ID: 926197174

View in Genome Browser
Species Human (GRCh38)
Location 2:10771117-10771139
Sequence CCCTCCTCAGGGAGCCTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 269}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926197174_926197178 4 Left 926197174 2:10771117-10771139 CCACGCAGGCTCCCTGAGGAGGG 0: 1
1: 0
2: 0
3: 39
4: 269
Right 926197178 2:10771144-10771166 TCCCATTGCCTTTAAAGCTTTGG 0: 1
1: 0
2: 0
3: 7
4: 142
926197174_926197181 10 Left 926197174 2:10771117-10771139 CCACGCAGGCTCCCTGAGGAGGG 0: 1
1: 0
2: 0
3: 39
4: 269
Right 926197181 2:10771150-10771172 TGCCTTTAAAGCTTTGGCCATGG 0: 1
1: 1
2: 2
3: 15
4: 148
926197174_926197183 21 Left 926197174 2:10771117-10771139 CCACGCAGGCTCCCTGAGGAGGG 0: 1
1: 0
2: 0
3: 39
4: 269
Right 926197183 2:10771161-10771183 CTTTGGCCATGGCTCAACGCTGG 0: 1
1: 0
2: 0
3: 2
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926197174 Original CRISPR CCCTCCTCAGGGAGCCTGCG TGG (reversed) Intronic
900087985 1:907786-907808 CCCTCCTCGGGGATCCCGCAGGG + Intergenic
900136492 1:1119704-1119726 CGCTCCTCAGGGTGTCTGCACGG - Intergenic
900291692 1:1926421-1926443 CCCAGCTCAGGCGGCCTGCGGGG - Intronic
900461198 1:2802780-2802802 CCCTCCCCAAAGGGCCTGCGGGG - Intergenic
900644649 1:3703392-3703414 CCCTGCTAAGGGAGCCTGCCTGG + Intronic
901443629 1:9293572-9293594 CCTCCCCCAGGGAGCCTGCCGGG + Intronic
901790497 1:11651212-11651234 ACCTCCTCAGGAAGCCTTCCGGG + Intronic
901801628 1:11711578-11711600 CCCTCCTCAGAGGGCCTGGTAGG + Intronic
902244882 1:15114301-15114323 CCCTGCTCAGGGAGGTTGAGGGG - Intronic
902525255 1:17053390-17053412 CCCACCTCCGGGATCCTTCGAGG + Intronic
902590081 1:17467610-17467632 CACTTCTCAGGCAGCCTGCCTGG + Intergenic
902924847 1:19689339-19689361 CCCTCCTCAGGCTGTCTTCGTGG - Intronic
904302237 1:29561778-29561800 CCCTCCTTAGGGTGGCTGTGAGG - Intergenic
905257871 1:36696662-36696684 CCATCTGCAGGGAGCCTGCCTGG + Intergenic
905859761 1:41342411-41342433 GCCTCCTCAGGGAGCCTGGAGGG - Intergenic
906479199 1:46189246-46189268 ACCTCCTCCAGGACCCTGCGGGG - Exonic
906826566 1:48987864-48987886 CCATCCTCAGGGATCCAGTGTGG + Intronic
907444655 1:54499862-54499884 CCAACCTCAGGGGGCCTGAGAGG + Intergenic
908734020 1:67257046-67257068 GCCTCCTTAGGGAGCTTGCCAGG - Intronic
912927829 1:113929424-113929446 GCCTCCGTAGGGAGCCAGCGTGG - Intronic
913510632 1:119558612-119558634 CCCTCTTCAGGGGGTCTGCATGG + Intergenic
913514846 1:119596025-119596047 CCCTCTTCAGGGGGTCTGCATGG + Intergenic
915537975 1:156548964-156548986 CACTCCTGAGGGAGGCAGCGTGG + Intronic
916173505 1:162019685-162019707 CCCTCCTTATGGAGCCAGAGAGG - Intronic
919083301 1:192891650-192891672 CCCTCCTGTGGGTGCCTGCTGGG - Intergenic
920431357 1:205921244-205921266 CCCTCCTCAGAGAACCTGGGTGG + Intronic
921414666 1:214871840-214871862 CCCTCTTCAGGGGGTCTGCATGG - Intergenic
