ID: 926202789

View in Genome Browser
Species Human (GRCh38)
Location 2:10813350-10813372
Sequence CTGGGGTTCTCCAGAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 319}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926202789_926202804 29 Left 926202789 2:10813350-10813372 CCTCCTTCTCTGGAGAACCCCAG 0: 1
1: 0
2: 4
3: 46
4: 319
Right 926202804 2:10813402-10813424 GGGTCTCCACTTTGTCCTGGGGG 0: 1
1: 0
2: 1
3: 17
4: 159
926202789_926202801 26 Left 926202789 2:10813350-10813372 CCTCCTTCTCTGGAGAACCCCAG 0: 1
1: 0
2: 4
3: 46
4: 319
Right 926202801 2:10813399-10813421 ACAGGGTCTCCACTTTGTCCTGG 0: 1
1: 0
2: 2
3: 24
4: 281
926202789_926202803 28 Left 926202789 2:10813350-10813372 CCTCCTTCTCTGGAGAACCCCAG 0: 1
1: 0
2: 4
3: 46
4: 319
Right 926202803 2:10813401-10813423 AGGGTCTCCACTTTGTCCTGGGG 0: 1
1: 0
2: 1
3: 20
4: 200
926202789_926202798 9 Left 926202789 2:10813350-10813372 CCTCCTTCTCTGGAGAACCCCAG 0: 1
1: 0
2: 4
3: 46
4: 319
Right 926202798 2:10813382-10813404 CGGTAGCCTCCTCGCTGACAGGG 0: 1
1: 0
2: 0
3: 2
4: 62
926202789_926202805 30 Left 926202789 2:10813350-10813372 CCTCCTTCTCTGGAGAACCCCAG 0: 1
1: 0
2: 4
3: 46
4: 319
Right 926202805 2:10813403-10813425 GGTCTCCACTTTGTCCTGGGGGG 0: 1
1: 0
2: 1
3: 19
4: 144
926202789_926202797 8 Left 926202789 2:10813350-10813372 CCTCCTTCTCTGGAGAACCCCAG 0: 1
1: 0
2: 4
3: 46
4: 319
Right 926202797 2:10813381-10813403 GCGGTAGCCTCCTCGCTGACAGG 0: 1
1: 0
2: 0
3: 1
4: 36
926202789_926202802 27 Left 926202789 2:10813350-10813372 CCTCCTTCTCTGGAGAACCCCAG 0: 1
1: 0
2: 4
3: 46
4: 319
Right 926202802 2:10813400-10813422 CAGGGTCTCCACTTTGTCCTGGG 0: 1
1: 0
2: 2
3: 24
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926202789 Original CRISPR CTGGGGTTCTCCAGAGAAGG AGG (reversed) Intronic
900152006 1:1182861-1182883 CTGGGTTTCTGCAGAGAGCGCGG - Exonic
900326641 1:2111455-2111477 CTGGGTGTCTCCAGAGAAGCTGG + Intronic
902606774 1:17573442-17573464 CTGGGGTTCTCTGGAGAAGAGGG + Intronic
904071030 1:27797446-27797468 CTGGGGATCTCCAGAGTTGGGGG - Intronic
904350067 1:29899263-29899285 CTGGGCTTCCCCAGAGTAGAGGG + Intergenic
904900914 1:33856366-33856388 CTGGGGTTCCCCAGAGAAAGAGG - Intronic
905233426 1:36529683-36529705 CTGGGGCTCTCCAGAGACAAGGG + Intergenic
905411964 1:37776783-37776805 ATGGGGTTCTCCAGTCAGGGGGG - Intergenic
905422668 1:37859313-37859335 CTGGGGGTCTCCAAGCAAGGAGG + Intronic
905475486 1:38224225-38224247 TTAGGGTTCTCCAGAGAAACAGG + Intergenic
905699983 1:40004985-40005007 GGGGTGTTCTCCAGAGAAAGAGG - Intergenic
906215169 1:44034313-44034335 CTGGGGGCCTGCTGAGAAGGTGG + Intergenic
906964583 1:50443932-50443954 ACGGGGGTCTCCAGAGATGGAGG - Intronic
908032542 1:60016665-60016687 CTGGGTTTCTCCATAGATGGGGG + Intronic
909459341 1:75892441-75892463 TTAGGGTTCTCCAGAGAAAGAGG - Intronic
910238745 1:85063350-85063372 AGGGGATTCTCCAGAGAGGGAGG + Intronic
910763686 1:90759652-90759674 CTGGGGCTCCACTGAGAAGGAGG + Intergenic
913674697 1:121129960-121129982 CTGGGGTCATCCAGGGCAGGAGG - Intergenic
914026538 1:143917590-143917612 CTGGGGTCATCCAGGGCAGGAGG - Intergenic
914664918 1:149825021-149825043 CTGGGGTCATCCAGGGCAGGAGG - Intergenic
914670847 1:149868799-149868821 CTGGGGTCATCCAGGGCAGGAGG + Intronic
914850096 1:151307896-151307918 CTGGAGTTCTCCAGATAGTGGGG - Intronic
914881010 1:151547218-151547240 CTGGGCTTTGCCAGAGAAGGAGG + Intronic
915544130 1:156586339-156586361 CTGGTGGGCTCCAGAGAAGGAGG - Intronic
916143907 1:161723363-161723385 ATGGGCTTCTCCAGAGTAGCTGG - Exonic
