ID: 926197600

View in Genome Browser
Species Human (GRCh38)
Location 2:10773139-10773161
Sequence CTGTGTGTCAGGAGGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 3, 3: 68, 4: 356}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926197586_926197600 22 Left 926197586 2:10773094-10773116 CCATCACGGGACACTGCATGGCG 0: 1
1: 0
2: 0
3: 2
4: 65
Right 926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG 0: 1
1: 0
2: 3
3: 68
4: 356
926197593_926197600 -7 Left 926197593 2:10773123-10773145 CCAAGGATGCCAGGCCCTGTGTG 0: 1
1: 0
2: 1
3: 36
4: 296
Right 926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG 0: 1
1: 0
2: 3
3: 68
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926197600 Original CRISPR CTGTGTGTCAGGAGGGATGA AGG Intronic
900012846 1:131538-131560 CTGGGTGTCAGGAGACATGATGG - Intergenic
900042911 1:487525-487547 CTGGGTGTCAGGAGACATGATGG - Intergenic
900064348 1:722522-722544 CTGGGTGTCAGGAGACATGATGG - Intergenic
900148265 1:1167603-1167625 CTGTCCGGCAGGAGGGAAGATGG - Intergenic
901078776 1:6571906-6571928 CTCTGAGCCAGGAGGGAAGAAGG - Intronic
901408916 1:9069376-9069398 CTCTGTGTTGGGAGGGATTATGG - Intronic
901862514 1:12083929-12083951 GTGTGTGGGAGGGGGGATGACGG + Intronic
901927060 1:12573022-12573044 CTGTGTGCCTGGAGGAGTGAGGG - Intronic
902451757 1:16500828-16500850 CTGTTTGTCAGGAGAGATTCGGG + Intergenic
902501191 1:16912837-16912859 CTGTTTGTCAGGAGAGATTCGGG - Intronic
902912232 1:19608275-19608297 CCGTGTGACTGGTGGGATGAAGG + Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903342250 1:22661800-22661822 CTGAGGATCAGAAGGGATGAAGG + Intergenic
903474994 1:23613411-23613433 CTAGGGGGCAGGAGGGATGAGGG + Intronic
903643582 1:24876700-24876722 CTGGGAGTCATGAGGGAGGATGG - Intergenic
904997214 1:34640441-34640463 TGGTGTGGCAGGAAGGATGATGG - Intergenic
905898950 1:41567919-41567941 CTGGGTCTCAGGAAGGATCAAGG - Intronic
906661981 1:47589546-47589568 CGGTGAGGAAGGAGGGATGATGG - Intergenic
906947817 1:50310435-50310457 GTGTGTGTCAGGAGAGAGGTTGG - Intergenic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908453656 1:64280961-64280983 CTGGTTGACATGAGGGATGATGG + Intergenic
908466943 1:64405553-64405575 ATGTGTGTGGGGAGGGTTGAAGG + Intergenic
908518932 1:64922043-64922065 CTGTGTCTCAGGAAGGGTGATGG - Intronic
909331056 1:74411508-74411530 CTGTGTGTCAGGGTGGGGGAGGG - Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
913092701 1:115490330-115490352 CTGTGTGTGAGGGAGGATGAAGG + Intergenic
915166693 1:153951960-153951982 CTGCCTGACTGGAGGGATGAAGG - Intronic
915325086 1:155077774-155077796 GTGTGTGTCAGGATGCATGTGGG + Intergenic
916738884 1:167631080-167631102 CTGTGTGTATGGAGGTATGCTGG + Intronic
916847869 1:168671601-168671623 ATGTGTGGCAAGAGGGAAGAGGG + Intergenic
917054733 1:170968282-170968304 ATGTGTGTCAAGAGGAATGCGGG - Intronic
917782339 1:178411720-178411742 CCGTGTGACTGGTGGGATGAAGG + Intronic
918139103 1:181705231-181705253 ATGTGTGCCTGGAGGGATGAGGG - Intronic
918143677 1:181738000-181738022 GTATGTGTCAGGAGACATGAGGG + Intronic
918666938 1:187163038-187163060 CTTTGTGTGAGGAAAGATGAGGG - Intergenic
920889256 1:209967236-209967258 TCGTGTGTCAGTAGGGATGCTGG + Intronic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
922099247 1:222468534-222468556 CTGGGTGTCAGGAGACATGATGG - Intergenic
922261285 1:223948028-223948050 CTGGGTGTCAGGAGACATGATGG - Intergenic
922735787 1:227977712-227977734 CTGGGTGTCAGGAGACATGATGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923737214 1:236621894-236621916 CTGTGTGCCAGGAAGGAGCATGG + Intergenic
924261693 1:242237991-242238013 TTATGTTACAGGAGGGATGAGGG - Intronic
924342446 1:243050208-243050230 CTGGGTGTCAGGAGACATGATGG - Intergenic