922703327 1:227775049-227775071 CCCTCCTCAGGACGCCCCCGCGG - Intronic
1062833710 10:623100-623122 CCCTTCCCAGGGAGCCAGTGAGG + Intronic
1062932366 10:1361693-1361715 CACTGCTCAGGGAGACTGCAGGG - Intronic
1062939536 10:1411040-1411062 CCTCCCTCAGGGCGCCTGCAGGG + Intronic
1064230697 10:13528184-13528206 CCCTCCTCGGGGCGCCTCCGGGG - Intronic
1064263981 10:13809641-13809663 CCCTCGTCCTGGAGCCTGCAGGG - Intronic
1064409543 10:15093118-15093140 CCCTCTTCAGGGCGTCTGCGTGG + Intergenic
1068030293 10:51698067-51698089 CCCTCCTCAGGGACCCAGACAGG - Exonic
1070301929 10:75210360-75210382 CCCTGCATAGGGTGCCTGCGGGG - Intronic
1073177343 10:101564620-101564642 CAATCCCCAGGGAGCCTGAGAGG - Intergenic
1073185000 10:101610616-101610638 CCCTTCTCCTGGAGCCTGCTAGG + Intergenic
1073374482 10:103021233-103021255 CCTTCGTCAGGGAGGCTGTGGGG - Intronic
1073460155 10:103661454-103661476 CCGGCATGAGGGAGCCTGCGGGG + Intronic
1074056721 10:109928893-109928915 CCCTCCTCAAGAAGCCTTTGGGG + Intergenic
1074592089 10:114822364-114822386 CCCTCCTCCAGGAGCCGGGGCGG + Intronic
1075900545 10:126039690-126039712 CACGCCTCAGGGAACCTGCGTGG - Intronic
1076426438 10:130370575-130370597 CTCTGCTCTGGGAGCCTGTGGGG + Intergenic
1076788947 10:132766855-132766877 GCGGCCTCAGGGAGCCTGGGTGG + Intronic
1076871106 10:133195575-133195597 CCCACCTCAGGCACCCTGAGGGG - Intronic
1077024536 11:433367-433389 CTCTCCTCCTGGAGCCTGAGGGG - Exonic
1077101503 11:824515-824537 ACCTGCTCCGGCAGCCTGCGGGG - Exonic
1077135745 11:997422-997444 CCCTCCTCAGGGAGCAGGCCTGG - Intronic
1077282067 11:1750322-1750344 CCCAGCTCAGGGAACCTGCGTGG - Intronic
1077298298 11:1836110-1836132 CCCTGATCTGGGAGCCAGCGGGG - Exonic
1077480440 11:2812074-2812096 GCCTCCTCAGGAAGCCTCCCAGG + Intronic
1077485309 11:2835795-2835817 CCTTCCTCATGGAGGCGGCGGGG + Intronic
1079357254 11:19740018-19740040 CCCTCCAGGGGGAGCCTGCTCGG - Intronic
1079656489 11:22992290-22992312 CCCTTCTCAGGGAGTCTGTGAGG + Intergenic
1081484174 11:43515331-43515353 CTCTGGTCAGGGAGCCTGCGTGG - Intergenic
1081618234 11:44603184-44603206 CCTTCCTCAGGGTGAGTGCGGGG - Intronic
1082808413 11:57464091-57464113 CGCTCTTCAGAGAGCCTGCAGGG + Intronic
1083609414 11:63998026-63998048 CCCTCCACCGGGAGTCTGCATGG + Exonic
1083820646 11:65169566-65169588 ACGGCCTCAGGGAGCCTGGGAGG + Intergenic
1084225441 11:67712095-67712117 CCCTCCTCCGGGAGCCTCCCGGG + Intergenic
1084263263 11:67991945-67991967 CCCTCCTCCGGGAGCCTCCCGGG + Intronic
1084476288 11:69391510-69391532 CCCTACTGAGGGAGCCAGAGGGG + Intergenic
1084696935 11:70761339-70761361 CCCAGATCAGGGAGCCTGCCTGG - Intronic
1084743607 11:71154722-71154744 CCCTCCTCTGGGAGCGTGGGTGG - Intronic
1084743631 11:71154789-71154811 CCCTCTTCTGGGAGCATGGGCGG - Intronic
1084743656 11:71154859-71154881 CCCTCCTCTGGGAGCGTGGGCGG - Intronic