917125787 1:171686321-171686343 CAGCAGTTCTCCAGAGAAGGGGG + Intergenic
920053122 1:203175326-203175348 CTGGAGCTCTGCAGAGAGGGAGG - Exonic
920091473 1:203455999-203456021 TTGGGTTTTTCCAGAGAAGCTGG + Intergenic
920217915 1:204374624-204374646 CTGGGATGCTCAACAGAAGGAGG - Intronic
921220741 1:212972039-212972061 CTGAGCTTTTCCAGGGAAGGGGG - Intronic
921844263 1:219862254-219862276 TTTGGGTTCTCAAGAGAATGTGG - Intronic
922060234 1:222082295-222082317 GAGGAGTTCTCCAGAGTAGGAGG - Intergenic
923034122 1:230272285-230272307 GTGGCCTTCCCCAGAGAAGGTGG + Intronic
923269099 1:232338656-232338678 CTGAGATTCTCCAGAGGAGAGGG + Intergenic
924836434 1:247652497-247652519 TTGTGGTTCTCCAGAGAAGATGG - Intergenic
924943072 1:248825706-248825728 CTCGGGTTGGACAGAGAAGGTGG - Intronic
1062900602 10:1142418-1142440 CTGGGGATCTGCACAGAAGTTGG - Intergenic
1063362262 10:5468336-5468358 CTGGCTTCCTCCAGAGCAGGAGG - Intergenic
1063584083 10:7335122-7335144 CGGTGGTTGCCCAGAGAAGGGGG + Intronic
1066681120 10:37937689-37937711 CTGGGGCTTTTCAGAAAAGGGGG - Intergenic
1066802349 10:39206001-39206023 CTGGGTTTTTTCAGAAAAGGGGG + Intergenic
1067690276 10:48497327-48497349 GTGGGGTTCTCCAGGGCAGCTGG + Intronic
1068136233 10:52953240-52953262 TTGGGGCTTTTCAGAGAAGGGGG + Intergenic
1069606906 10:69744459-69744481 CTTGGATTCCCCAGGGAAGGAGG - Intergenic
1069722704 10:70559960-70559982 CTGGGGGTCTGCAGAGAACTTGG - Intronic
1070825962 10:79390834-79390856 GGGGGGTTCTCCAGAGACGGAGG + Intronic
1071371913 10:84960025-84960047 CTGGGTTGCAGCAGAGAAGGAGG - Intergenic
1072456203 10:95578577-95578599 CTTGAAGTCTCCAGAGAAGGGGG + Intergenic
1072924534 10:99604981-99605003 CTGAGGTTTCCCAGAGAAGAAGG + Intergenic
1073458108 10:103649930-103649952 ATGGTGTGCTCCAGGGAAGGTGG - Intronic
1074382951 10:112995141-112995163 CAGGGGTTCCCCTGAGGAGGAGG - Intronic
1075327252 10:121543824-121543846 CTGGATCTCTCCAGAGGAGGTGG + Intronic
1075970047 10:126644294-126644316 CTGGAGTTCTGCAGTGGAGGAGG - Intronic
1076190167 10:128477293-128477315 CTGGGATTTACTAGAGAAGGTGG + Intergenic
1076572819 10:131443782-131443804 CAGGGCTTCTCCAAAGAAGGAGG - Intergenic
1076657594 10:132035344-132035366 CTGAGGACCTGCAGAGAAGGCGG + Intergenic
1076768748 10:132651521-132651543 CAGGGCCTCTCCAGAGACGGGGG - Intronic
1076921759 10:133458004-133458026 CTGCGGTACCCCAGAGAGGGTGG + Intergenic
1077218976 11:1407040-1407062 CTAGGGTTTCCCAGGGAAGGGGG + Intronic
1077497685 11:2894322-2894344 CTGGGGTAACCCAGGGAAGGGGG - Intronic
1077549389 11:3193361-3193383 CTGGCGTTGTGCAGGGAAGGGGG - Intergenic
1079392409 11:20034025-20034047 CTGGCGTCCTCCTGAGAAAGTGG + Intronic
1079450761 11:20598221-20598243 CTCGGGCTCTCCAGAGGAGCAGG + Intergenic
1084319876 11:68367323-68367345 CTGGGGTTGCCCACAGCAGGTGG + Intronic
1085350771 11:75796759-75796781 CTGGGGGTCCCCAGAAAAGGGGG - Intronic
1085441760 11:76570638-76570660 TCGGGGTTCTCCAGAGAAACCGG - Intergenic
1085528069 11:77175525-77175547 CTGGGGTGCTCGGGAGAGGGAGG + Intronic
1086850642 11:91803278-91803300 TTGTGTTTCTCCAGAGAAAGTGG + Intergenic
1088178020 11:107076163-107076185 AGGGGATTCTCCAGAGAATGTGG - Intergenic
1088676593 11:112199718-112199740 TCGGGTTCCTCCAGAGAAGGTGG + Exonic
1089507683 11:118974996-118975018 CTGGAGTTCTGGAGAGAAGTGGG + Intronic
1089860624 11:121587177-121587199 TTGGGGTTCTCCAGAGGAATAGG + Intronic
1091045073 11:132318121-132318143 ATGAGGTTCTCCAAAGGAGGAGG + Intronic
1091750474 12:3018839-3018861 CTGGGGTCCCCCAGGGGAGGAGG + Intronic