1063665406 10:8057834-8057856 CTGTGAGTGAGGAGGCCTGAAGG - Intronic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1064210895 10:13359793-13359815 TTGTCTGTCAGCAGGGATTAGGG + Intergenic
1066059566 10:31709775-31709797 CTGTCTGTAAGAAGGGATGAAGG - Intergenic
1066308669 10:34173366-34173388 CTGTTTGTCAGTGGGGATCAAGG + Intronic
1066734026 10:38455347-38455369 CTGGGTGTCAGGAGACATGATGG + Intergenic
1067517408 10:46963580-46963602 ATGTGTGTACAGAGGGATGAGGG + Intronic
1068963194 10:62886115-62886137 CAGTGAGTCAGGAGGGAAGCTGG + Intronic
1069990119 10:72310013-72310035 ATGTGTGTCGTGCGGGATGAAGG - Intergenic
1070756409 10:78996163-78996185 CTGTGTAGCAGGAGGGGGGAGGG - Intergenic
1071491664 10:86140532-86140554 CTGTGTGACAGGAGCCATCATGG + Intronic
1071708431 10:88025005-88025027 CTGTGTGTAAAGCAGGATGAAGG + Intergenic
1071915022 10:90284929-90284951 CTTTCTGTCAGGAAGGCTGAAGG - Intergenic
1072273606 10:93801266-93801288 CTGAGTGTCAGGATGGAAGATGG - Intergenic
1072414593 10:95236682-95236704 CTCAGTGTCTGGAGGGATGGGGG + Intergenic
1073134408 10:101212192-101212214 CTGTGTGACAGGAGGGGTACTGG - Intergenic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074288811 10:112122851-112122873 CTGTGTCTAAGGAGGTAGGAAGG + Intergenic
1074699930 10:116083890-116083912 CAGAGTGGCAGGAGGGATGGAGG - Intronic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1075426584 10:122346548-122346570 CTGTTTGTCAGCAGAGGTGAGGG + Intergenic
1075746266 10:124730077-124730099 CTGTGTGGCATGAGGAAGGAAGG - Intronic
1076969184 11:123742-123764 CTGGGTGTCAGGAGACATGATGG - Intergenic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1077025742 11:439158-439180 CTGTGGGACAGGAAGGATGGGGG - Intronic
1077743922 11:4879781-4879803 CTGTGTAAGAGGAGGGATGTAGG + Intronic
1078457742 11:11488553-11488575 CTATGTGGCAGGAAGGATGATGG - Intronic
1078908059 11:15705797-15705819 CTGTGTCTCAGGGAGGATCATGG - Intergenic
1079563949 11:21857921-21857943 CTGGCAGTCAGTAGGGATGATGG + Intergenic
1083805919 11:65073886-65073908 ATGGGTGTGAGGAGGGATGAAGG - Intronic
1085129081 11:74022244-74022266 CTGTGGGTCATGGGGGATAAAGG + Intronic
1086047502 11:82549988-82550010 CAATGGGTCAGAAGGGATGAAGG - Intergenic
1087015263 11:93548597-93548619 CTGTGGGTCAGGAGGGAGCTGGG + Intergenic
1087434143 11:98091206-98091228 CTGTGTGTGTAGGGGGATGAAGG + Intergenic
1087652119 11:100879942-100879964 CTGTGTGTTGAAAGGGATGAGGG - Intronic
1088249133 11:107847700-107847722 ATGTGTGTCAGGAGGGACAGAGG + Intronic
1088463932 11:110112938-110112960 CAGTGGGGCAGGAGAGATGACGG - Intronic
1089775921 11:120835714-120835736 CCGACTGTCAGGAGGGATGAGGG + Intronic
1091226441 11:133959060-133959082 CTGTCTGTCAGAATGGATGGCGG + Intergenic
1091799098 12:3313572-3313594 CAGGGTGTCAGGAGGGGTGAGGG + Intergenic
1091996424 12:4997597-4997619 CTCTGTGTCATGAGAGAGGAAGG - Intergenic
1092120236 12:6038522-6038544 CTGGGTGACAGGAGGCATGGTGG - Intronic
1092121458 12:6046926-6046948 CTGTGCTTCAGGAGGGGTTATGG - Intronic
1092791676 12:12076080-12076102 CTGTGCTGCAGGATGGATGAGGG + Intronic
1093709515 12:22314036-22314058 CTTTGTCTGAGGAGGGATAAAGG + Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094302623 12:28982610-28982632 ATGTGTGTCAGGAGGGGTAGTGG - Intergenic
1095042964 12:37464514-37464536 CTGAGTCACAGGAGGAATGATGG + Intergenic
1095169340 12:39015448-39015470 CTCTGTGCCAGGAGGCATTAGGG - Intergenic
1095827744 12:46547844-46547866 TTGTGTGTGAGGAGGGATTATGG + Intergenic
1095968139 12:47883091-47883113 CAGGGTGTCAGGAGGGAGGAAGG + Intronic
1097287197 12:57887463-57887485 AGGGGTGTCAGGAGGGATAAGGG + Intergenic
1097631098 12:62063152-62063174 CTGTGTGGCAGGCGGAATAACGG - Intronic
1098305650 12:69100000-69100022 CTTTCTGTGAGGATGGATGAGGG - Intergenic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1100432791 12:94545778-94545800 TGGTGTGTCAGGAGAGACGAGGG + Intergenic