1084743681 11:71154926-71154948 CCCTCCTCTGGGAGCGTGGGCGG - Intronic
1084743693 11:71154961-71154983 CCCTCTTCTGGGAGCGTGGGCGG - Intronic
1084743849 11:71155395-71155417 CCCTCTTCTGGGAGCGTGGGCGG - Intronic
1084743862 11:71155430-71155452 CCCTCCTCTGGGAGCGTGGGCGG - Intronic
1084810138 11:71607182-71607204 CCCTCCTCCGGGAGCCTCCCGGG - Intergenic
1084956897 11:72696453-72696475 CCCTCCTCTGGGAGCCAGCTGGG - Intronic
1085041127 11:73327005-73327027 CCCTGCCCAGGGAGCCTGGCTGG - Intronic
1086581738 11:88408037-88408059 CCCTCTTCAGGGGGTCTGCATGG + Intergenic
1087293287 11:96341857-96341879 CCCTCCTGCGGGGGCCTGCGGGG + Exonic
1088735663 11:112725787-112725809 CTGTCCTCAGGGAGCTTGCAGGG + Intergenic
1089768214 11:120783974-120783996 CCAGCCTCAGGGAGGCTGAGGGG + Intronic
1092287580 12:7137698-7137720 CCCTCCTCAGCCAGCCAGCCAGG + Intronic
1093250589 12:16799240-16799262 GCCTTTTCAGGGAGCCTGCAAGG - Intergenic
1095951438 12:47783961-47783983 CCCTGGTCAGGAAGCCTGGGAGG + Intronic
1096229452 12:49889068-49889090 CCCTCCCCATGGGGCCTGCTGGG + Intronic
1098022365 12:66169670-66169692 CCCTCCTCAGGGAGTCGGGGAGG - Intronic
1101139106 12:101776886-101776908 GCCTCCTGGGGGAACCTGCGAGG + Intronic
1101399284 12:104373780-104373802 GCCTACTCATGGAGCCTGCCAGG - Intergenic
1101886303 12:108666075-108666097 ACCTCCTCAGGGAGCCCTCCTGG - Intronic
1102012756 12:109628677-109628699 CCCACCTCACAGAGCCTGGGGGG + Intergenic
1102829848 12:115987895-115987917 CCCTCCCCAGGGCGACTGCTGGG - Intronic
1106719765 13:32426422-32426444 CCCTCCCCAGCGAGCCAGAGAGG + Intronic
1107913089 13:45123870-45123892 CCCTCTTCAGGGGGTCTGCATGG + Intronic
1111806007 13:93041257-93041279 CCCTCATTAGGAAGCCTGCTGGG - Intergenic
1112140314 13:96634107-96634129 CCCAGCTCAGGGAGCCAGCATGG - Intronic
1113952326 13:114078967-114078989 CCCTCCCCAGGATGCCTGCAGGG - Intronic
1119469069 14:74882212-74882234 CCTTCTCCAGGCAGCCTGCGGGG + Intronic
1120848165 14:89144510-89144532 CCCTTCTCATGGAGCCTGGAAGG + Intronic
1121641501 14:95487460-95487482 CCCTCCTCAGGGAGCTCCTGTGG - Intergenic
1121685381 14:95831631-95831653 CCCTCTCCAGGGAGCCAGTGGGG - Intergenic
1122027185 14:98886585-98886607 CCAGCCTCAGGGAGCCTGTCTGG - Intergenic
1122064615 14:99163608-99163630 CCCTCCTCATGCAGCCTGAAGGG + Intergenic
1122415872 14:101549221-101549243 CCCTCCTCGGGGACGCTGTGGGG - Intergenic
1122720003 14:103716385-103716407 CCCTCCCCACCGAGCCTGCGAGG - Intronic
1122996535 14:105268333-105268355 CCCAGCCCAGGGAGGCTGCGTGG - Intronic
1123026329 14:105425970-105425992 CCCGCCCCAGGGAGGCTGCCGGG - Intronic
1124379767 15:29155646-29155668 CCCACCCCAGGGAGTCTGCAGGG + Intronic
1128803625 15:70514206-70514228 CCCTCCATATGGAGCCTGCTGGG - Intergenic
1129239927 15:74245153-74245175 CCGTCCTCAGGGAGCCCCAGAGG - Intronic
1130274526 15:82469509-82469531 CCCACCTCAGGGTGCCCCCGTGG - Intergenic
