ID: 926203314

View in Genome Browser
Species Human (GRCh38)
Location 2:10816876-10816898
Sequence CACATGCCCAGTGTGGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926203314_926203318 -7 Left 926203314 2:10816876-10816898 CCAAGACCCACACTGGGCATGTG 0: 1
1: 0
2: 1
3: 18
4: 264
Right 926203318 2:10816892-10816914 GCATGTGCTTGGCACACTATAGG 0: 1
1: 0
2: 3
3: 21
4: 185
926203314_926203319 2 Left 926203314 2:10816876-10816898 CCAAGACCCACACTGGGCATGTG 0: 1
1: 0
2: 1
3: 18
4: 264
Right 926203319 2:10816901-10816923 TGGCACACTATAGGCTTTCAAGG 0: 1
1: 0
2: 0
3: 10
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926203314 Original CRISPR CACATGCCCAGTGTGGGTCT TGG (reversed) Intronic
900299826 1:1971535-1971557 CACATCCCAAGCGTGGGGCTGGG + Intronic
900607265 1:3529397-3529419 CCCCTGCCCCGTGTGGGGCTTGG - Intronic
900709688 1:4105739-4105761 TCCATGGCGAGTGTGGGTCTTGG - Intergenic
901187706 1:7385853-7385875 CAAATGGCCAGTGAGGGCCTCGG - Intronic
902621377 1:17652846-17652868 CACAGACCCCCTGTGGGTCTGGG - Intronic
903096325 1:20978730-20978752 CAGATGCCCACTGGGGGTCTTGG + Intronic
903740842 1:25557496-25557518 CATGTCCCCAGTGTGTGTCTGGG + Intronic
904294262 1:29507518-29507540 CTCATCTCCACTGTGGGTCTTGG + Intergenic
904330138 1:29753516-29753538 CAGATGCCCAGGATGAGTCTGGG + Intergenic
905231693 1:36518487-36518509 CAGAAGCCCAGTGTGGGTGGGGG + Intergenic
905672217 1:39799282-39799304 CACCTGCCTCGTGTGGGCCTGGG + Intergenic
905674739 1:39817525-39817547 CACCTGCCTCGTGTGGGCCTGGG - Intergenic
906746669 1:48226633-48226655 CCCATGAACAGTGTGGGGCTTGG + Intronic
906954190 1:50358893-50358915 CCCCTGCCCCGTGTGGCTCTCGG - Intergenic
908892084 1:68859815-68859837 CACATGCCCACTGGGGCTTTGGG - Intergenic
910321903 1:85955490-85955512 CACATGCCCACTGGGGCTTTGGG + Intronic
910985952 1:93004761-93004783 CACATGCCCACTGGGGGAGTGGG - Intergenic
912511105 1:110190657-110190679 GACAAGCCCTGTGTGGGTCCTGG - Intronic
912559902 1:110543275-110543297 TACATCCCCAGGGTGTGTCTTGG + Intergenic
912734578 1:112139112-112139134 CTCATGTCCAGTGTGGGTTGAGG + Intergenic
912867118 1:113267389-113267411 CTCAGCCCCAGTGGGGGTCTGGG - Intergenic
913106428 1:115617824-115617846 CATCTGCTTAGTGTGGGTCTGGG - Intergenic
913445554 1:118947016-118947038 CACATCCCCAGTGAGGGGATTGG - Intronic
915567141 1:156721503-156721525 CACATACCCTGTGTGTGTCAGGG + Intergenic
916510144 1:165466180-165466202 CACCTGCCCAAAGTGGGTTTCGG - Intergenic
916925973 1:169521262-169521284 CACAACCCCAGTGAGGGTGTAGG - Intronic
919542168 1:198861934-198861956 CACATGCCCAATTTAGGTCAAGG - Intergenic