1101156975 12:101936875-101936897 CTGTGTGCCATGGGTGATGAGGG - Intronic
1101581972 12:106049737-106049759 CTGTGTGCCAGGCTGGAGGATGG - Intergenic
1102073804 12:110044164-110044186 ATGTGTGTCTGTAGGGATGTGGG + Intronic
1103539975 12:121659245-121659267 CTGTTGGTCAGGAAGGCTGAGGG + Exonic
1104394758 12:128423030-128423052 TTGTGTGTCAGGACTGATAATGG + Intronic
1104702506 12:130917911-130917933 CTCTGAGGCAGGAGGGATGCGGG + Intergenic
1105428116 13:20313177-20313199 CTGAGTGGGATGAGGGATGAAGG + Intergenic
1106553222 13:30789010-30789032 CTGGGTGGCAGCAGGGATGAGGG + Intergenic
1108167800 13:47711006-47711028 CTGGGGGTTAGGAGGGATGGAGG - Intergenic
1108637305 13:52348357-52348379 CTGTGTTTCTGCAGGGATGAAGG - Intergenic
1109547140 13:63844251-63844273 CTATGAGCCAGGGGGGATGAGGG - Intergenic
1110142401 13:72146972-72146994 ATGTGTGGCAGGAGAGGTGATGG - Intergenic
1110160628 13:72373972-72373994 TTTTGTGTGTGGAGGGATGATGG + Intergenic
1110236094 13:73219633-73219655 TTGTGTGTGAGGTGGGGTGAGGG + Intergenic
1110301177 13:73929012-73929034 GTGTGAGTTATGAGGGATGAAGG - Intronic
1110407610 13:75168342-75168364 CTGTGTCTCAGGAGAAATAAGGG + Intergenic
1110457231 13:75703146-75703168 GTGTGTGTTGGGGGGGATGAGGG - Intronic
1110630380 13:77698898-77698920 CAGTGTTTTCGGAGGGATGACGG + Exonic
1110904011 13:80862717-80862739 GTGTGTGTCTGGAGGGCTAAAGG + Intergenic
1111128579 13:83944345-83944367 CTGTGTGTGTGGTGGGGTGATGG + Intergenic
1111588198 13:90309449-90309471 CTGTATGTCAGGAGTGTTGGGGG + Intergenic
1112620085 13:101046402-101046424 CTCCCTGTCAGGAGGCATGAGGG + Intergenic
1115925189 14:38425403-38425425 CTCTGCTTGAGGAGGGATGAAGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1118457776 14:65960317-65960339 CTGTGTGTCAGCCCTGATGATGG - Intronic
1118962276 14:70545300-70545322 CTCTGTGCCAGGTGGGATGGGGG - Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119746649 14:77049403-77049425 ATGTGTGTCTGCAGTGATGATGG + Intergenic
1122438298 14:101713362-101713384 CGGTGGGTCCGGAGAGATGACGG - Intergenic
1202889625 14_KI270722v1_random:143791-143813 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1202889638 14_KI270722v1_random:143911-143933 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1123899438 15:24861939-24861961 CTGTGTGGCAGGAAGACTGATGG + Intronic
1124631847 15:31342393-31342415 CTGGGTCTCAGGAGGGAAGGCGG - Intronic
1124784133 15:32663474-32663496 CTTTGTGGCAGGAGGCATCAGGG + Intronic
1125217169 15:37288674-37288696 CTCTGTGTCAGGTGCTATGAGGG - Intergenic
1126291973 15:47091290-47091312 CTGAGTCACAGGAGGAATGATGG - Intergenic
1127142974 15:55995341-55995363 ATGTGTATCATGAGAGATGAGGG - Intergenic
1127377917 15:58402057-58402079 TTGTGTGTCTGGTGGGGTGAGGG + Intronic
1127832769 15:62765392-62765414 CTGTGGGCCGGGAGGGATGCGGG - Intronic
1128542178 15:68543807-68543829 GTGTGCGTCAGGAGGGTGGAGGG - Intergenic
1128730234 15:70015811-70015833 CTGGGGGTCAGGAGGGCTGCGGG - Intergenic
1129373164 15:75110451-75110473 CTCTGTGTCAGGTGGGAAGCCGG - Intronic
1129682179 15:77664103-77664125 CTGTGTGGCAGAAGAGAGGAAGG - Intronic
1129980554 15:79865643-79865665 CTGAGGGTAAGCAGGGATGAGGG - Intronic
1131341404 15:91605136-91605158 CTGTCTGTGGGGAGTGATGAGGG + Intergenic
1131841554 15:96442653-96442675 CTGGGTGTTAGGCGGGAAGAAGG - Intergenic
1131993497 15:98112711-98112733 GTGTGTGTCAGGAGGGGGGCAGG - Intergenic
1132667125 16:1086636-1086658 TTGTGTGTGTGGAGGGGTGAGGG + Intergenic
1132836905 16:1958737-1958759 CTGTTTGTCTGTAGGGTTGATGG + Intergenic
1132977976 16:2719975-2719997 CTCAGGGGCAGGAGGGATGATGG + Intronic
1133801846 16:9091372-9091394 GTGAATGTCAGGAAGGATGAAGG - Intergenic
1134875395 16:17693705-17693727 CGGTGTGCCAGGAGGGAAGGGGG - Intergenic
1136492419 16:30618013-30618035 CTCTGTGTCAGGGGAGATTAGGG + Intronic