1130466874 15:84196883-84196905 CCCACCTCAGGGTGCCCCCGTGG - Intergenic
1130497390 15:84476653-84476675 CCCACCTCAGGGTGCCCCCGTGG + Intergenic
1130514029 15:84612111-84612133 CCTTTCTCAGGGAGCCTGGAGGG + Intronic
1130589168 15:85201476-85201498 CCCACCTCAGGGTGCCCCCGTGG - Intergenic
1132566609 16:626337-626359 CCCCCCTCAGGGTGCCGCCGTGG + Intronic
1132609878 16:810344-810366 CCCTCCTCAGGGAACCAGAGGGG - Intronic
1132726902 16:1342843-1342865 CCCTCCTCAGGCCCCCTGCCGGG - Intronic
1136133432 16:28239543-28239565 CCCTCTTCAGGGGGTCTGCATGG + Intergenic
1136278048 16:29191177-29191199 CCTTCCTGAGAGAGCCTGTGAGG - Intergenic
1142002274 16:87670669-87670691 CGGTCCTCAGGGACCCGGCGGGG + Intronic
1142037732 16:87872283-87872305 CCCCCCTCAGAGCGCCAGCGTGG + Intergenic
1142082424 16:88157217-88157239 CCTTCCTGAGAGAGCCTGTGAGG - Intergenic
1142178921 16:88657811-88657833 CCCTCCTGAGGCAGCAGGCGGGG - Intronic
1142472695 17:172153-172175 CACTCCTCAGGGCGTCTGGGAGG + Intronic
1142559647 17:802614-802636 CCAGCCCCAGGGAGGCTGCGCGG - Intronic
1142851448 17:2706730-2706752 CCTTTCTCAGGGACCCTGTGGGG - Intronic
1142881068 17:2883033-2883055 CTCTTCTGAGGGAGGCTGCGGGG + Intronic
1143037176 17:4005965-4005987 CCCACCTCTGGGACTCTGCGTGG - Exonic
1143519692 17:7438248-7438270 CCCTCCTCGGAGAGCCGGCCCGG - Intergenic
1143768304 17:9151725-9151747 CTCTCCACAGGGACCCTCCGTGG - Intronic
1144788936 17:17846949-17846971 CCCTGCCCAGGGAGCCTGCAGGG + Exonic
1147132481 17:38417727-38417749 CCCTCCCCAGGCAGCCAGCAGGG + Intergenic
1151450493 17:74195760-74195782 CCCACCTGAGGGATCCTTCGAGG - Intergenic
1151552819 17:74831811-74831833 CCCACCTCGTGGAGGCTGCGTGG - Intronic
1151819486 17:76489958-76489980 CCCCTCTCAGGGAGCCAGAGAGG + Intronic
1152229286 17:79106515-79106537 CACTGCGCAGGGAGCCTCCGGGG - Intronic
1152563555 17:81090316-81090338 ACCTTCTCACGGTGCCTGCGTGG + Intronic
1152572316 17:81126328-81126350 CCTGCCTCAGGGGGCTTGCGAGG - Intronic
1152601222 17:81263227-81263249 CCGTACACAGGGAGCCTGCATGG + Intronic
1152786276 17:82249590-82249612 GCCTCCTCAGGGTGCCAGCCGGG - Exonic
1153341252 18:3977513-3977535 CCCTCTTCAGGGGGTCTGCATGG + Intronic
1153363868 18:4231340-4231362 CCCTGCTCTGGAAGCCTGGGTGG + Intronic
1157153139 18:45239457-45239479 GCCACCTCAGGGATCCTGCCCGG - Intronic
1157179205 18:45480691-45480713 CCCTCCCCTGGGGGCCTGCATGG + Intronic
1157577888 18:48755727-48755749 CCCTTCTCAGGAGGCCTGTGTGG - Intronic
1158703412 18:59769989-59770011 CCCTACTGAGTGAGCCTGCATGG - Intergenic
1161009090 19:1951506-1951528 GCCTCCTCAGGGAGCCCCAGAGG - Intronic
1161043457 19:2122094-2122116 CCTTCCTGAGGGAGCCGGCATGG - Intronic
1161273530 19:3403654-3403676 CCCTCCCCTGGGCGCCTGCCCGG + Intronic
1161718725 19:5891922-5891944 AGCCCCTCAGGGAGCCTGCTGGG + Exonic
