCAGGGG - Intronic
919314700 1:195956186-195956208 CCCAGGGGTGGCAGAGGCAGAGG + Intergenic
919464841 1:197914979-197915001 TCCAGGGAAGCCAAACACAGAGG - Intronic
920104752 1:203544193-203544215 CCCAAGAAGGCCAGGCTCAGTGG - Intergenic
920376757 1:205512874-205512896 CCCAGGGATGCCAGGCTCAAAGG + Intronic
920813914 1:209313209-209313231 CCCAAGGATGCACAACTCAGGGG + Intergenic
921446639 1:215254722-215254744 CTCACGGCTGCCAGGCTCAGTGG - Intergenic
921597131 1:217066526-217066548 CCATGGGAGGCCAGGCTCAGTGG - Intronic
922167503 1:223128293-223128315 CCCAGAGATGCTAGGCTTAGAGG - Intronic
1063414367 10:5861459-5861481 TCCAGGGATGCATGACTCAGTGG + Intergenic
1065014527 10:21449768-21449790 CCCAGGGACGCCGGGCACAGTGG + Intergenic
1065828252 10:29591371-29591393 CCCAGGGAATCCAAACTAAGAGG + Intronic
1065949459 10:30638829-30638851 CCCAGGGAATCCAAACTAAGAGG - Intergenic
1067353210 10:45495996-45496018 ACCAGGGAGGCCAGAGACAGTGG + Intronic
1067512438 10:46907061-46907083 CCCAGGCCCTCCAGACTCAGTGG - Intergenic
1067649806 10:48144761-48144783 CCCAGGCCCTCCAGACTCAGTGG + Intergenic
1070425612 10:76284287-76284309 CTCAGGGAAGTCAGAGTCAGGGG + Intronic
1070659793 10:78296717-78296739 CCCATGGATGCCAAAATCCGTGG + Intergenic
1070995148 10:80772190-80772212 CCCAGGAATGCGTGACTGAGTGG + Intergenic
1071274349 10:84039162-84039184 CCCAGGGAGTCCCTACTCAGTGG + Intergenic
1073028567 10:100506810-100506832 CCCAAGGAGGCCAGGCACAGTGG + Intronic
1073124332 10:101140321-101140343 CCCGGGGATGCCAGACTCCTGGG + Intergenic
1073143634 10:101264960-101264982 CCCAGGGCTGCCAGAGCCAAGGG + Intergenic
1073445471 10:103577761-103577783 GCCCAGGATGCCAGATTCAGTGG + Intronic
1073476688 10:103758293-103758315 CCCAGGGGTGCCAGGCTTGGGGG - Intronic
1073649209 10:105340970-105340992 GCCAGGGATGCCAGCCTCTGAGG - Intergenic
1075573714 10:123563325-123563347 CCCAGGTCTCCCAGACACAGAGG - Intergenic
1075909175 10:126108440-126108462 CCCAGGAATTACACACTCAGAGG + Intronic
1076036794 10:127205365-127205387 CCCAGGGCTGAGAGACCCAGAGG - Intronic
1076629053 10:131841822-131841844 CCCTGGGAGGACAGACTCTGGGG + Intergenic
1076704247 10:132292744-132292766 CCCTGGGAAGCCACTCTCAGAGG + Intronic
1076809086 10:132877506-132877528 CCCAGGTCTGCCAGGCTCAGAGG - Intronic
1077357095 11:2123436-2123458 ACCAGGGAGGCCAGACTCCTGGG + Intergenic
1077535192 11:3120656-3120678 CCCAGGGATGGCGGCCCCAGAGG - Intronic
1077744659 11:4889205-4889227 CCCAAGGATGCCAAAATCTGAGG + Intronic
1078441934 11:11375575-11375597 CCCAGAGAAGCTAGACTCAGTGG - Intronic
1078739974 11:14057707-14057729 TTCAGGGTTGCCAGACACAGTGG + Intronic
1080550556 11:33370883-33370905 TCCAGGGGGGCCAGGCTCAGTGG - Intergenic
1080818436 11:35781519-35781541 TCCAGATATGCCAGAGTCAGTGG + Intronic
1082109353 11:48257116-48257138 CCCACGGATGCCAGAATGTGAGG + Intergenic
1084084893 11:66850466-66850488 TGCAGGGAGGCCAGAGTCAGAGG + Intronic
1085034506 11:73292010-73292032 CCCAGGGAGGCCAGCTCCAGAGG - Intronic