921163116 1:212486799-212486821 CACATGCACAATCTGGGTCCTGG + Intergenic
923462009 1:234215848-234215870 CACCTACCAACTGTGGGTCTAGG - Intronic
1062959325 10:1560789-1560811 CAGCTGCCCAGTCTGGGGCTCGG - Intronic
1063660301 10:8031144-8031166 CACACGCCCAGTGTTTGTCTTGG - Intergenic
1063789779 10:9429673-9429695 CACATGTCAAGTGTGGGGCCAGG - Intergenic
1066055612 10:31677806-31677828 CACATGCCCAGGGTGCCTATGGG + Intergenic
1066671242 10:37842507-37842529 CGCATTCCAAGTGTGGGTCCTGG + Intronic
1066717717 10:38304929-38304951 CACACACCCACTGGGGGTCTTGG - Intergenic
1067247461 10:44558551-44558573 CACATGCCCAGGGGGAGTCCAGG - Intergenic
1069371273 10:67750317-67750339 AAGATGCCCATTGTGGGCCTGGG + Intergenic
1069698178 10:70402894-70402916 AACATGCCCAAGGTGGGACTGGG - Intergenic
1070606447 10:77901736-77901758 CTCAGGCCCACTGTGGGTCCTGG - Intronic
1070677826 10:78424671-78424693 CACATGACCAGTGTTAGTCCTGG - Intergenic
1071195460 10:83153838-83153860 CACATGCCCACTGCGGCTTTGGG + Intergenic
1071454526 10:85835365-85835387 CACATGCCAAGGGTGGGGCCAGG + Intronic
1072805229 10:98419689-98419711 CACATGCCAAGTGTGGCACATGG - Intronic
1074208912 10:111310303-111310325 CACATTCCAAGGGTGGGTGTAGG - Intergenic
1074964155 10:118473983-118474005 CAAATGCCCCGTGTGAGTCGGGG - Intergenic
1075644042 10:124085988-124086010 CACAGGCCCTGTGGGGGGCTGGG + Intronic
1076337522 10:129718416-129718438 CACTTGCCCAGGGTGGGGGTGGG - Intronic
1076519611 10:131073480-131073502 CACGTGCTCAGTGGGGCTCTAGG - Intergenic
1077316875 11:1923311-1923333 CTCATGCCCACTGTGGGACGTGG + Intronic
1077676024 11:4193566-4193588 CACATCCCCAGTCTGAATCTGGG + Intergenic
1077980947 11:7300432-7300454 CCAATCCCCAGTGTTGGTCTTGG - Intronic
1078333944 11:10449900-10449922 GAGATGCCCAGAGTGGGCCTTGG + Intronic
1078462929 11:11528980-11529002 CTCAGGGCTAGTGTGGGTCTTGG + Intronic
1078894599 11:15586847-15586869 CTCTTCCCCAGTGTGGGCCTTGG + Intergenic
1079559762 11:21807281-21807303 CACATGTCAAGGGTGGGACTAGG - Intergenic
1081122494 11:39284711-39284733 CACATGTCAAGGGTGGGTCCAGG - Intergenic
1081393671 11:42559863-42559885 CACATGTCAAGTGTGGGACTAGG + Intergenic
1081667384 11:44924524-44924546 CACAAACCCAGTGTGTGTGTTGG + Intronic
1082068139 11:47917337-47917359 CACCTCCCCAGTTTGGGCCTTGG + Intergenic
1083356636 11:62071191-62071213 CACATATCCACTGAGGGTCTTGG - Intergenic
1085303458 11:75472182-75472204 CTCAGGCCCAGAGAGGGTCTGGG + Intronic
1087083423 11:94193847-94193869 CATTTGCCCAGTGAGGGGCTTGG + Intergenic
1090117383 11:123987902-123987924 CACACACCCAGAGTGAGTCTTGG + Intergenic
1090629263 11:128632389-128632411 CCCAGGCCCAGGGTGGGTTTGGG - Intergenic