1161967651 19:7557160-7557182 ACCGCCACAGGGAGCCTGCGCGG - Exonic
1164670950 19:30071560-30071582 CCCTCCACGGGGAGCCCGGGAGG - Intergenic
1164737301 19:30551377-30551399 CCAACGTCAGGGAGCCTGCCGGG + Intronic
1164794221 19:31013568-31013590 CCCTCCTCAGTGGGCCTGGGCGG - Intergenic
1164855286 19:31516396-31516418 CCCTCCACAGGGACCCTGACTGG - Intergenic
1165097531 19:33417732-33417754 CCCTCCTCAGGCAGCAGGAGAGG + Intronic
1166126360 19:40717332-40717354 GCCTCCACAGCGAGCCTGAGAGG + Exonic
1166612095 19:44207624-44207646 GCCTCGTCAGGGAGCAAGCGGGG + Intronic
1166939866 19:46356056-46356078 CCAGCCTCAGGGAGTATGCGGGG - Intronic
1167592927 19:50414159-50414181 CCCCCATCAGGGTCCCTGCGTGG - Intronic
1167636725 19:50659847-50659869 CAGTCCGCAGGGGGCCTGCGCGG - Intronic
925185211 2:1842408-1842430 CCCACCTCCTGGAGCCAGCGGGG + Intronic
925201020 2:1967914-1967936 GTGTCCTCAGGGAGCCTGGGAGG + Intronic
925313120 2:2902016-2902038 CCATCCTCAGGTGGCCAGCGAGG + Intergenic
926197174 2:10771117-10771139 CCCTCCTCAGGGAGCCTGCGTGG - Intronic
927461661 2:23304576-23304598 CCAGGCTCAGGGAGCCTGCATGG + Intergenic
928088115 2:28358330-28358352 CCCTGCAGAGGGAGCCTGCTGGG + Intergenic
928455344 2:31415865-31415887 TCCCCCTCAGGTAGCCTGCTAGG - Intergenic
929509343 2:42554734-42554756 CCCTTCTCAGAGAGGCTGTGAGG - Intronic
930680942 2:54255979-54256001 CCCTCCTCTGGAAGCCGGGGCGG + Exonic
932699567 2:73984190-73984212 CCCTCCTCTGGGAGGCAGGGCGG + Intergenic
934763977 2:96870154-96870176 CCCTCCTGAGCGAGCCTTCGCGG - Intronic
934777535 2:96948947-96948969 CCCCCCCCAGTAAGCCTGCGTGG + Intronic
934858150 2:97741574-97741596 CCATACCCAGGGAGCCTGGGCGG - Intergenic
936239059 2:110771360-110771382 GCCTGCTCAGGGAGCATGCCAGG + Intronic
937116439 2:119408264-119408286 CCCAGCTCAGCGAGCCTGCCAGG + Intergenic
938072493 2:128316071-128316093 CCCTGCCCAGGGAGCATGTGTGG - Intronic
938481831 2:131669485-131669507 CCCTCCTCAGAGACCCGGGGGGG - Intergenic
941920839 2:170849278-170849300 ACCTCCCCAGGCAGCCTGTGGGG - Exonic
942653934 2:178195027-178195049 CAATCCCCAGGCAGCCTGCGGGG - Intronic
946590300 2:221239813-221239835 ACCTCCTTAGGGCCCCTGCGTGG + Intergenic
947168361 2:227286027-227286049 CTCTCCACAAGGAGGCTGCGTGG + Intronic
947624932 2:231613385-231613407 CCCACCCCAGGGACCCCGCGGGG + Intergenic
948052918 2:234991974-234991996 CCCTGTCCAGGGAGCCTGCCGGG + Intronic
948487428 2:238289641-238289663 CCTTTCTCACGGAGCCTGTGGGG - Intronic
948892292 2:240913339-240913361 CCTCCCCCAGGAAGCCTGCGTGG + Intergenic
948949676 2:241240818-241240840 CCCTTCTCGGGGCCCCTGCGTGG - Intronic
1169087841 20:2838448-2838470 CCCGCCGCAGGGAGCCTGCCAGG + Exonic
1170169381 20:13393795-13393817 CCCTCTTCAGGGTGTCTGCATGG - Intronic
1172481838 20:35276088-35276110 CCCTGCTCACTGAGCCTGCATGG + Exonic
1172759333 20:37311066-37311088 CTGGCCTCAGGGAGCCTGAGTGG + Intronic