1085114010 11:73913972-73913994 CCCAGGGATTCAAGACTGTGGGG + Intronic
1086338881 11:85827068-85827090 TCCAAGGATGTCAGAGTCAGAGG + Intergenic
1089696781 11:120220831-120220853 ACCTGGGATGCCAGGCTCTGGGG + Intronic
1090608382 11:128448709-128448731 CCCAGGCAAGCCTGACTCACAGG + Intergenic
1091406705 12:213824-213846 CCCTGGGAAGCGAGACTCTGTGG - Intronic
1091622280 12:2098186-2098208 CCAAGGAATGACAGCCTCAGGGG + Intronic
1092187837 12:6493983-6494005 CCGCGCGTTGCCAGACTCAGAGG + Exonic
1093855377 12:24095531-24095553 CCAAGTGATGCCAGAAGCAGAGG - Intergenic
1094065315 12:26355734-26355756 ACCAGGGATGAAAGACTGAGGGG - Intronic
1094113367 12:26884390-26884412 CCCAAGGAGGCCGGGCTCAGTGG + Intergenic
1094835983 12:34322324-34322346 ACCAGGGATGCCAGAATCCCTGG + Intergenic
1094845067 12:34357905-34357927 CACAAGGATGCCAGACAAAGCGG - Intergenic
1096600874 12:52728066-52728088 GCCAGGGAAGCCAGACACAAAGG + Intergenic
1096671134 12:53198842-53198864 CCCAGGGATACCAGACATATTGG - Intronic
1097709397 12:62901785-62901807 CCCAGGGATGCCTGGAGCAGAGG - Intronic
1097895810 12:64824377-64824399 CCAAGGGGCGCCAGTCTCAGGGG - Intronic
1098226614 12:68331443-68331465 ACCAGGAATTCCAGGCTCAGAGG + Intronic
1098836018 12:75425233-75425255 CCCAGGGATGCCTTCCTCACTGG - Intronic
1104730278 12:131101668-131101690 CCAATGGAGGCCAGACACAGTGG - Intronic
1104798352 12:131535853-131535875 CCCAAGGATGCCAGAATCCATGG - Intergenic
1104921515 12:132293055-132293077 GCCAGGGCTGCCATAATCAGGGG + Intronic
1107808126 13:44174149-44174171 CCCAGTGATGCTGGCCTCAGGGG - Intergenic
1107824534 13:44316349-44316371 ACCAGGGATGCCAAAATCAGTGG + Intergenic
1111597195 13:90427539-90427561 CGCAGGGATGCCTGCATCAGAGG - Intergenic
1113736538 13:112682587-112682609 CTCAGTGAAGCCAGACTCAAGGG - Intronic
1113916156 13:113875224-113875246 CCCGGGGTTGCCAAGCTCAGGGG + Intergenic
1114536699 14:23427460-23427482 CCCAAGGTTTACAGACTCAGTGG - Intronic
1114624075 14:24117217-24117239 CCTAGGTCTGCCAGCCTCAGAGG - Intronic
1115163021 14:30416834-30416856 CTCAATGATGCCAGACGCAGTGG + Intergenic
1118176238 14:63442768-63442790 CCCAGGGATGCCTGAAACTGTGG - Intronic
1118761675 14:68884127-68884149 CCCAGGGGAGCCAGCCTCCGGGG + Intronic
1119471264 14:74901169-74901191 CCCCAGGATGGCAGACTGAGGGG - Exonic
1119768256 14:77204357-77204379 CCCTGGGTTTCCAGTCTCAGGGG - Intronic
1120108163 14:80520129-80520151 CCAAAGCAGGCCAGACTCAGTGG + Intronic
1122067624 14:99184635-99184657 CACAGGGATGGCAGACCCTGTGG + Intronic
1122151036 14:99726374-99726396 CCCAGCGGAGCCAGACCCAGAGG + Intronic
1122427630 14:101620990-101621012 CCCAGGGCTGTCAGAGACAGTGG - Intergenic
1125471145 15:40005180-40005202 CCCAAGGATACCAAAATCAGTGG - Intronic
1126938516 15:53739293-53739315 CCCAGGACTGCCAGATTCTGCGG - Intronic
1127113112 15:55695985-55696007 CACAGGGAGGCCAGACACAGTGG + Intronic
1127275201 15:57437756-57437778 CCCAGTGGTGACAAACTCAGTGG + Intronic