1137373756 16:47933023-47933045 CTGTGTGTGTTGAGGGGTGAGGG - Intergenic
1140145810 16:72307321-72307343 CTATGAGTCAGGAGGGAGGAAGG + Intergenic
1140232822 16:73131983-73132005 CTGTGATGCAAGAGGGATGAGGG + Intronic
1141114867 16:81299852-81299874 CTGTGTCCCAGGAGGACTGAAGG + Intergenic
1141472959 16:84252046-84252068 CTGTGTGGCAGAGTGGATGAAGG + Intergenic
1142451491 16:90175380-90175402 CTGGGTGTCAGGAGACATGATGG + Intergenic
1142621300 17:1167213-1167235 CTGGGTGTTAGGAGGGCAGAAGG - Intronic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1145758784 17:27412938-27412960 TTTTGTGTCAAGAGGGAAGAAGG - Intergenic
1146184720 17:30717366-30717388 CTGTGTGTGGGGAGGGTTGCTGG - Intergenic
1146418915 17:32664238-32664260 ATGTGTGGCAGGAGGGTTGTTGG + Intronic
1146490774 17:33280062-33280084 CTATGTGCCAGGAGTGAGGAGGG - Intronic
1146671827 17:34743133-34743155 CTGTGGGTTAGGAGGGGTGGAGG - Intergenic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1149439219 17:56661401-56661423 CTTGATGTCAGGAGGGATAAGGG - Intergenic
1150635626 17:66911346-66911368 CTCAGTGACAGGAGGGATGATGG - Intergenic
1151618273 17:75228975-75228997 CTGTAAGCCAGGAGGGAAGAAGG - Intronic
1152001665 17:77649764-77649786 CTGTGTGGTTGGAGGGATGGAGG + Intergenic
1152401477 17:80069071-80069093 ATGGGTGTCAGGAGGGAGGAGGG - Intronic
1153250643 18:3118262-3118284 CAGGGTGTCAGGAGGGTGGAGGG + Intronic
1153336029 18:3925639-3925661 CTGTGTGCCCGGAAGTATGAAGG - Intronic
1153676352 18:7459070-7459092 CTGGGTGTCAGGAGGCTTCAGGG - Intergenic
1154348086 18:13560460-13560482 CTCTGTGCCAGTGGGGATGACGG + Intronic
1155533319 18:26789995-26790017 CTTTGTGTGAGGAGGCATGAAGG + Intergenic
1156620707 18:38848168-38848190 CTGTCTGTCAAGAAGGATAATGG + Intergenic
1158959177 18:62574467-62574489 CTGTGTGGAAGGAAGGTTGATGG - Exonic
1160420479 18:78740495-78740517 CTGTGGGTCAGGTGGCGTGAGGG + Intergenic
1160645989 19:193668-193690 CTGGGTGTCAGGAGACATGATGG - Intergenic
1160820306 19:1054757-1054779 CTGTGTGTGAGGGGAGATGTAGG - Intronic
1161324264 19:3655908-3655930 CTGTGAGTCATGCGGGATGAGGG + Intronic
1161939034 19:7391119-7391141 ACCTGTGTCAGGAGGCATGAAGG + Intronic
1162308993 19:9893719-9893741 CTGTGTCTCAGGATTAATGAGGG + Intronic
1162553173 19:11369727-11369749 CTGTGTGTCAGGAGAGACCACGG - Intergenic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1162974063 19:14198327-14198349 CTGTGTGTGGGGAGGGTTGCTGG + Intronic
1165136103 19:33670485-33670507 GTGTGTGTCAGGACAGGTGATGG - Intronic
1165797401 19:38526932-38526954 TTGTGGGTCAGGAAGGAGGATGG + Intronic
1165860987 19:38909200-38909222 GGGTGTGTCAGGAGGAAGGAGGG + Exonic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1166646340 19:44534488-44534510 ATGTGTGCCATGGGGGATGAGGG + Intergenic
1167052315 19:47086733-47086755 CTGTGTGTCTGGGGTGCTGAGGG - Intronic
1167384063 19:49153830-49153852 CTGTGTGTCCTGGGGGGTGATGG + Exonic
1202665026 1_KI270708v1_random:110558-110580 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1202665039 1_KI270708v1_random:110678-110700 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
925018397 2:548991-549013 CTTTGTTTCAGCAGGGATGGTGG + Intergenic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG + Intronic
926706280 2:15840063-15840085 TAGTGTGTGAGGAGGGGTGAAGG - Intergenic
926833355 2:16989299-16989321 CTGTTTGTCATGAAGGATGTAGG + Intergenic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
927715235 2:25347598-25347620 CTGGAAGTCAGGAGGGAGGATGG - Intergenic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
927967197 2:27278102-27278124 CTGGGTGCCAGGAGGATTGAGGG + Intronic
928578457 2:32680564-32680586 CTGTGTGAAATGAGGGATGGGGG + Intronic
929079296 2:38106555-38106577 CTATGTCTCAGTAGAGATGAGGG - Intronic