1172950842 20:38722787-38722809 GCCTCCTCCGGGAGACTGGGAGG + Intergenic
1174358975 20:50016082-50016104 CACTCCTCAGGGAGCATGGCTGG + Intergenic
1175217492 20:57399246-57399268 TCCTCCGCTCGGAGCCTGCGTGG - Intronic
1175539143 20:59737256-59737278 GCCTCCTCAGGGAGCCTCGAGGG - Intronic
1175667419 20:60872113-60872135 CCCTCCTCAGGGCACCTGGTGGG + Intergenic
1176205493 20:63885925-63885947 CCCTCCTCGGGGAGCCCCAGGGG - Intronic
1177638389 21:23815455-23815477 CCCTCCTCAGCCAGTCTGAGTGG + Intergenic
1180086959 21:45512013-45512035 CCCTCCACAGGCAGCCAGCAGGG + Intronic
1180702713 22:17790434-17790456 ACATCCTCAGGGAGCGCGCGGGG + Exonic
1181105107 22:20569621-20569643 CCCTCCTCAGGCAGCTTCCCAGG - Intronic
1181182831 22:21079366-21079388 CCCTTCTCAGGATGCCTGTGTGG + Intergenic
1181466141 22:23111733-23111755 CCTTCCTCAGGGAGCCAGCAGGG + Intronic
1182146841 22:28001859-28001881 CCCTTCTCAGGGTGCCTGTGCGG - Intronic
1182451506 22:30424439-30424461 GCCTCCGTAGGGAGCCAGCGGGG + Exonic
1182575041 22:31267396-31267418 CCCTGCTAAGGGAGCCTGGAGGG + Intronic
1183383625 22:37502896-37502918 CCCTCTTCTGGGAAACTGCGGGG - Intronic
1183649844 22:39147559-39147581 CCCTCCTCGGGGGCCCTGCTTGG - Intronic
1185274958 22:49946770-49946792 CCCTCCCCTGCGGGCCTGCGGGG - Intergenic
950503212 3:13377340-13377362 CCCTCCTCGGTCAGCCTGCATGG + Intronic
952497171 3:33925968-33925990 CCCTACTCCTGGAGCCTGAGGGG - Intergenic
953389318 3:42525459-42525481 TCCTCCTCAGTCAGCCTGCCTGG - Intronic
953494072 3:43371580-43371602 CCCTTCTCAGGGAGACTTGGAGG - Intronic
954539030 3:51381640-51381662 CCCACCCCAGGGAGCCAGAGAGG + Exonic
955772934 3:62404742-62404764 CCCTCCCCAGGGAGCAGGAGGGG + Intronic
957078701 3:75619887-75619909 CCCTCCTCCGGGAGCCTCCCGGG + Intergenic
961166307 3:124766221-124766243 CCGTCCTCAGGGAGCCAGGTAGG - Exonic
962710785 3:138083991-138084013 CTCTCCTTAAGGAGCCTGAGTGG + Intronic
963335517 3:143971008-143971030 CGCTCCTCAGGGACCCTCAGGGG + Intergenic
966883327 3:184361792-184361814 GCATCCGCAGGGAGCCGGCGCGG - Intronic
967018989 3:185506030-185506052 ACCTCCTCAGGGAGTCTTCTTGG - Intergenic
968058155 3:195708849-195708871 CCCTTCTCAGAGAACCTGCAGGG - Intergenic
968064964 3:195753484-195753506 CCCTCCTCTGCCAGCCTTCGGGG - Intronic
968229602 3:196997544-196997566 CCCTCCACATGGAGCCCACGGGG + Intronic
968735148 4:2291426-2291448 CCCTCCTCGGGGAGCCTAGAAGG - Intronic
969021780 4:4143855-4143877 CCCTCCTCCGGGAGCCTCCCCGG + Intergenic
969085473 4:4653036-4653058 CCCCCCTCAGGGGGCCAGGGTGG - Intergenic
969455351 4:7297070-7297092 CTCTCCTCAGAGTGCCTGGGGGG + Intronic
969732087 4:8963560-8963582 CCCTCCTCCGGGAGCCTCCCGGG - Intergenic
969791680 4:9497645-9497667 CCCTCCTCCGGGAGCCTCCCGGG - Intergenic
970379456 4:15492580-15492602 CCCTCTTCAGGGGGTCTGCATGG + Intronic
970432517 4:16001759-16001781 CACTCCTCTGAGAGCCTGTGTGG + Intronic