1091594177 12:1864733-1864755 CATATTCCCAGTGTGGGGCCAGG - Intronic
1091831987 12:3556532-3556554 CACAGGCTCAATGTGGGGCTGGG + Intronic
1091911980 12:4240233-4240255 CACATGCCACCTGTGAGTCTGGG - Intergenic
1092523329 12:9294613-9294635 CACATAGCCAGTGAGGGTCATGG - Intergenic
1092543965 12:9437286-9437308 CACATAGCCAGTGAGGGTCATGG + Intergenic
1093612398 12:21178122-21178144 CACATGCCAAGAGTGGGGCCAGG + Intronic
1094508982 12:31084764-31084786 CACATAGCCAGTGAGGGTCACGG - Intronic
1096493641 12:52026751-52026773 CATATTCCCAGTGTGGCTTTAGG - Intronic
1096786041 12:54017944-54017966 CACATGCGCAGTGTGGGCCCAGG + Intronic
1097291976 12:57924814-57924836 CACATGTCAAGTGAGGGACTTGG - Intergenic
1098545578 12:71707640-71707662 CACATGCCCTCTGGGGCTCTGGG - Intergenic
1098697836 12:73581649-73581671 CACACGCCCACTGTGGCTTTGGG + Intergenic
1099225948 12:79969213-79969235 CACATGTCAAGGGTGGGTCCAGG + Intergenic
1103053587 12:117801583-117801605 CACATGGCCAGAGTGGGGTTGGG + Intronic
1103950944 12:124550711-124550733 CACATGCCCAGCCTGGCCCTGGG + Intronic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1104164669 12:126216298-126216320 GAAATGCCCAGTGAGGCTCTGGG - Intergenic
1105245981 13:18650646-18650668 CACATGCCCTCTGGGGCTCTGGG - Intergenic
1106111853 13:26784731-26784753 CACATGCCCACTGTCTGTCCCGG + Intergenic
1110161687 13:72385956-72385978 CACATGTCCAGAGTGGGACCTGG - Intergenic
1111198014 13:84898620-84898642 CACATGCCCACTGGGGGTTCAGG - Intergenic
1119383880 14:74245378-74245400 CACATGCCCACAGTGGGGCTGGG - Intronic
1120857096 14:89222224-89222246 CCTATGCCCACTGTGGGGCTGGG + Intronic
1121277063 14:92675766-92675788 TACCTCCCCAGTGTGGCTCTTGG - Intronic
1122771534 14:104099965-104099987 CAGAAGCCCAGTGTGGGTGAGGG - Intronic
1124639250 15:31385499-31385521 CACATGCTCACTTTGTGTCTTGG + Intronic
1126687239 15:51259048-51259070 CACATGCTCATTCTGGGACTGGG - Intronic
1126999163 15:54481851-54481873 CAGATGACCTGTGTGGGTATAGG + Intronic
1127443548 15:59036600-59036622 CACATGCCAAGGGTGGGGCCAGG - Intronic
1130015425 15:80182398-80182420 TGCATGCCCAGTGTGGCTGTTGG + Intronic
1130735553 15:86544705-86544727 CACATGTCAAGGGTGGGTCCAGG - Intronic
1131529673 15:93180639-93180661 CACAGGCCCAGTGTCATTCTGGG - Intergenic
1132104123 15:99050597-99050619 CCCATGCCCTGTGTGGCTCTGGG + Intergenic
1132905038 16:2278164-2278186 CCCATGCTCAGTGTGGCTCACGG + Intronic
1134473216 16:14547183-14547205 TACATGGCCAGTGTGGGACTTGG - Intronic
1134839304 16:17388846-17388868 CTCACGCTCAGTGTGGGTCAAGG + Intronic
1136279916 16:29202305-29202327 CACCTGCCCGCTGTGGGCCTGGG + Intergenic