1127308289 15:57729097-57729119 CCCAGGGAGGCCGGGCACAGTGG + Intronic
1127601164 15:60538275-60538297 CCCAGGGAGTTCAGTCTCAGAGG - Intronic
1127647985 15:60976504-60976526 CCCAGGCCTGCCAGCATCAGCGG + Intronic
1127855637 15:62951250-62951272 CCCAGGGATGCCTTTCTCTGGGG - Intergenic
1128578011 15:68789509-68789531 CCCAGAGATGCCTGAGTAAGAGG - Intronic
1129272375 15:74425983-74426005 CCCATGGAGGCCAGGCACAGTGG + Intronic
1129671852 15:77612062-77612084 CCCAGCGATGCTAGAATCAATGG - Intergenic
1129943362 15:79518002-79518024 CCCAGGGATGGCAGAATCAAGGG - Intergenic
1132498071 16:273215-273237 CACAGGGATGCCAGATTGCGGGG - Intronic
1132781895 16:1631402-1631424 GTCAGGCATTCCAGACTCAGTGG + Intronic
1132800324 16:1748913-1748935 CCCAAGGATGCCAAAATCTGAGG + Intronic
1132833785 16:1942619-1942641 CCCAGAGATCCCGGACTCGGGGG + Intronic
1133040990 16:3059597-3059619 CCCAGGAATGCCAGACGCAGTGG - Exonic
1135345061 16:21681866-21681888 CTCAGGGATTGCAAACTCAGGGG + Intronic
1135597497 16:23755254-23755276 CCCAGCGATCCCAGGCACAGGGG - Intronic
1137700711 16:50495849-50495871 CCCAGGGAAGCAAGAATGAGGGG - Intergenic
1139464254 16:67145686-67145708 CCCAGGGAAGCCTGGCACAGTGG + Intronic
1139914232 16:70418418-70418440 CCCTGGGATGCCAGTCTCTGAGG - Intronic
1141144111 16:81516733-81516755 GCCAGGCATCCCAGACACAGTGG - Intronic
1141160448 16:81625975-81625997 CCCAGGGCTGCCAGGGCCAGAGG + Intronic
1141596679 16:85101157-85101179 CCCAGGGATGGCAGGCTTTGTGG + Intronic
1141771021 16:86089704-86089726 CACAGGGAAGCCAGACGCAGGGG + Intergenic
1141908780 16:87044613-87044635 ACCAGAGATGCCTGACTAAGTGG + Intergenic
1142156985 16:88537132-88537154 CCCTGGAATGCAAGACGCAGAGG + Intergenic
1142296238 16:89224329-89224351 CTCTGGGACGCCAGACGCAGTGG + Intronic
1143558873 17:7679984-7680006 CCCAGGGGTACCAGCATCAGTGG + Intronic
1144789250 17:17848280-17848302 CCCAGGTCTGCCAGACCCTGTGG - Intronic
1144813742 17:18018846-18018868 CCCAGGTACGCCAGACACGGTGG + Intronic
1145759244 17:27416547-27416569 CCCAGGGATGCCAAAATCCATGG + Intergenic
1147139099 17:38451692-38451714 CCCAGCCATGTCAGACTCTGGGG - Intronic
1147389379 17:40099821-40099843 CCCAGGGATTCGAGGCTCAAGGG + Intronic
1147769320 17:42856717-42856739 CCCTGTGATGCCTGACACAGGGG + Exonic
1147772058 17:42874536-42874558 CCCTGTGATGCCTGACACAGGGG + Intergenic
1148343467 17:46887965-46887987 CCCTGGGCAGCCAAACTCAGTGG + Intergenic
1150584274 17:66503230-66503252 CCCAGAGAAGCCAGAGTCACTGG - Intronic
1151573232 17:74937678-74937700 CCAAAAGATGCCAGAGTCAGTGG + Intronic
1151772919 17:76176995-76177017 CCCAGGAGTGTCAGGCTCAGTGG - Intronic
1151896993 17:76987231-76987253 CCCAGGGATGGCAGTTCCAGGGG + Intergenic
1152147984 17:78580695-78580717 CCCAGAGCTCCCAGACACAGGGG + Intergenic
1153981184 18:10311971-10311993 CCCAGGGAAGCAAGAGTGAGAGG - Intergenic
1154980398 18:21498708-21498730 CCCAGCCATGGCTGACTCAGAGG + Intronic
1156469987 18:37371395-37371417 CCCAGGGATCCTGGCCTCAGGGG + Intronic