971853095 4:32009985-32010007 CCCTCCCCAGGGAGGCAGTGAGG + Intergenic
973700509 4:53532906-53532928 TCCTCCTCTGGGAGCCTGCTAGG + Intronic
979523839 4:121697097-121697119 CCGGCCTCAGCGCGCCTGCGTGG + Exonic
981015349 4:139968605-139968627 CCCACCTCAGGGAGTTTGTGAGG - Intronic
984280393 4:177663309-177663331 CCCTTCCCAGGGACCCTGAGAGG + Intergenic
984616836 4:181907694-181907716 CCCTCCTCTGAGAGCTTGTGGGG - Intergenic
984838998 4:184051000-184051022 CCCTGCCCAGGGAGCCAGCCTGG + Intergenic
985472205 5:53392-53414 CCCTTCTCAGGCAGGCTGTGGGG + Intergenic
985517250 5:353393-353415 CCCTCCTCAGGGATCCGTAGTGG + Intronic
985685930 5:1281456-1281478 CCCTCCACAGTCAGCCTGGGCGG + Intronic
985927166 5:3027451-3027473 CCCCCATCAGGGAGCCTGCTGGG - Intergenic
985958587 5:3282634-3282656 CCCCTCACGGGGAGCCTGCGTGG + Intergenic
986736667 5:10673535-10673557 CCTTTCTCAGGCTGCCTGCGTGG + Intergenic
992102280 5:73419317-73419339 CCCTCCTAAGGGTGCCTGGCTGG + Intergenic
994918102 5:106005142-106005164 CCCTCCTAAGGGAAGCTGTGAGG - Intergenic
997464436 5:134077986-134078008 GCCGCATCAGGGAGCCTGGGAGG + Intergenic
998093440 5:139383897-139383919 CCTGCCTCAGGGACCCTGAGGGG - Intronic
999743663 5:154575666-154575688 CCCTCCCCAGGCAGCCTGGGAGG - Intergenic
1000258243 5:159561058-159561080 TCCTCCTCAGGGAGGTTGTGTGG - Intergenic
1000329722 5:160197133-160197155 CCCTCCACAGGGGCCCTGCCCGG + Intronic
1001797504 5:174514431-174514453 CCCTCTTCAGGGTGTCTGCATGG - Intergenic
1002421716 5:179152491-179152513 CACACCTCAGGGAGCCTGGCGGG + Intronic
1004427989 6:15519028-15519050 CCCTGCTCAGCCAGCCTGCAAGG - Intronic
1006273351 6:32981123-32981145 CCCTCCCCATGGAGGCTGAGGGG - Exonic
1006508966 6:34511548-34511570 TCCTCCTCCGGGTGCCTGCCAGG + Intronic
1007718287 6:43869961-43869983 CCCACCACAGGGAGCCGGCTGGG - Intergenic
1008128316 6:47692843-47692865 CCCTCCTCATGGCACCTGCTTGG + Intronic
1012475789 6:99613776-99613798 CCCTGCTCTGGGGCCCTGCGCGG + Exonic
1012996797 6:105982648-105982670 CCATCCTCATGGAGCTTGCATGG + Intergenic
1014428719 6:121341094-121341116 CCCTCTCCAGGATGCCTGCGAGG - Intergenic
1018658751 6:166065420-166065442 CCCTCTTCAGGGGGTCTGCATGG - Intergenic
1018982546 6:168611957-168611979 ACCTCCCCAGGGACCCTGTGAGG - Intronic
1019149867 6:169998040-169998062 CCCACCTCAGGGAGCCCCTGGGG + Intergenic
1019436855 7:1026786-1026808 CCCTCCACGGGGAGCGTGCAAGG - Intronic
1019494090 7:1329549-1329571 GCCTCCTCAGGGAGCCCTCTGGG - Intergenic
1019721144 7:2572219-2572241 CCCTCACCTGGGAGCATGCGTGG + Exonic
1020309199 7:6855885-6855907 CCCTCCTCCGGGAGCCTCCCGGG + Intergenic
1020551836 7:9616108-9616130 CCCTCTTCAGGGGGTCTGCATGG - Intergenic
1022324632 7:29320065-29320087 CACTCCTCAGGGAGACTGGAAGG - Intronic
1023127094 7:36965238-36965260 CTGTCCTCAGGGAGGCAGCGGGG - Intronic