1091995916 12:4993993-4994015 CTGGGGTCCCCTAGAGAAGCTGG - Intergenic
1095576472 12:43745785-43745807 ATGGTGTCCTCCAGAGAAGAGGG - Intronic
1095963691 12:47852079-47852101 CTGGGGTTCCTTAGTGAAGGGGG + Intronic
1096177844 12:49534862-49534884 CTGGGGACCTCCAGAGAGGAAGG + Intergenic
1097405605 12:59185607-59185629 CTGGGTTTCTCCAGACAACCAGG + Intergenic
1097785578 12:63755265-63755287 CTGGGGTTGTCCAGAGCATGGGG + Intergenic
1098488752 12:71050850-71050872 CTGGGCATCTCCAGAAATGGGGG - Intronic
1099708628 12:86190888-86190910 CCGAGGTTTTCCAGAGAAGAAGG + Intronic
1102358091 12:112257369-112257391 CTGGGTTTCTCTAGAGCAGCAGG - Intronic
1102591450 12:113959531-113959553 TCGGGGTCCTCCAGAGAATGGGG - Intronic
1102792110 12:115655793-115655815 CGGGGCTTTTCCAGAGGAGGAGG + Intergenic
1104179018 12:126360186-126360208 CTGGGGTTCACCTGAGAACATGG + Intergenic
1104473906 12:129054501-129054523 CTTGGGTTCTCTAGGGACGGGGG - Intergenic
1106022427 13:25928171-25928193 CTGGGGCTTTCCAGAGCAGATGG + Intronic
1106911340 13:34466423-34466445 CAGGTATTCTCTAGAGAAGGTGG - Intergenic
1108389695 13:49936189-49936211 CTGCGGTGCTGCAGAGACGGGGG - Exonic
1109311575 13:60700598-60700620 CTGAGGTTTTCCAAAGAAGAAGG - Intergenic
1111318595 13:86593979-86594001 TTGAGGTTTCCCAGAGAAGGGGG + Intergenic
1111396085 13:87671895-87671917 CTCGGCTGCTCCAGCGAAGGCGG - Intergenic
1111856341 13:93642147-93642169 CTGGGGATTACTAGAGAAGGAGG - Intronic
1113031752 13:106000875-106000897 GCAGGGTTCTCCAGAGAAAGAGG + Intergenic
1113650155 13:112028704-112028726 CTGGTGCTCTCCCGAGAACGGGG + Intergenic
1113841197 13:113362821-113362843 CTGGGGGCTTCCTGAGAAGGGGG - Intronic
1114521028 14:23336147-23336169 CAGGGGTTCTCTGGAGAAAGGGG - Intergenic
1115442625 14:33453762-33453784 CTGTGGGTCTCCAGGTAAGGAGG - Intronic
1115640442 14:35332392-35332414 CTGGGGTTTTCCAGGGATAGAGG + Intergenic
1117560570 14:56933773-56933795 CTGAGGTCCTCCAAAGAAGGGGG - Intergenic
1119302553 14:73583009-73583031 GTGGGGTCCTTCAGAGAAGCTGG - Intergenic
1119647921 14:76361814-76361836 TTGGGGAACTCCAGGGAAGGTGG + Intronic
1120331993 14:83104891-83104913 TCAGAGTTCTCCAGAGAAGGAGG - Intergenic
1121523501 14:94602387-94602409 CTGGCCTTCCACAGAGAAGGTGG + Intronic
1122324971 14:100876350-100876372 CTGGGGGTGGACAGAGAAGGTGG + Intergenic
1122494220 14:102140304-102140326 CTGGGGTACTCCTGAGGAGAGGG + Intronic
1123217443 14:106824243-106824265 CTGGTTTTCACCAAAGAAGGAGG + Intergenic
1123786999 15:23684285-23684307 AGGGGGTTCTGCAGAGAAAGGGG - Intergenic
1124106250 15:26740561-26740583 CTTGGGTGCTCCAGAGGAGGAGG - Intronic
1127471663 15:59295756-59295778 TTGGGGTCCTCCAAAGCAGGAGG - Intronic
1129515049 15:76152208-76152230 CTGGGGTTACCAAGAGGAGGGGG + Intronic
1129701307 15:77770023-77770045 CTGGGGTCCACCTGAGATGGGGG + Intronic
1130233934 15:82117146-82117168 CAGGGGTTCTCCAAAGATGCTGG - Intergenic
1130377322 15:83340825-83340847 TTAGGGTTCTCCAGAGAAATGGG - Intergenic
1131122340 15:89830369-89830391 ATGGGGCTCTCGAGAGAGGGAGG - Intergenic
1131143965 15:90000169-90000191 CTCGGGTTCTCCGGAGGAGTGGG - Intergenic
1131513176 15:93060816-93060838 CTGGAGCTGTCCAGAGCAGGAGG - Intronic
1131622839 15:94085335-94085357 CTGGAGTCATCCATAGAAGGAGG + Intergenic
1132313949 15:100877645-100877667 CTGGGCTTGTCCAGACAAGCAGG - Intergenic
1132838485 16:1966706-1966728 CTGTGATCCTTCAGAGAAGGGGG + Intergenic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133025786 16:2988426-2988448 CTGGGGTTCTGGAGACAAGGAGG + Intergenic