1157229851 18:45905413-45905435 CCAAGGCATTCCAGACTCAGAGG + Intronic
1157594643 18:48857143-48857165 CCCAGGGGTGCCTGAGTCAATGG + Intronic
1157622298 18:49023648-49023670 CCCAGAGGTGCCAGGCTCCGTGG - Intergenic
1160156826 18:76441194-76441216 TCCTGGGATCCCAGGCTCAGGGG - Intronic
1161031388 19:2059424-2059446 CCCAGGGACGCCTGCCTCCGCGG - Intergenic
1161153197 19:2720337-2720359 GTCAGGGATTCCAGACCCAGCGG - Intronic
1161393060 19:4031365-4031387 GCCAAGGATGCCGGACTCCGTGG - Intronic
1161479416 19:4503189-4503211 CCCAGGAACCCCAGACCCAGGGG - Exonic
1162127257 19:8506286-8506308 CCCAGGAATCTCAGACTCGGGGG - Intergenic
1163252752 19:16136013-16136035 CCCAGGCATTGCAAACTCAGTGG + Intronic
1166124232 19:40704079-40704101 CCCAGGGAGTCCAGGTTCAGGGG - Intronic
1166885125 19:45955929-45955951 CCCAGGTATCCCAGACACACAGG - Intronic
1167097395 19:47381659-47381681 CCCAGGGATGCCACACACTGGGG + Intronic
1168324498 19:55531034-55531056 CCCAGGGAGGCCCAACGCAGTGG + Intronic
926196357 2:10765811-10765833 CCCAGGGATGCCAGACTCAGTGG + Intronic
927195400 2:20543028-20543050 CCCAGGCTTCCCAGACTCTGGGG + Intergenic
928032381 2:27792529-27792551 CCAAGGGATGATAGATTCAGTGG - Intronic
929431783 2:41893381-41893403 CCCGGGGAGACCAGACTCAATGG + Intergenic
929568637 2:43006212-43006234 CCCAGAGAGGCCAGAGGCAGAGG - Intergenic
930634005 2:53785553-53785575 CCCAGGGGGGCCAGGCACAGTGG + Intronic
932422296 2:71608372-71608394 CCCAGGGTTGCCTGCCTCTGTGG - Intronic
932430661 2:71672047-71672069 CTCCGTGATGCCAGACTCTGGGG + Intronic
933902637 2:86860957-86860979 CCCAGGAATTCCATTCTCAGAGG + Intronic
935693529 2:105750888-105750910 CACAGAGATGGCAGGCTCAGAGG - Intronic
935777911 2:106488311-106488333 CCCAGGAATTCCATTCTCAGAGG - Intergenic
936460723 2:112712247-112712269 CCCAGGGATGCCAGAAGGAAGGG - Intergenic
938118790 2:128619789-128619811 CGCAGGCCTGCCAGGCTCAGTGG - Intergenic
938716951 2:134029650-134029672 CCAAGTGCTGCCAGACACAGAGG + Intergenic
939250916 2:139680691-139680713 CCCAGGGAGGTCATACTCTGTGG + Intergenic
939574381 2:143878831-143878853 CCCAGAGATGCCTGCCTCATAGG + Intergenic
939729478 2:145764328-145764350 CCCAGGCATGTCAGACTCACTGG - Intergenic
940125520 2:150319111-150319133 CCGAAGGATGACACACTCAGCGG - Intergenic
940850176 2:158680650-158680672 CCCAGGGTCCCCAGACTCATGGG + Exonic
941574898 2:167217364-167217386 CACAGGCATGTCAGAATCAGGGG - Intronic
941736479 2:168982196-168982218 CCCTGGGAAGACAGAGTCAGAGG + Intronic
945979079 2:216294557-216294579 CCCATGGCTGCCAGCCTGAGAGG - Intronic
947490571 2:230591304-230591326 CCCAGGGATGCTAGAATCTAGGG + Intergenic
947542271 2:230987349-230987371 CCCGGGGATCACAGCCTCAGCGG - Intergenic
947596253 2:231413537-231413559 TACAGGGATGCCTGCCTCAGGGG + Intergenic
947746863 2:232512368-232512390 CCCAGGGAGGCCACACTTGGTGG - Intergenic
948004583 2:234596817-234596839 CTGAAGGATGCCACACTCAGGGG - Intergenic