932697372 2:73968234-73968256 CTGGGTGGCTGGAAGGATGATGG - Intergenic
932801896 2:74748250-74748272 GTGTGTGTCTAGAGGGATGGGGG - Intergenic
933792421 2:85893727-85893749 CTGTGAGGCAGGAGGGGTGAGGG + Intergenic
933994063 2:87655059-87655081 CTGTGTGACTGGTGGGATGAAGG + Intergenic
934658908 2:96132758-96132780 CTGTATGTCCGGAGGGATCTGGG - Intronic
935109763 2:100081672-100081694 CTGTGTGTCAGAAAGTGTGAAGG - Intronic
935271130 2:101435317-101435339 GTGTGTTTCGGGAGGGATGAGGG + Intronic
935486429 2:103661009-103661031 CTGTGTGTCAGCTGTGATGTTGG + Intergenic
935599820 2:104911623-104911645 CTCTGTGTCAGGGGGTATGTAGG - Intergenic
936299801 2:111295851-111295873 CTGTGTGACTGGTGGGATGAAGG - Intergenic
937024389 2:118685838-118685860 CTGTGTCTCCTGATGGATGATGG - Intergenic
938173674 2:129104791-129104813 CTGTGTGCCATGAGGGTTCAGGG + Intergenic
939097467 2:137851020-137851042 GTGTGTGTGAGGAGGCAGGACGG + Intergenic
941720031 2:168802701-168802723 CTGCGTGTGAGGAGGGTGGAGGG + Intronic
943148289 2:184074549-184074571 CTCTGTGCCAGGAGGTCTGAAGG + Intergenic
943745657 2:191460355-191460377 GTGTGTGTGTGGAGGGATGGTGG - Intergenic
944686616 2:202123220-202123242 CTGTGTGTCAGGCGAGAGGGCGG - Intronic
945048955 2:205805699-205805721 CTGGGTGCCAATAGGGATGAGGG - Intergenic
945523442 2:210858709-210858731 CTATGTGTGAAGAAGGATGACGG - Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946570026 2:221014270-221014292 CAGTGAGTCAGGAGTGCTGATGG - Intergenic
947454793 2:230244389-230244411 CAGTGAGTCAGCAGGGATGTGGG - Intronic
948176653 2:235948790-235948812 CTGTGTGGCAAGTGGGAGGATGG - Intronic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948571900 2:238922927-238922949 CTGAGTGCCAGCAGGGAGGATGG - Intergenic
948741434 2:240049027-240049049 CTCTGGGTCAGCAGGGAGGAGGG + Intergenic
948753987 2:240148740-240148762 CCGTATGTCAGGAGGACTGAGGG - Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168862185 20:1053570-1053592 CTGTCTGGCTGGAGGGAGGAGGG - Intergenic
1169234802 20:3922425-3922447 CTGTGTCTCAGGAGGGCTGAGGG + Intronic
1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG + Intronic
1169265832 20:4166954-4166976 CTGGGTGCCAGGCAGGATGATGG + Intronic
1169355077 20:4898933-4898955 TTGTGTGCCAGGCGGGTTGAGGG + Intronic
1169535722 20:6537880-6537902 CTGTGAGTGAGCAGGAATGAGGG + Intergenic
1170585113 20:17728520-17728542 CTGTGTGAGAGGAGGAATGGAGG - Intronic
1170764124 20:19275562-19275584 CTGTTTGTCAGGGGGCATGCAGG + Intronic
1171387494 20:24780087-24780109 CTGTGTGTCATGAGGCATCAGGG + Intergenic
1171537384 20:25907269-25907291 CTGAGTCACAGGAGGAATGATGG + Intergenic
1171840337 20:30202608-30202630 CTGAGTCACAGGAGGAATGATGG + Intergenic
1172169008 20:32917591-32917613 CTGGGAAGCAGGAGGGATGATGG + Intronic
1172864541 20:38085691-38085713 CTTTGGGTCTGGAGAGATGAAGG - Intronic
1172903126 20:38349382-38349404 CTGTGTGCCAGGTAGCATGAGGG - Intronic
1173844811 20:46181462-46181484 CTTTGTGGCTGGAGGAATGAGGG + Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1175632374 20:60552555-60552577 CTCTATGTCAGGAGGGGTCATGG + Intergenic
1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG + Intergenic
1176279517 20:64292548-64292570 CTGGGTGTCAGGAGACATGATGG + Intergenic
1177605486 21:23372033-23372055 CTGAGAGTCAGGAGAGCTGATGG - Intergenic
1179562237 21:42222954-42222976 CTGTGAGCCAGGTGGGGTGATGG - Intronic
1179960512 21:44764869-44764891 ATGTGTGCCAGGAGGGAAGGGGG - Intergenic
1180331752 22:11487478-11487500 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1180331765 22:11487598-11487620 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1181102331 22:20549791-20549813 CTGTGGGTCAGGAGTGGTGCTGG + Intronic
1182454499 22:30441243-30441265 CAGTGAGTCAGGAGTGCTGATGG + Intergenic