1133223622 16:4329545-4329567 CAGAGGATCTCCAGTGAAGGGGG + Intronic
1134045271 16:11096391-11096413 CTGTGGTTATCCAGGGAAGTGGG - Intronic
1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG + Exonic
1134829885 16:17314327-17314349 TTGGGGTGCTGCAGAGAGGGAGG + Intronic
1134977228 16:18580307-18580329 CTGGGGGTCTTCAGGGAAGAAGG - Intergenic
1136279669 16:29200926-29200948 CTGCAGTTTTCCAGAGAAGAGGG - Intergenic
1137533396 16:49298802-49298824 CTGGGGTAGGGCAGAGAAGGGGG - Intergenic
1137550339 16:49433239-49433261 ATGAGTTCCTCCAGAGAAGGTGG - Intergenic
1137586036 16:49664498-49664520 CTGAGATTCTACAGAGATGGAGG + Intronic
1137625625 16:49906283-49906305 CTTGGATTCTCCAGGAAAGGTGG - Intergenic
1138882559 16:61033207-61033229 CTGGGGTAATCCAGGGCAGGAGG - Intergenic
1139309217 16:66014258-66014280 ATGCTGTTCTGCAGAGAAGGTGG - Intergenic
1139921214 16:70461648-70461670 TGGGGGTTCCCCGGAGAAGGGGG - Intronic
1140023547 16:71262421-71262443 CAGGGGTCCTCCTGAGAGGGAGG + Intergenic
1140282080 16:73564248-73564270 CTGGGGTTATGCAGAGAGCGAGG - Intergenic
1140657438 16:77155304-77155326 CTGGGGCTCTTCAGGGAAGCTGG + Intergenic
1140733082 16:77873970-77873992 CTCTGGTTCTGCAGAGAAGCAGG - Intronic
1141886616 16:86896596-86896618 CTAGGGTTCTGCAGAGGTGGAGG + Intergenic
1142084059 16:88167023-88167045 CTGCAGTTTTCCAGAGAAGAGGG - Intergenic
1203093257 16_KI270728v1_random:1229910-1229932 CTGGGCTTCCCCCGAGCAGGTGG + Intergenic
1142602254 17:1059383-1059405 TTAGGGTTCTCAAGAGAAGGAGG - Intronic
1142809338 17:2387846-2387868 CTGGGGCTCACCAGAGGCGGTGG + Exonic
1146506822 17:33413067-33413089 GCAGGGTTCTCCAGAGATGGGGG + Intronic
1146957766 17:36946728-36946750 ATGGCCTTCTCCAGAGAAGGCGG - Intergenic
1148645548 17:49217970-49217992 CTGGGGTTCTGGAGGGAAAGGGG - Intronic
1148742028 17:49898363-49898385 CTGGGGTCCTACAGGGAGGGAGG + Intergenic
1149524196 17:57341151-57341173 CTGGGGTGGGCCAGGGAAGGAGG + Intronic
1149954118 17:61026614-61026636 CAGGGGTGCTCCAGAAAAGGGGG + Intronic
1150135471 17:62692803-62692825 CTCGGGCTCTGCAAAGAAGGGGG - Exonic
1151495348 17:74455018-74455040 CTGAGGTTCCCAAGAGAAGCTGG + Intergenic
1153377697 18:4399706-4399728 CTGGCTTTCTCCAGAGAGGCAGG + Intronic
1153555725 18:6311233-6311255 TTAGGGTTCTCCAGAGAAACAGG - Intronic
1154194159 18:12253926-12253948 CTGGGGGACTCCAGAGCTGGAGG + Intergenic
1157518036 18:48324823-48324845 CTGGGCTGGTCCAGGGAAGGGGG + Intronic
1157776955 18:50403318-50403340 CTGGGGCTTTTCAGAAAAGGAGG - Intergenic
1161081932 19:2315586-2315608 CTGTTGTTTTCCAGAGAAGGGGG + Intronic
1161564380 19:4992036-4992058 TTTGAGTTCTCCAGAGATGGAGG + Intronic
1161810313 19:6467667-6467689 CTGGGGTCCTCCAGAGAACTGGG + Exonic
1161992207 19:7690378-7690400 CTGGGGCTCTGCAGAGGTGGTGG - Intronic
1162192278 19:8956371-8956393 CTGGTTTTCTCTATAGAAGGAGG + Exonic
1162525108 19:11202295-11202317 TTGGGGTTTCCCAGAGAAAGAGG + Intronic
1163408341 19:17137491-17137513 CTGGTCCTCTACAGAGAAGGGGG - Intronic
1163481732 19:17560506-17560528 CTGGGTATCCCCAGGGAAGGCGG + Intronic
1164063522 19:21695050-21695072 CTGGGGCTTTTCAGAGTAGGGGG + Intergenic
1164822231 19:31258958-31258980 CTGGGGTTGGATAGAGAAGGCGG - Intergenic
1165253369 19:34557990-34558012 CTGGGGTTTTTCAAAGAAGGGGG + Intergenic
1165272793 19:34724892-34724914 CTGGGGTTTTTCAGAGAAGGGGG - Intergenic
1166304477 19:41929683-41929705 CTGCCTTTCCCCAGAGAAGGTGG - Intronic
1167207708 19:48113689-48113711 CTCGGGTCTTCCAGAGCAGGAGG - Intergenic