948276235 2:236711164-236711186 CCCAAGGATGCCAGGCCCAATGG + Intergenic
948569971 2:238911590-238911612 CCCGGTGATGCCAGCCCCAGTGG - Intergenic
948653767 2:239464542-239464564 CCCAGGGGCCCCACACTCAGTGG + Intergenic
948674566 2:239589315-239589337 CCTTGGGAGGCCAGGCTCAGAGG + Intergenic
1168866919 20:1094696-1094718 CCCAGAAAAGCCAGGCTCAGTGG - Intergenic
1170191531 20:13649647-13649669 CCCAGGGAAGCCGGACCCAGAGG + Intergenic
1170230624 20:14043205-14043227 CCCAGGGGAGCCAGAAGCAGTGG - Intronic
1170593176 20:17786659-17786681 CTCCAGGATGCCAGACTCTGGGG + Intergenic
1171079259 20:22161710-22161732 CCCAGCAAAGCAAGACTCAGGGG - Intergenic
1172124942 20:32619995-32620017 CCCCTGAATGCCAGACACAGTGG + Intergenic
1172228373 20:33320446-33320468 CCCAGGAGTGCCAGACTCCAAGG - Intergenic
1172558541 20:35865383-35865405 CCCAGCGATTCCAGAGTCTGAGG + Intronic
1172595332 20:36147457-36147479 CCCAGGCATGCCTGACTCCAAGG - Intronic
1172623759 20:36335902-36335924 CCCAGGGGTTGCAAACTCAGGGG + Intronic
1172666538 20:36604414-36604436 CCTAGGGAGGCCAGGCGCAGTGG - Intronic
1173249314 20:41356361-41356383 CCAAGGGTTGCCAGAATCTGAGG - Intronic
1173252291 20:41370347-41370369 CCTAGGGAGGCCAGAAGCAGAGG + Intergenic
1173469156 20:43309291-43309313 ACCTGGAATGCCATACTCAGAGG - Intergenic
1174085017 20:48001275-48001297 GCCAGGAAAGCCAGACACAGAGG - Intergenic
1174380508 20:50152952-50152974 CCCAGGGAACCCTAACTCAGGGG - Intronic
1174385491 20:50186499-50186521 CCAAGGGCTGCCAGGCTCCGAGG - Intergenic
1175283310 20:57819953-57819975 CCAAGGGAAGCCAGCCTGAGGGG - Intergenic
1175521202 20:59603941-59603963 CCCAGGGCTGCCACTCACAGAGG - Intronic
1175786545 20:61715712-61715734 CCCAGGGCTTTCAGTCTCAGGGG - Intronic
1175992931 20:62798361-62798383 CCCAGGGAGGGCAGAACCAGCGG - Intronic
1176081947 20:63277916-63277938 CCCAGCAATGCCAGCCTCATGGG - Intronic
1178430557 21:32515006-32515028 CCCTGGGAAATCAGACTCAGAGG - Exonic
1178631061 21:34261823-34261845 CCCAAGGAGGACAGACTCTGAGG + Intergenic
1178910444 21:36669262-36669284 CCCAGAGAAGCCAGAGTGAGGGG - Intergenic
1179570415 21:42275308-42275330 CCCAGGGATGCTGGGCCCAGGGG - Intronic
1181754212 22:25011572-25011594 ACCAGGCAGGCCAGGCTCAGTGG - Intronic
1182461587 22:30487287-30487309 ACCAGGCATGGCAGACTCTGGGG - Intergenic
1182743174 22:32583535-32583557 GGCATGGATGCCAGAATCAGTGG + Intronic
1183411060 22:37655356-37655378 CCCAGGGCTGCCAGAGCCAGGGG - Exonic
1183947510 22:41335021-41335043 GCCAGGGAAGCAAGACTAAGAGG + Intronic
1184177511 22:42797197-42797219 CTCAGGGCTGCCAGAATCAGCGG - Exonic
1184248222 22:43246268-43246290 CCCAGGGATCCCACCCACAGGGG - Intronic
1184850306 22:47116004-47116026 CCCTGGGAAGCCAAACTGAGAGG - Intronic
949479044 3:4475960-4475982 CCCAGGGATGTGTGACTAAGGGG + Intergenic
952391450 3:32884236-32884258 CCCATGGAAGCCAGGCACAGAGG - Intronic
953378310 3:42447250-42447272 CCCAGGGATGCCACTCACATAGG - Intergenic
953842360 3:46399338-46399360 CCCAGGGAGACCAATCTCAGTGG + Intergenic