1182700155 22:32230227-32230249 CTGTGTGTCAGGGTGGAGGAAGG + Intronic
1183026361 22:35068407-35068429 CTGTGTGTCTGCAGGCAGGAAGG + Intronic
1183098276 22:35567701-35567723 CTGTGTGCCAGGTGGGACAAGGG + Intergenic
1183321366 22:37167060-37167082 CTGGGGGTTAGGTGGGATGAGGG - Intronic
1183672875 22:39283393-39283415 CTGGGCCTCAGGAGGGCTGATGG - Intergenic
1184516155 22:44964029-44964051 CTGTGTGTTGGGAGGGTTGCTGG + Intronic
1184602550 22:45552178-45552200 GTGTGTGCTAGGAGGGAGGAGGG + Intronic
1185047742 22:48537435-48537457 CTGTGTGCCAGGAGGCATGTGGG + Intronic
949747179 3:7308485-7308507 TTATGTGTCTGGAGGGATGGAGG + Intronic
951196108 3:19825540-19825562 CTGTGTCCCAGGTGGGAAGAGGG - Intergenic
952098546 3:29984828-29984850 CTGCCAGTCAGGAGGCATGAGGG + Intronic
952210597 3:31225796-31225818 CTGTGTGGCAGCAGGGAAGAGGG - Intergenic
953391350 3:42535699-42535721 CAGTGAGTGGGGAGGGATGAGGG + Intronic
954671093 3:52291771-52291793 CAGTGTGACAGGTGGGATGGGGG - Exonic
955059830 3:55485150-55485172 CTGGTGGTCGGGAGGGATGAAGG + Intronic
955389790 3:58513118-58513140 CTGGGGGTCAGTAGGGAGGAGGG - Intronic
956651986 3:71512771-71512793 CTGTGTGTGGGAAGAGATGACGG - Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957372167 3:79309174-79309196 ATGTGTGCCAGGAAGGATGAAGG + Intronic
958764961 3:98356754-98356776 TTCTGTCTCAGGAGGGAAGATGG + Intergenic
958833027 3:99112546-99112568 CTGTGTGTCAGGGGGTGAGAGGG + Intergenic
958885688 3:99724250-99724272 CTGTCTGTCAGGAGTCATCAGGG + Intronic
960421969 3:117457627-117457649 CAGTGTGTAAGGAGGAATGAAGG + Intergenic
960968138 3:123119753-123119775 CTGTGTTTCAGCAGCGAGGAGGG - Intronic
961817214 3:129557295-129557317 TTATGTGGCAGGAGGGATGAGGG - Intronic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
964268530 3:154929529-154929551 CTGTGAGCCAGGAGGCAAGAGGG + Intergenic
965742124 3:171886520-171886542 ATGTGTGGCAGAAGGGAAGAAGG - Intronic
967042408 3:185705753-185705775 CTGTGTCTCTGGATGGAGGAAGG + Intronic
968371692 3:198225858-198225880 CTGGGTGTCAGGAGACATGATGG + Intergenic
968594426 4:1474909-1474931 GTGTGTGTCAGGAGAGAAGGTGG + Intergenic
968763726 4:2457436-2457458 CTCTGTGGCAGGAAGGAGGAGGG + Intronic
969346994 4:6575960-6575982 CAGGGAGTCAGGAGGCATGAGGG - Intronic
969968595 4:11022692-11022714 TTTTGTGTGAGGATGGATGAGGG + Intergenic
971934932 4:33135721-33135743 CTGCTTCTCAGTAGGGATGAAGG - Intergenic
973815936 4:54619012-54619034 ATGTGTGGCAGGAGGAATGAAGG - Intergenic
977658207 4:99549209-99549231 CAGTCTGTCAGGATGGAGGAAGG - Exonic
978112201 4:104976865-104976887 GTGAGTATCAGGAGGGTTGAGGG - Intergenic
979260380 4:118638336-118638358 CGGGGTGTCAGGAGACATGATGG + Intergenic
982455123 4:155600487-155600509 CTGAGTAACAGGAGAGATGATGG + Intergenic
982655045 4:158137426-158137448 CTGTCTGTCTGAAGGGATGCTGG - Intronic
983976220 4:173937233-173937255 TTGTGTGTCAGGAGGTAAGAAGG - Intergenic
984183890 4:176518963-176518985 CTGTGTCTCAGAAGGCAGGATGG - Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
986517902 5:8582441-8582463 CTGTGTGTGAGGATGGTTGTTGG + Intergenic
987426211 5:17776451-17776473 CTGTGTGTCATCAGAGATGATGG + Intergenic
988627082 5:32888782-32888804 CTGTGTGTCTGGAAGGAGAAAGG + Intergenic
989209968 5:38848551-38848573 CTGAGTGGGAGGAGGGAGGATGG - Intronic
990149261 5:52798726-52798748 ATTTGTGTCAGGAGGGCAGAGGG + Intronic
990844154 5:60118538-60118560 CTGTTTTTCAGGATGGATGTAGG + Intronic
992485550 5:77191034-77191056 CTGTGTGCCAGCTGGGAAGAAGG - Intergenic
993164967 5:84341032-84341054 CTATGTTGGAGGAGGGATGAGGG - Intronic
993802049 5:92354059-92354081 CTGTAAGTCAGGAAGGAGGAAGG + Intergenic
995852693 5:116562720-116562742 CCGTGTGACTGGTGGGATGAAGG + Intronic
995857950 5:116613670-116613692 CTGGGTATCAGGAGAGCTGAGGG - Intergenic
997381159 5:133439553-133439575 CTCTGAAGCAGGAGGGATGAAGG - Intronic