1136279947 16:29202475-29202497 CACCTGCCCGCTGTGGGCCTGGG + Intergenic
1137571544 16:49569384-49569406 CAGATGCCCAGTTAGGGTCAGGG + Intronic
1139284488 16:65798297-65798319 CACACGCCCAGTGGGGCTTTGGG + Intergenic
1139417069 16:66821156-66821178 TACATGCCCAATGTGGGTTAGGG + Intronic
1140577375 16:76186819-76186841 CACATGTCCATGGTGGGTGTGGG - Intergenic
1140855504 16:78974726-78974748 CAGAGACCAAGTGTGGGTCTTGG - Intronic
1142084309 16:88168413-88168435 CACCTGCCCGCTGTGGGCCTGGG + Intergenic
1142276988 16:89124072-89124094 CACATGCCTAGTGTGCGCATGGG + Intronic
1142276991 16:89124102-89124124 CACATGCCTAGTGTGCGCATGGG + Intronic
1143118880 17:4595370-4595392 CCCAAGCCCCGTCTGGGTCTGGG - Intronic
1143891841 17:10107980-10108002 CACAGTCCCAGTGGGGGACTGGG + Intronic
1144331151 17:14225130-14225152 CACATGGCCAGGGAGGCTCTGGG + Intergenic
1144468325 17:15515098-15515120 GCCATGCCCACTGTGGGTATGGG - Intronic
1146374848 17:32287170-32287192 CACATGCCCAGTGCTGTGCTGGG - Intronic
1147862751 17:43533204-43533226 CCCATGGCCAGGGTGGGGCTGGG + Exonic
1148744037 17:49908536-49908558 CAGGTGCCCAGTGTGGGCTTTGG + Intergenic
1149981391 17:61314119-61314141 CACTTCCCCAGTGTGTGCCTCGG - Intronic
1151217724 17:72589277-72589299 CACATTCCCACTGTAGGTTTGGG + Intergenic
1152491434 17:80637250-80637272 CCCATGCCCAGCGTGGCTCTGGG + Intronic
1152692002 17:81722526-81722548 CACAGGCCCAGGGTGGGGGTAGG + Intergenic
1154391332 18:13938923-13938945 CTGCTGCCCAGTGTGGCTCTGGG - Intergenic
1155245893 18:23908696-23908718 CACACACCCAGTAGGGGTCTTGG - Intronic
1155394939 18:25377160-25377182 CACATGCCCACTTGGGCTCTGGG + Intergenic
1156458013 18:37305579-37305601 CACCACCCCACTGTGGGTCTGGG - Intronic
1159284851 18:66336303-66336325 CCCCAGCCCAGGGTGGGTCTGGG + Intergenic
1159831944 18:73287887-73287909 CACCTGCACAGTGTTGCTCTGGG + Intergenic
1160474502 18:79170218-79170240 CCCAGGCCCAGTGTGGCTCTGGG - Intronic
1160758978 19:773065-773087 CACCTGCCCCGTGCGGGACTGGG - Intergenic
1161393885 19:4034676-4034698 CACAGGCCCGGAGTGGGGCTTGG + Intronic
1161558529 19:4957842-4957864 CAGGTGGGCAGTGTGGGTCTGGG + Intronic
1161621580 19:5300313-5300335 CACATTTCCAGTGTGGCTCATGG + Intronic
1162121998 19:8476438-8476460 CTCATGCTGAGTGTGGGTCCTGG - Intronic
1163131469 19:15276071-15276093 CACAGGCCCAGAGTGGGTGCAGG - Intronic
1164750865 19:30653847-30653869 CACATGCCCTGTGTGTGCCAGGG - Intronic
1164764832 19:30756449-30756471 GACACGCCCAGGGTGGGGCTGGG - Intergenic
1165333322 19:35153642-35153664 CAAAAGCCCAGGTTGGGTCTGGG + Intronic
1168490128 19:56802206-56802228 CTCATGCCCAGTGTCAGCCTGGG - Intronic