954363934 3:50136494-50136516 CCCAGGGTTGCCAGAATCTGGGG + Intergenic
954459587 3:50618567-50618589 CCCAGAGATGACAGATTCAAGGG - Intronic
956704047 3:71983999-71984021 CCCAGGGATGATAGAGTGAGGGG - Intergenic
957646791 3:82940049-82940071 TTCAGGGAGCCCAGACTCAGGGG + Intergenic
957808824 3:85190188-85190210 CCCAGTGATTCTAGACTCTGAGG - Intronic
959530538 3:107430538-107430560 CCCTGGGAAGCCGGCCTCAGTGG + Intergenic
961855195 3:129863572-129863594 CCCAGAGAGGCCAGGCGCAGTGG + Intronic
962782035 3:138728488-138728510 CCAATGGATGCCAGGCGCAGTGG + Intronic
962849410 3:139296868-139296890 GCCAGAGCTGCCAGATTCAGTGG - Intronic
962924300 3:139977369-139977391 CCCAGGGATGCCAGCCAAAGAGG - Intronic
963161806 3:142158363-142158385 CACAGAGAAGCCAGACACAGTGG - Intergenic
966376204 3:179298192-179298214 GACAGGGATGACAAACTCAGTGG - Intergenic
966593220 3:181703961-181703983 CCCAGGGATCCCAGCCTGTGGGG + Intergenic
967404785 3:189103382-189103404 GCCAGAGATGCCAGACCCTGAGG + Intronic
967915178 3:194573234-194573256 CCCAGGGAAGGCAGCCTCAAGGG + Intergenic
968591639 4:1462607-1462629 CCCAGAGGAGCCACACTCAGGGG + Intergenic
968876293 4:3269525-3269547 CCCAGGGGTGCGAGGCTGAGAGG - Intronic
968944246 4:3655250-3655272 CGCAGGGCAGCCAGACTCTGAGG - Intergenic
969668382 4:8575332-8575354 TCCAGGGCTGCCAGACTGAAAGG + Intronic
973858577 4:55038233-55038255 CCCTGGGATGGCAGAATAAGAGG - Intergenic
974384246 4:61184306-61184328 CCCAGGTATGCCATCCCCAGCGG + Intergenic
977949895 4:102958633-102958655 CCCAGAGAGGCCAGGCGCAGTGG + Intronic
978314740 4:107423160-107423182 ACCAGGGAGGCCAGGCACAGTGG + Intergenic
978378265 4:108098159-108098181 CCCAGGGATGGCATATTCAGAGG + Intronic
980945974 4:139320806-139320828 ACCAGGGAGGCCAGACGCAGAGG - Intronic
981714584 4:147740021-147740043 CCCAGTAAGGCCAGACGCAGTGG - Intronic
984984615 4:185315579-185315601 ACCAGTGAGGCCAGACACAGTGG - Intronic
985879164 5:2625486-2625508 CCCAGGGCTGCCTGAGGCAGAGG + Intergenic
987642096 5:20625862-20625884 ACCAGGGATGACACACACAGAGG + Intergenic
988181865 5:27806023-27806045 CCAAGGGGGCCCAGACTCAGGGG + Intergenic
988297977 5:29390742-29390764 TTCAGGGATGCCAGACTCTGTGG + Intergenic
988363920 5:30271675-30271697 CCCAAGGGGGCCAGGCTCAGTGG + Intergenic
989024202 5:37047172-37047194 CCCAGGGATACCAAAATCCGTGG - Intronic
990991893 5:61693721-61693743 CACAGTGATGTCAGACTCAATGG - Intronic
991532650 5:67632823-67632845 TCCAGGGAGTCCAGACTAAGAGG + Intergenic
992430050 5:76701729-76701751 TCAAGGGAAGCCAGACTCACTGG + Intronic
994131214 5:96230233-96230255 CCCAGGGATGCCCTAGGCAGAGG + Intergenic
994785233 5:104151424-104151446 CCCAGGACTGCCAGACTCTAGGG + Intergenic
995434577 5:112120903-112120925 CCCAGGGTTGCTAGACTCACTGG - Intergenic
997375244 5:133393111-133393133 CCCAGGGATGCTGGACTACGGGG + Intronic
997438405 5:133891600-133891622 CCCAAGCCTGCCAGCCTCAGAGG - Intergenic