1168056573 19:53868067-53868089 TTGGGGTTCTGCAGAGGAGAGGG + Intronic
1168294092 19:55370324-55370346 CAGGGGTTCCCCAGGGCAGGGGG + Exonic
925142611 2:1560258-1560280 CTGGGGCTCAGCAGTGAAGGGGG + Intergenic
926202789 2:10813350-10813372 CTGGGGTTCTCCAGAGAAGGAGG - Intronic
926901155 2:17753543-17753565 CTGGGGGTCGCCAGCCAAGGGGG + Intronic
928098180 2:28418407-28418429 CTTGGTGTCTCCAGAGAATGAGG - Intergenic
928335237 2:30392254-30392276 CTGGTGTTCTAGAGAGAAGGAGG + Intergenic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929395609 2:41518766-41518788 ATGTGGTTCTCCTGGGAAGGAGG + Intergenic
930172804 2:48268528-48268550 CTGGGGTTCAAGAGAGAAAGTGG - Intergenic
931827322 2:66015162-66015184 CTGGGGGTCACTAGAGATGGGGG + Intergenic
934574433 2:95391261-95391283 CTGGTGAGCTCCAGAGAAGCCGG - Intergenic
934774514 2:96928641-96928663 CTGGGTTTCACCAGAGAGTGGGG + Intronic
935253868 2:101290854-101290876 CAGGGGTTAGCCAGAGAAGTAGG - Intronic
936375864 2:111941241-111941263 CTGGGTTGCTCTAGAGAAGCAGG + Intronic
939752755 2:146067838-146067860 CTGTGGTCCTTGAGAGAAGGAGG + Intergenic
940176168 2:150879771-150879793 CTGGGTTGCACCAGAGAAAGAGG - Intergenic
942549371 2:177098796-177098818 CTGAGATGCACCAGAGAAGGAGG - Intergenic
946537685 2:220648896-220648918 CTGGGGTTTACCAGAGGATGGGG - Intergenic
947079583 2:226381188-226381210 CTGGGGTTCTCCAGAGAGGAAGG - Intergenic
947367306 2:229409993-229410015 CTAGGGACCTCCAGAGGAGGAGG - Intronic
948800888 2:240433063-240433085 CTGGGGTCCTCCACAGAAGATGG + Intergenic
1169023994 20:2351895-2351917 CTGTGATTCTCCAGAAAAGGGGG - Intergenic
1169774531 20:9238098-9238120 CTGGAGTTTTCCAGAGCAGCTGG + Intronic
1172162842 20:32880223-32880245 CTGGGGTTTAATAGAGAAGGCGG + Intronic
1173827271 20:46055952-46055974 CTGGGGTTCTGGAGAGGAGGTGG + Intronic
1173846657 20:46192842-46192864 TGGGGGTGCTCCAGGGAAGGGGG + Intronic
1174041780 20:47705316-47705338 CTGGCGTTCTGCAGAGGAGGAGG + Intronic
1174503371 20:51001546-51001568 CTGGGGTTGTGCAGGGAAGCCGG - Intergenic
1176695152 21:9968412-9968434 CTGGGGCCCTCCTGAGATGGAGG - Intergenic
1177149516 21:17440897-17440919 CTGGGGTGCTGGAGAGAAGTAGG - Intronic
1177972282 21:27805418-27805440 CCAGGGTTCTCCAGAGAAACAGG + Intergenic
1178025995 21:28467766-28467788 TTAGGGTTCTCCAGAGAAACAGG - Intergenic
1178682436 21:34684231-34684253 CTGAAGTTCTCCAGAAAAGCAGG - Intronic
1179380502 21:40894797-40894819 CTGAGCTACTCCACAGAAGGTGG - Intergenic
1179481001 21:41678657-41678679 CTGGACTTCTCCAGGGCAGGCGG + Intergenic
1179623929 21:42637552-42637574 CTGTGGTACTTCTGAGAAGGAGG - Intergenic
1179799353 21:43803671-43803693 GAGGGGCTCGCCAGAGAAGGAGG + Exonic
1180767466 22:18353774-18353796 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1180778840 22:18508608-18508630 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1180811562 22:18765929-18765951 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1181197715 22:21200177-21200199 CTGAGGTTTCCCAGAGAAGCAGG - Intergenic
1181395860 22:22621109-22621131 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1181559401 22:23691405-23691427 CTGGGGTTCTCCAAAGGTTGGGG + Exonic
1181647518 22:24241459-24241481 CTGAGGTTTCCCAGAGAAGCAGG - Intronic
1181703986 22:24636724-24636746 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
1181730554 22:24843313-24843335 ATGTGTTTCTGCAGAGAAGGTGG + Intronic
1181805545 22:25372542-25372564 CTGGGGTTGCCCATAGCAGGTGG - Intronic
1182985683 22:34714061-34714083 ATGGAGTGCTCCAGAGAATGGGG + Intergenic