998128754 5:139640661-139640683 CTGTGTGTGGGGAGGAATGAGGG + Intergenic
999148550 5:149411896-149411918 CTGTGTGCCCAGAGGGATAATGG - Intergenic
999269631 5:150289328-150289350 CAGTGTGTATGTAGGGATGAAGG - Intronic
999294049 5:150446929-150446951 CCGTGTGACTGGTGGGATGAAGG - Exonic
1000613702 5:163404629-163404651 GTGTGTGTAAGGAGGGAGGGGGG - Intergenic
1000926663 5:167202646-167202668 CTGTGTGACTGGGAGGATGATGG - Intergenic
1001930852 5:175672054-175672076 GTGTGTGTGTGGAGGGGTGAAGG - Intronic
1002730932 5:181331404-181331426 CTGGGTGTCAGGAGACATGATGG + Intergenic
1002753601 6:142700-142722 CTGGGTGTCAGGAGACATGATGG - Intergenic
1003025728 6:2553982-2554004 CCGTGTAGCAGTAGGGATGAGGG - Intergenic
1004164016 6:13239825-13239847 CTGTGTGTCAGGAGGAGAGGAGG + Intronic
1004962664 6:20808679-20808701 CTGGGTTTCAGGAGAGAAGATGG + Intronic
1004980906 6:21022599-21022621 TTGTGTGTGAGGAGGGAAGGGGG + Intronic
1005094880 6:22103936-22103958 GTGTCTCTCAGGAGAGATGAGGG + Intergenic
1006361905 6:33591409-33591431 CTGTATCTCAGGTGGGATGAAGG + Intergenic
1006380618 6:33695147-33695169 GGGTGGGTCAGGAAGGATGAAGG - Intronic
1006381005 6:33697151-33697173 CTCTGAGTCAGTGGGGATGAGGG + Exonic
1008029201 6:46674087-46674109 CTCAGGGTCAGGAGGGATGAGGG + Intronic
1008489014 6:52065891-52065913 CTGTATGGCATGAGGGATGCAGG - Intronic
1008715792 6:54288345-54288367 CTGAGTCTGAGCAGGGATGAGGG + Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1012330816 6:97984067-97984089 CTGTATTTCATGAGGGATGTTGG - Intergenic
1015156891 6:130106722-130106744 ATGTGAGTCAGGATGGAAGATGG - Intronic
1015458097 6:133452540-133452562 GTGTATGGCAGTAGGGATGAAGG + Intronic
1015494991 6:133871486-133871508 CTGTGTGCCAGATGGGTTGAGGG - Intergenic
1016045843 6:139479635-139479657 CAGAGTGTCAGGATGGAGGAGGG + Intergenic
1016277832 6:142375407-142375429 CTGTGTTTCAGGAGAAATGATGG + Intronic
1019148822 6:169990909-169990931 CCTGGTGTCAGGAGGGATGTGGG - Intergenic
1019256820 7:57580-57602 CTGGGTTTCAGAAGGGAGGATGG + Intergenic
1020509403 7:9034541-9034563 CTTTTTGTTAGGAGGGGTGAAGG + Intergenic
1021482758 7:21135996-21136018 CTGTGTGTAATGAGGCATAAAGG - Intergenic
1023071521 7:36439598-36439620 CTGTGTGTGGGGTGGGATAAAGG + Intronic
1023081243 7:36528503-36528525 CTATGTGCCAGGAGCTATGAAGG - Intronic
1023402097 7:39797936-39797958 CTGGGTGTCAGGAGACATAACGG + Intergenic
1024076075 7:45818566-45818588 CTGGGTGTCAGGGGACATGACGG + Intergenic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1024647526 7:51382723-51382745 CTGGGTGTCAGGAGACATGACGG - Intergenic
1025060130 7:55798474-55798496 CTGGGTGTCAGGAGACATGACGG - Intronic
1025128328 7:56362886-56362908 CTGGGTGTCAGGAGACATGACGG - Intergenic
1025170734 7:56754270-56754292 CTGCTTGTCAGAAGGGTTGAAGG + Intergenic
1025176711 7:56805767-56805789 CTGGGTGTCAGGAGACATGACGG - Intergenic
1025288861 7:57694098-57694120 CTGAGTCACAGGAGGAATGATGG + Intergenic
1025695083 7:63770619-63770641 CTGGGTGTCAGGAGACATGACGG + Intergenic
1025701149 7:63821429-63821451 CTGCTTGTCAGAAGGGTTGAAGG - Intergenic
1026170405 7:67949073-67949095 CTGCTTGTCAGAAGGGTTGAAGG - Intergenic
1026445440 7:70480683-70480705 CTGTGTGGCAGGAGACAGGAAGG + Intronic
1027419730 7:78007162-78007184 CTGTTTCTCAGCATGGATGATGG + Intergenic
1027420541 7:78013737-78013759 CTGTGTGACAGTAGGAATGCAGG - Intergenic
1027655800 7:80929766-80929788 CTGTGTGACAGGAGTGAAGTGGG - Intergenic
1032052610 7:128658329-128658351 CTGGGTGTCAGGAGACATGATGG + Intergenic
1032164055 7:129531897-129531919 GGGTGTGTCAGGAGCGGTGAAGG - Intergenic
1033671089 7:143493926-143493948 GTGTGTGGGAGGAGGGGTGAAGG - Intergenic
1034026526 7:147710349-147710371 CTGTGTTTCAGGAGTGGTGATGG - Intronic
1034294262 7:149957933-149957955 CTGTGTGACAGGAGGTATTTAGG + Intergenic