997521821 5:134527915-134527937 CCCAGGGGTGCTAGACGCAGCGG - Intronic
998161853 5:139817416-139817438 CCCAAGGATGACAGAATCACAGG - Intronic
999255379 5:150207003-150207025 CTCAGGAATGCCAGCTTCAGAGG + Intronic
1001722668 5:173869374-173869396 CCCAGGCATTCCTGATTCAGGGG + Intergenic
1002143001 5:177155990-177156012 CCCATGCAGGCCAGACGCAGTGG - Intronic
1002521364 5:179794748-179794770 GCCAGGGCTGCAGGACTCAGGGG + Intronic
1007342311 6:41199147-41199169 CCCTGGGATGCCGGGCACAGTGG - Intronic
1007470289 6:42085695-42085717 CCCAGGGAGGCCAGGCACGGTGG + Intronic
1007723627 6:43900931-43900953 CCCTGTGATGGCAGAGTCAGCGG - Intergenic
1013162833 6:107562304-107562326 ACCAGGGAGGCCAGGCGCAGTGG - Intronic
1013417107 6:109934719-109934741 CCCAGGGATTCCACTCACAGGGG + Intergenic
1015163566 6:130178878-130178900 CCCAGGTATGCATGAGTCAGAGG + Intronic
1015512601 6:134053293-134053315 CTCAGAGAGGCCAGACTAAGTGG + Intergenic
1016064318 6:139663318-139663340 CTCAGGGATGGCAGAGGCAGAGG + Intergenic
1017247810 6:152245983-152246005 CCCAGGGAGAGAAGACTCAGGGG - Intronic
1017731722 6:157323258-157323280 CCCTGGGCCGCCAGACTCCGCGG + Intronic
1018113192 6:160556980-160557002 CCCCAGGATGACAAACTCAGCGG + Intronic
1018247861 6:161839545-161839567 CCCAAGCATTCCAGAGTCAGTGG - Intronic
1018990693 6:168671448-168671470 CCCAGGGATGCAGGACGGAGAGG - Intronic
1018990712 6:168671501-168671523 CCCAGGGATGCAGGACGGAGAGG - Intronic
1019400375 7:848752-848774 CCCAGGGATGCAAGATCCAGAGG - Intronic
1019729393 7:2622127-2622149 CCCAAGGTGGCCAGACACAGTGG + Intergenic
1019907006 7:4072482-4072504 CCCAGTGATGCCCGCATCAGGGG + Intronic
1021621825 7:22556571-22556593 ACCAAGTATCCCAGACTCAGTGG + Intronic
1022261187 7:28706496-28706518 TACAGGGAAGCCATACTCAGTGG + Intronic
1024188499 7:46980671-46980693 CTCAGGGATTCCATTCTCAGTGG - Intergenic
1026997140 7:74624902-74624924 GCCAGGCATGCCAGGCGCAGTGG + Intergenic
1027237730 7:76307827-76307849 CCCAGGGGAGCTACACTCAGAGG - Intergenic
1030600925 7:111590842-111590864 CCCAGAGAAGACAGAATCAGTGG + Intergenic
1031086718 7:117309331-117309353 CCCAGGTAGGCCATGCTCAGGGG + Intronic
1032885041 7:136128438-136128460 TCCAATGATGCCAGACACAGTGG + Intergenic
1032984721 7:137325363-137325385 CCTAGGGAGGGCAGAATCAGTGG - Intronic
1033254146 7:139785021-139785043 CCCAGAGATTCCTGAGTCAGTGG - Intronic
1033853980 7:145534499-145534521 TCCATGGATGCTAAACTCAGAGG - Intergenic
1035822676 8:2611115-2611137 TCCAGAGACCCCAGACTCAGAGG + Intergenic
1037665577 8:20966855-20966877 CCCAGTGATGCCAGAAGCCGAGG + Intergenic
1037769284 8:21789371-21789393 CCCAGGCTTCCCAGACCCAGCGG - Intronic
1038424425 8:27455226-27455248 CACAGGGATCCCAGGATCAGGGG + Intronic
1038516751 8:28193927-28193949 TCCTGTGATGCCAGGCTCAGAGG - Intergenic
1038662763 8:29511457-29511479 CCCAGGGAAGCCAGAATGAAGGG + Intergenic
1039479999 8:37865605-37865627 CCCAGGAAGGCCGGGCTCAGTGG - Intronic
1039488799 8:37932177-37932199 CCCCTGGAGGCCAGACACAGTGG + Intergenic