1183498637 22:38164918-38164940 CTGGGGTTCTCCAGGGCCGGGGG - Intronic
1184449656 22:44575461-44575483 CTGGGGGTCTCGTGAGATGGAGG - Intergenic
1185088337 22:48752661-48752683 CTGGGTTTCTCCTGGGAGGGAGG + Intronic
1185153647 22:49180361-49180383 CTGGGGTTGACCCGAGTAGGGGG + Intergenic
1185166972 22:49267223-49267245 CTGGGGCACTCCCTAGAAGGGGG + Intergenic
1185250482 22:49799255-49799277 CTGGGGCTCTCTAGTGAGGGTGG - Intronic
1203229088 22_KI270731v1_random:94658-94680 CTGAGGTTTCCCAGAGAAGCAGG + Intergenic
949208246 3:1466597-1466619 CTGGGGTTTTCCAGAGTAAGTGG + Intergenic
949517756 3:4822397-4822419 CAGGGATTTTCCAGAGGAGGAGG - Intronic
950034684 3:9877006-9877028 CTGGGATTCAGCAGAGATGGAGG - Intronic
950121611 3:10485616-10485638 CAGATTTTCTCCAGAGAAGGGGG + Intronic
950327204 3:12121953-12121975 CTGAGGTTTTGCAGAGAAGAAGG - Intronic
952516608 3:34110972-34110994 CTGGGGAACTTCAGAAAAGGAGG + Intergenic
954317168 3:49807434-49807456 CAGGGGTACTCCAAGGAAGGAGG + Intronic
954422783 3:50427338-50427360 CTGGGGGTCCCCAGGGATGGGGG - Intronic
954973890 3:54675087-54675109 CTGGGCTTTTTCAGAGGAGGAGG + Intronic
955407845 3:58636533-58636555 CTGGGGGTGTCCAGAGAACGTGG + Intronic
959063367 3:101635155-101635177 CTGGGGCTCTTCAGAGAAGGGGG - Intergenic
959696537 3:109254550-109254572 CTGGTGTTCTGCAGGTAAGGAGG - Intergenic
960801629 3:121545923-121545945 CCAGGGTTCTCCCGAGAGGGAGG - Exonic
961432140 3:126890869-126890891 CTGGGGTTCCCCAGGGAGTGGGG + Intronic
961457972 3:127033574-127033596 CTGGGGCTCACCAGGGAAAGGGG + Intronic
961638859 3:128352216-128352238 CTGAAGTTCTCCAGAGATGTAGG + Intronic
966946256 3:184779111-184779133 CTGGGGTTCCCCGCAGAAGCGGG + Intergenic
968579406 4:1383002-1383024 GTGGGGTTCCCCACACAAGGCGG - Intronic
969430412 4:7150639-7150661 CTGGGTTTCTCCCGGGATGGGGG + Intergenic
969683666 4:8657112-8657134 CTGCGGTTTTCTACAGAAGGAGG + Intergenic
969686307 4:8676285-8676307 CTGTTGTTCCACAGAGAAGGAGG - Intergenic
970968321 4:21952320-21952342 CTAGGGTTAGTCAGAGAAGGTGG - Intergenic
971115344 4:23639991-23640013 CTGGGGTTCTCTGGAGAGGGTGG - Intergenic
971431896 4:26577060-26577082 CTGAGGTTTTCTAGAGAAGAAGG + Intronic
971872196 4:32256923-32256945 CTGGAGTTCTTCAGAGAAAGAGG - Intergenic
972127103 4:35782282-35782304 TTAGGGTTCTCCAGAGGAAGAGG + Intergenic
974003564 4:56534166-56534188 AAGTGGTTCTCTAGAGAAGGGGG - Intronic
974328479 4:60445647-60445669 TTAGGTTTCTCCAGAGAAAGAGG + Intergenic
976500535 4:85783652-85783674 CTGGGGATTTTCAGAGAATGGGG - Intronic
978831275 4:113088206-113088228 CTGGGGTTTTACAGAGGAGCAGG + Intronic
979064217 4:116107441-116107463 CTGGGGTTATCTAGAAAAGCTGG - Intergenic
980516313 4:133867098-133867120 CTGGGGTAGTGAAGAGAAGGTGG - Intergenic
985802052 5:2010935-2010957 TTAGGGTTCTCTAGAGAAGAGGG - Intergenic
986020097 5:3793806-3793828 CTGGGGTTCCCCAGAGTGGAAGG - Intergenic
988314040 5:29601108-29601130 ATGGGATTCTCTAGAGAATGTGG - Intergenic
990186265 5:53213085-53213107 ATGGGATTCTCTAGAGAATGTGG + Intergenic
990531771 5:56681410-56681432 TTGGCCTTCTGCAGAGAAGGTGG - Intergenic
990598792 5:57336742-57336764 CTGGGTTTGTCCAGTGAAGAAGG + Intergenic
991486759 5:67145257-67145279 ATGGGGGTCTCCAGGGCAGGAGG - Exonic
992613074 5:78524157-78524179 CCCGGGTTTTCCTGAGAAGGAGG - Intronic
996956942 5:129194551-129194573 CTGGGGTTCTCTGGAGTAGCTGG + Intergenic
998227544 5:140338665-140338687 CCTGGCTTCCCCAGAGAAGGAGG + Intronic
1000639490 5:163684854-163684876 CCAGGGTTCTCCAGAGAAACAGG + Intergenic