1034333368 7:150303255-150303277 CTGTGTTCCAGGAAGGAGGAGGG - Intronic
1034664675 7:152806632-152806654 CTGTGTTCCAGGAAGGAGGAGGG + Intronic
1036649463 8:10633125-10633147 ATCTGTGGCTGGAGGGATGAGGG + Intronic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1037630661 8:20652626-20652648 CTGTTTATCAGGTGGGCTGAAGG + Intergenic
1038560455 8:28573614-28573636 CTGTCTGTCAGGTAGAATGAGGG - Exonic
1039412768 8:37369349-37369371 CTGTGAGCCAGGAGGGCTTAGGG - Intergenic
1039567538 8:38562083-38562105 GTGTGTGTAAGGTGGGATGGGGG - Intergenic
1041739131 8:61139739-61139761 CTGTTTATCAGGAGGGCTGGGGG + Intronic
1042200253 8:66274560-66274582 CTGTGAGGCAGGTGGGATGTGGG - Intergenic
1042812845 8:72845392-72845414 CTCTCAGTCAGGAGGCATGAGGG + Intronic
1043088247 8:75865077-75865099 ATGAGGGTCAGGAGGGATGGAGG - Intergenic
1043212475 8:77540358-77540380 CGGTGTGGCAGGAGGGCTGGAGG + Intergenic
1044488527 8:92783381-92783403 CTGTGTGTAAGGAGAGCTGACGG + Intergenic
1047368873 8:124238357-124238379 CTGTATGTGAGGAGGGAAGGTGG - Intergenic
1048528892 8:135229494-135229516 CTGAGTGTCAGGAGGGATTACGG + Intergenic
1049586702 8:143435720-143435742 CTGTGTGCCTGGAGGGGTGCCGG - Intergenic
1049705611 8:144040700-144040722 CTGTGTGTCCGAAGTGTTGAAGG - Exonic
1049905625 9:214374-214396 TAGTGTCTCAGGAAGGATGATGG + Exonic
1050682939 9:8135054-8135076 CTGGTTTCCAGGAGGGATGAGGG + Intergenic
1051982039 9:23031865-23031887 TTGTGTGGCAGCTGGGATGATGG - Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053434408 9:38065976-38065998 CAGGGTTACAGGAGGGATGAAGG - Intronic
1057210165 9:93196779-93196801 CTGTTGGTCAGGAGGGGTGGCGG + Intronic
1057282136 9:93720635-93720657 GTCTCTGTCAGGAGGGAGGAGGG - Intergenic
1057307435 9:93920459-93920481 CTGGGGGTCAGGAGTGAAGAAGG + Intergenic
1058090672 9:100802214-100802236 GTGAGTATCTGGAGGGATGAAGG + Intergenic
1059571764 9:115445333-115445355 ATATCTGTCAGGAGGGAGGAAGG - Intergenic
1060110393 9:120902582-120902604 CTGTGTGGCAGGATGGGGGAGGG - Exonic
1060739199 9:126086855-126086877 CTGTGTGTCCGCAGGCATGGGGG - Intergenic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1061623513 9:131826722-131826744 TTGTGTGTAGGGAGGGATGGGGG - Intergenic
1062186628 9:135221900-135221922 CAGTGTGTCTGGAGGGAGCAAGG - Intergenic
1062196362 9:135276398-135276420 CTGTGTGGCAGGAGGTTGGAGGG - Intergenic
1062755338 9:138283911-138283933 CTGGGTGTCAGGAGACATGATGG + Intergenic
1203579251 Un_KI270745v1:28083-28105 CTGGGTGTCAGGAGACATGATGG + Intergenic
1203611678 Un_KI270749v1:12854-12876 CTGAGTCACAGGAGGAATGATGG - Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1187366513 X:18670040-18670062 CAGGCTGTCAGGAGGCATGAAGG - Intronic
1187391359 X:18888436-18888458 CTGTGTGTCAGGAGTGAAGAGGG - Intergenic
1189638008 X:43033093-43033115 CTGAGAATCAGGAGGGCTGATGG - Intergenic
1189911197 X:45812041-45812063 CTATGTTTCAGGAGGCAAGAAGG - Intergenic
1190118224 X:47639393-47639415 CAGGGTGTCAGGGGGGAGGAGGG + Intronic
1190655118 X:52604992-52605014 CTGTGTGTCAGGAATTAGGAAGG - Intergenic
1190912648 X:54786983-54787005 CGGGGTGTCAGGAGGGGTAAGGG + Intronic
1195703510 X:107722374-107722396 CTGAGTGACACAAGGGATGACGG + Intronic
1195726960 X:107927849-107927871 GTGCGTGACAGGAGGGAGGAAGG - Intergenic
1198804617 X:140481515-140481537 CTGTGTGTAAGAAGGGAGGGAGG + Intergenic
1198823969 X:140679642-140679664 CTGTATTTCAGGTGGGATGTTGG + Intergenic
1201438622 Y:13985557-13985579 AAGTGTGTCAGGAGGGAGGCAGG - Intergenic
1201445951 Y:14057151-14057173 AAGTGTGTCAGGAGGGAGGCAGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1201742373 Y:17337613-17337635 CTGGGGGTCAGCAGGGCTGAAGG + Intergenic
1202381859 Y:24280705-24280727 CTGGGTGTCAGGAGACATGATGG + Intergenic
1202488925 Y:25389420-25389442 CTGGGTGTCAGGAGACATGATGG - Intergenic