1039635182 8:39157112-39157134 ACCAGGGAGGCCAGAGGCAGTGG - Intronic
1039859832 8:41447569-41447591 GCCAGGGGTGCCAGACTGAAAGG + Intergenic
1040010131 8:42654693-42654715 TCCAGAGATGCCAGTCTCATTGG - Intergenic
1040485471 8:47867023-47867045 CACAGGGAAGCCAGATGCAGTGG - Intronic
1041539590 8:58967793-58967815 CCCAGGGAAACCAGAGTGAGGGG - Intronic
1042739475 8:72027339-72027361 CCCAGTGGTGCCAGGCTCAGTGG - Intronic
1043087043 8:75848624-75848646 CCCAGGGAGACTAGAGTCAGGGG + Intergenic
1046187150 8:110735317-110735339 TGCAGGGATGCCAGCTTCAGCGG - Intergenic
1046450134 8:114378576-114378598 TCCAGGGATACCATTCTCAGAGG + Intergenic
1046745113 8:117868192-117868214 CACAGGGATGCCACATACAGAGG - Intronic
1047024900 8:120813645-120813667 AGCAGGGATGGCAGTCTCAGGGG + Intergenic
1047144537 8:122182843-122182865 CCCTGGGTTGCTAGACTCTGAGG + Intergenic
1048834040 8:138501326-138501348 CCCATGAAGGCCAGACTCTGGGG - Intergenic
1049364983 8:142232761-142232783 CCCAGGGATGCCAGATGCTGGGG + Intronic
1049547548 8:143240554-143240576 GCCTGGGATACCAGCCTCAGTGG - Intergenic
1049790073 8:144468419-144468441 CCCAGGGATCCATGGCTCAGGGG + Intronic
1050222294 9:3406248-3406270 CCCAGGGTTGGCCGAGTCAGTGG - Intronic
1050600103 9:7241945-7241967 CTCAGGGGTGCCAGAGGCAGAGG - Intergenic
1051380876 9:16457360-16457382 CCCAGGATTGCGAGACTCACAGG + Intronic
1052434812 9:28412876-28412898 CTCAGGGATGACAGAGGCAGAGG - Intronic
1055074673 9:72201475-72201497 GCAAGGAATGGCAGACTCAGTGG - Intronic
1056839524 9:89987214-89987236 TCCATGGATGCCTCACTCAGTGG - Intergenic
1057126938 9:92624191-92624213 GCCAGGCATGCCAGGCACAGTGG + Intronic
1057274618 9:93669752-93669774 CACAGGGAGCCCAGACACAGAGG - Intronic
1057625257 9:96670851-96670873 GACACGGATGCCAGGCTCAGTGG - Intergenic
1059381844 9:113933108-113933130 CCCAGTGCTGCCAAACCCAGTGG - Intronic
1059649525 9:116302850-116302872 CCCAGGGATTCCTGGATCAGTGG + Exonic
1060663567 9:125419134-125419156 CCAAAAGAAGCCAGACTCAGGGG - Intergenic
1060893867 9:127205096-127205118 CCCGAGGACACCAGACTCAGGGG - Intronic
1061116929 9:128619553-128619575 CCAAGTGAAGACAGACTCAGAGG - Intronic
1061321812 9:129835593-129835615 GCCAGGTACGCCAGACGCAGCGG + Intronic
1061508446 9:131045944-131045966 CCAAGGGAGGCCAGTCTCAACGG - Intronic
1062022858 9:134327265-134327287 CCCGGGGGTGCCAGAGTGAGGGG - Intronic
1062678547 9:137763243-137763265 ACCGGGGATCACAGACTCAGAGG + Intronic
1190453281 X:50601998-50602020 CCCAGGGATTACAGACTAAATGG - Intronic
1193698716 X:84739276-84739298 TTCAGGGATGCCTGACTCGGTGG + Intergenic
1197870337 X:131058068-131058090 CCCAGGGAGCCCAGAGTCTGAGG - Intergenic
1197948175 X:131863078-131863100 CCCAGGGATGTTAGCCTCAGAGG - Intergenic
1198995128 X:142566179-142566201 CCCAGTGATGACAGCCACAGGGG - Intergenic
1200118673 X:153780505-153780527 CCCAGTGACGCCACATTCAGAGG + Intronic
1201729746 Y:17191089-17191111 CCAAGGGAGGTCAGACTTAGTGG + Intergenic