1000813124 5:165887380-165887402 CTAGGGTTTCCCAGAGAAGGAGG + Intergenic
1001441820 5:171749484-171749506 GTGGGGATGACCAGAGAAGGAGG + Intergenic
1001874542 5:175188122-175188144 GTGTTGTTCTCAAGAGAAGGAGG + Intergenic
1002454608 5:179338966-179338988 ATGGGGTCATCCAGGGAAGGGGG + Intronic
1003241725 6:4351028-4351050 CAGGAGCTGTCCAGAGAAGGAGG + Intergenic
1003923751 6:10857486-10857508 CTGAGGTTCCTCAGAGAAGAAGG + Intronic
1003923959 6:10859537-10859559 CTGAGGTTTCCCAGAGAAGGAGG + Intronic
1004044683 6:12012416-12012438 TTGGGGTTGTCAAGTGAAGGAGG + Exonic
1004477338 6:15986123-15986145 CTGGGGATCGCCTGAGAAGCAGG + Intergenic
1004666059 6:17749606-17749628 CTGGAGATCACCAGATAAGGGGG + Intergenic
1005117506 6:22355043-22355065 TTGGAGTTCTCCAGAGAAACAGG - Intergenic
1006423226 6:33948471-33948493 CTGGGGCTTTTCTGAGAAGGGGG + Intergenic
1007401227 6:41603684-41603706 CTCGGAGCCTCCAGAGAAGGAGG - Intergenic
1007916586 6:45567023-45567045 CTGGGACTCTCCAGAGAAAGAGG + Intronic
1008132607 6:47736035-47736057 ATGGTGGTTTCCAGAGAAGGGGG + Intergenic
1010259041 6:73794445-73794467 ATGGGGTCCTGTAGAGAAGGAGG + Intronic
1010734609 6:79429549-79429571 TTAGGGTTCTCCAGAGAAACAGG + Intergenic
1014655563 6:124099632-124099654 CTGTGGTTCTCAGGAGGAGGTGG + Intronic
1014799587 6:125763290-125763312 CAGGGGTTCTCAAAAGAAGGAGG + Intergenic
1016504923 6:144768350-144768372 CTGGGGCTCTTCAGAGTAAGGGG + Intronic
1017516322 6:155159257-155159279 CAGGTATTCTACAGAGAAGGAGG - Intronic
1018395912 6:163377921-163377943 CTGCGCTGCTCCAGGGAAGGAGG - Intergenic
1018775633 6:167012766-167012788 GTGAGTTTTTCCAGAGAAGGGGG + Intronic
1018810174 6:167293329-167293351 CTGGGGCCCTGCAGAGAGGGAGG - Intronic
1019187036 6:170226777-170226799 CTGGGCATATCCAGAGCAGGGGG - Intergenic
1019611735 7:1940181-1940203 CTGTGCTTCTCCTGGGAAGGAGG + Intronic
1021265517 7:18516506-18516528 CTGGGGTTCTCATGTGAAGGAGG - Intronic
1022261607 7:28710935-28710957 ATGTGGTTGCCCAGAGAAGGTGG + Intronic
1022359281 7:29643298-29643320 CTGGGGCTTTTCAGAGAAGGGGG + Intergenic
1022802859 7:33792487-33792509 CTGGGCTCCACCAGAGCAGGAGG - Intergenic
1023123485 7:36932922-36932944 CTGGGGTGCTGCAGAGACAGTGG + Intronic
1023213482 7:37833263-37833285 TTGGGGTTCTGCTGAGAAAGGGG + Intronic
1024105067 7:46075205-46075227 CTGGTGTCCTCCAGAGAAAAGGG + Intergenic
1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG + Intronic
1024468708 7:49742912-49742934 CTTTTGTTCTGCAGAGAAGGTGG - Intergenic
1024732148 7:52264578-52264600 CTAGGGTTATCCAGAAAAGGTGG + Intergenic
1027229719 7:76265116-76265138 CTGGGGTTGTCTAGAGAAAAGGG + Intronic
1028981140 7:96969234-96969256 CTGTGGTTTTCCAGACAATGGGG + Intergenic
1029114954 7:98232026-98232048 CTGGGGGTGCCCAGAGGAGGAGG + Intronic
1029314126 7:99695919-99695941 CTGGAATGCTCAAGAGAAGGAGG + Intronic
1029625389 7:101717634-101717656 CTGGGGTTCCCAAGAGAACAGGG - Intergenic
1031069926 7:117150727-117150749 CTGGAGTTCAACAGAGAAGAGGG - Intronic
1031293195 7:119965734-119965756 TTAGGGTTCTCCAGAGAAACAGG - Intergenic
1031899369 7:127392618-127392640 CTCGGGCTCTCCGGAGGAGGGGG - Exonic
1032721091 7:134551384-134551406 CTGGGGCTTTTCAGAAAAGGGGG - Intronic
1034828629 7:154289703-154289725 CTGAAGTTGTGCAGAGAAGGTGG - Intronic
1037481799 8:19312901-19312923 CTGGGGTTCACCAAAGCAGGCGG + Intergenic
1037539951 8:19861635-19861657 GAGCGGTTCTCCAGAGAAGCTGG + Intergenic
1037934492 8:22906097-22906119 CTGGGGCTCTCCAGAGATGCAGG + Intronic