1024623837 7:51187767-51187789 CCCTCCTGAAGGTGCATGCGAGG - Intronic
1030879595 7:114861193-114861215 CACTACTCAGGGACTCTGCGAGG + Intergenic
1032151779 7:129435042-129435064 CCCGCCGCAGGCAGCCTGGGAGG - Intronic
1032159988 7:129502684-129502706 CCCTCCTCAGGGAACCGCCACGG - Exonic
1032498599 7:132381911-132381933 CTCACATCAGGAAGCCTGCGGGG - Intronic
1032977440 7:137241875-137241897 ACCTCTTCAGGGGGCCTTCGAGG + Intronic
1034965603 7:155388858-155388880 CCGGCCTCAGTGAGCCTTCGGGG + Intronic
1035119120 7:156550096-156550118 CTCTCCTCAGGCAGCCTCCTGGG - Intergenic
1035916356 8:3628660-3628682 CCCTTCTCGGGGCGCCTGTGAGG - Intronic
1037525564 8:19720794-19720816 CCCTCCTCTGGGATGCTGCTTGG - Intronic
1044582698 8:93837987-93838009 CCCTCCTCGGGAAGCCTTCCCGG + Intergenic
1047254682 8:123206599-123206621 GCCTCCTCAGGGAGCCTCTAAGG + Intronic
1049475460 8:142795124-142795146 CCCTCCTGAGTCAGCCTGCCTGG + Intergenic
1049475718 8:142796146-142796168 CCTTCCTCAGGAAGCCAGCCAGG - Intergenic
1050123541 9:2332709-2332731 CTTTCCTCAGGGAGCCTCAGAGG - Intergenic
1051967779 9:22849186-22849208 CCCTTCTCAGAGAGCCAGCCAGG + Intergenic
1054812077 9:69442895-69442917 CCCTGCTCAGGTACCCTGCCTGG + Intronic
1060140273 9:121203293-121203315 CCCTCCTTAGGCAACCTGGGTGG - Intronic
1060524409 9:124312364-124312386 CCCTGCTCTGGGAGCCTCCCAGG - Intronic
1060820213 9:126657568-126657590 GCCTCCTCAGGGAGGCTGGCTGG + Intronic
1061237739 9:129352212-129352234 CCATCCCCCGGGAGCCTACGGGG - Intergenic
1061284614 9:129615054-129615076 ACCTCCTCAGGCAGGCTTCGAGG + Intronic
1061907025 9:133704076-133704098 CCGTCCTCATGAACCCTGCGGGG - Intronic
1061969446 9:134035944-134035966 CACTCCTCACGGACCCTGTGCGG - Intronic
1062293582 9:135811012-135811034 CCCTCCGCTGGGAGCCTCAGTGG + Exonic
1062309315 9:135927393-135927415 CCCTGCTCTGGAAGGCTGCGTGG + Intergenic
1062620368 9:137417812-137417834 TCCTGCCCAGGGCGCCTGCGGGG + Intronic
1185461488 X:334691-334713 CCCTCCCCCGGGAGCATTCGTGG - Intronic
1187019971 X:15370867-15370889 CCCTCTTCAGGGGGTCTGCATGG + Intronic
1187179592 X:16931469-16931491 CTCTCCACAGGGTGCCTGAGTGG - Intergenic
1187747254 X:22422921-22422943 CCCTGCTCAGGGAGCATCAGAGG - Intergenic
1191721245 X:64230539-64230561 CCCTCCTTAGGGAGCCCCCACGG + Exonic
1192990751 X:76453839-76453861 CCTTCCTAAGGTAGCCTGCCTGG + Intergenic
1193152520 X:78139823-78139845 CCTTCCCCATGGAGCCTGCTGGG + Intergenic
1196141747 X:112270491-112270513 CCCTCCTTAGGGATCCTGCTGGG - Intergenic
1199851371 X:151726751-151726773 GGCTCCTCAGGGAGCTTGGGAGG + Intergenic
1199991058 X:152988033-152988055 CCCTCCTCAGGCAGCATCCAGGG + Intergenic
1200134361 X:153867710-153867732 CCCTCCTCCTGGAGCCTTCCTGG - Intronic
1200216809 X:154371698-154371720 CCTTCCCCAGGGCCCCTGCGGGG + Intronic
1201147460 Y:11072889-11072911 CCCTCCTCCGGGAGCATGGGTGG - Intergenic