1038328828 8:26591777-26591799 CTGGGATTCTCCAGAGGCAGAGG - Intronic
1039654064 8:39378861-39378883 CTGGCCCTCTCTAGAGAAGGAGG - Intergenic
1039890361 8:41681768-41681790 CTTGTGTTCTGGAGAGAAGGTGG - Intronic
1040295617 8:46147588-46147610 CTGGGGTTTTCCAGACAATCCGG + Intergenic
1041362158 8:57065812-57065834 CTGGGGTACACAAAAGAAGGAGG - Intergenic
1041766863 8:61427886-61427908 GTAGGGCTCTCCGGAGAAGGAGG - Intronic
1042930028 8:74004109-74004131 CTGGGGATCCCCAGAGAAATTGG + Intronic
1043089130 8:75875695-75875717 CTGGGTTTCACCAGTGGAGGTGG + Intergenic
1043132921 8:76484029-76484051 CTGGGGTCTGCCAGAGAAGACGG - Intergenic
1043714643 8:83466906-83466928 CTTGGGTTCTCCAAAGAAAATGG - Intergenic
1046977540 8:120298737-120298759 CTGGGATTCTCCAGAGCATGGGG + Intronic
1047096555 8:121632533-121632555 CTTGTGTTCTCCAGAGAATTAGG + Intronic
1047787557 8:128168491-128168513 CTGTGGTTCTCCAGGGCTGGAGG + Intergenic
1049001263 8:139826813-139826835 CTGGGTTTCTGCAGAGAGGTTGG + Intronic
1049707560 8:144049934-144049956 CGGGGGTTCGGCCGAGAAGGCGG + Intergenic
1050070085 9:1801269-1801291 TTAGGGTTCTCCAGAGAAAGAGG - Intergenic
1050629988 9:7549018-7549040 TTAGGGTTCTCCAGAGAAACAGG + Intergenic
1051150167 9:14071515-14071537 GTGGGGGTCACCAGAGAAGCTGG + Intergenic
1051580642 9:18670081-18670103 CTGAGGTTGTCTAGAGAAGATGG + Intronic
1052009204 9:23385952-23385974 CTGGGGGACTACAGGGAAGGTGG + Intergenic
1053079513 9:35162575-35162597 CTGGGGTTCTCTAGTGAGAGTGG + Intronic
1053199557 9:36143256-36143278 CTGGGGCTCTGAAGAGGAGGGGG - Intronic
1053632129 9:39954358-39954380 CTGGGGCCCTCCTGAGATGGAGG - Intergenic
1053773637 9:41509177-41509199 CTGGGGCCCTCCTGAGACGGAGG + Intergenic
1054211759 9:62296340-62296362 CTGGGGCCCTCCTGAGATGGAGG + Intergenic
1054313224 9:63552489-63552511 CTGGGGCCCTCCTGAGATGGAGG - Intergenic
1054857967 9:69921705-69921727 AGGGGATTCTCCAGAGAATGTGG - Intergenic
1056463104 9:86827022-86827044 GTGGCGTGCTCCAAAGAAGGTGG - Intergenic
1056534239 9:87514078-87514100 CTGTGGTTCTCTACAGAGGGTGG - Intronic
1056552471 9:87663511-87663533 CTGGGGATATCCAGTGAAAGAGG - Intronic
1057171702 9:92966753-92966775 CTGGGGGTGTCCAGGGGAGGCGG - Intronic
1057220955 9:93257460-93257482 CTGGGGTCCTTCAGGGAGGGCGG + Intronic
1057248693 9:93481652-93481674 CTGGGGTGTCCCAGACAAGGAGG - Intronic
1057901311 9:98950962-98950984 CAGGATTTCTCCAGAGAAGATGG - Intronic
1060447166 9:123700586-123700608 CTGAGGTTTTCCAGAGAAGAAGG - Intronic
1060531123 9:124347531-124347553 CTGGGGTTCAACAGAGGAGCAGG - Intronic
1060888033 9:127169293-127169315 CTGGGGCTCTACGGGGAAGGAGG - Intronic
1061645516 9:131997741-131997763 CTGGGGGCCTCCAGACAAGGTGG + Intronic
1061962865 9:133997346-133997368 CTGGGGCTGCCCAGAGAATGAGG - Intergenic
1062343296 9:136103385-136103407 CTGGGGGTCTCGAGGGACGGAGG - Intergenic
1186806041 X:13140797-13140819 CTGGGATTTCACAGAGAAGGTGG - Intergenic
1186914687 X:14206864-14206886 CTGGGGCTTGCCAGAGAAGTGGG - Intergenic
1188508794 X:30911644-30911666 CTGGGTGGCTCCAGAGAAAGTGG + Intronic
1190275020 X:48893793-48893815 CTGGGGTCCTCCAGGAATGGGGG + Exonic
1191677850 X:63810520-63810542 AGGGGGTTTTCCAGTGAAGGTGG - Intergenic
1192242941 X:69349186-69349208 TAGTGGTTATCCAGAGAAGGTGG - Intergenic
1195877828 X:109560825-109560847 TTAGGGTTCTCCAGAGAAACAGG - Intergenic
1199030469 X:142992979-142993001 CTGAAGTTCTCCTGAGAAGTGGG + Intergenic
1201231283 Y:11867208-11867230 TTGGGGTTTGCCAGAGAAGCAGG - Intergenic
1201283241 Y:12358854-12358876 CTGGGGCTTTTCAGAAAAGGGGG + Intergenic