926203314 2:10816876-10816898 CACATGCCCAGTGTGGGTCTTGG - Intronic
926268597 2:11347225-11347247 CACATGGCAAGTGTGTGTTTGGG - Intronic
926735237 2:16068745-16068767 CATATGCCCAGTGGGGGCCCAGG - Intergenic
927509780 2:23637151-23637173 CCCAGGCCCAGTGTGGGACTTGG + Intronic
928086591 2:28350006-28350028 CTCAGGCCCAGTATGGGTGTTGG - Intergenic
928441480 2:31295787-31295809 CACATGCCCACTTGGGCTCTAGG + Intergenic
928872203 2:35993094-35993116 CCCAAGCCCAGTGTGAGTCATGG + Intergenic
930301704 2:49623877-49623899 CACATGCTCCTTGTGTGTCTTGG - Intergenic
930831100 2:55744113-55744135 CACATGCCAAGAGTGGGACCAGG - Intergenic
932059148 2:68477917-68477939 CACATGTCAAGGGTGGGACTAGG - Intronic
932590597 2:73064409-73064431 AACCTGCCCAGTGTGACTCTTGG + Intronic
932767986 2:74483147-74483169 GACAAGACCAGTGGGGGTCTAGG + Intronic
934323612 2:91986581-91986603 AGCATGCCCAGTGTGGGGCCTGG - Intergenic
936930881 2:117787669-117787691 CCCAGCCCCAGTGTAGGTCTGGG + Intergenic
938291896 2:130154979-130155001 CACACGCCCAGAGTGGGCCCCGG - Intronic
939101276 2:137897521-137897543 CACATGCCCTCTGGGGCTCTGGG - Intergenic
942789887 2:179748883-179748905 CACTTCCCCAGTGCAGGTCTAGG - Intronic
946210434 2:218143308-218143330 CACATGCCCACTGGGGTTTTGGG - Intergenic
946287080 2:218711796-218711818 CACATTCCCATTCTGGATCTCGG + Intronic
948241895 2:236444904-236444926 CATATGGCCAGTGTGGATATTGG + Intronic
948392436 2:237622230-237622252 CACATGCCATGTGTGCCTCTGGG - Intergenic
1168788798 20:562229-562251 CATGTGCCCAGTGAGGCTCTGGG + Intergenic
1169639985 20:7741120-7741142 CACACTCCCAGTGTGAGTCAAGG - Intergenic
1170289372 20:14751198-14751220 CACAGGCCAAGGGTGGGGCTGGG - Intronic
1170791975 20:19516042-19516064 CACATGCCAAGAAAGGGTCTGGG - Intronic
1172023940 20:31935388-31935410 CAGAAGCCCAGTGAGGGTCAGGG + Intronic
1172519422 20:35557380-35557402 CACTGGCCCAGTGGGGGCCTTGG - Intronic
1172761855 20:37328672-37328694 CCCTTCCCCAGTCTGGGTCTGGG + Intergenic
1173111208 20:40192309-40192331 CACATTCCCAGTGTCAGCCTGGG - Intergenic
1174391495 20:50220852-50220874 CACAGGGCCAGTGTGGGGCCAGG + Intergenic
1174709211 20:52687052-52687074 CCCATGCCCTCTGAGGGTCTGGG + Intergenic
1175160017 20:57001460-57001482 CACTTGCGAAGTGAGGGTCTCGG - Intergenic
1175482736 20:59322781-59322803 CAGAGGCGAAGTGTGGGTCTGGG - Intronic
1176111132 20:63411324-63411346 CACCTGCCCACTGTGGGGGTGGG - Intronic
1176453146 21:6882186-6882208 CACATGCCCTCTGGGGCTCTGGG - Intergenic
1176667154 21:9698188-9698210 CACATGCCCAGAGGGAGTGTTGG - Intergenic
1176831319 21:13747234-13747256 CACATGCCCTCTGGGGCTCTGGG - Intergenic
1177803079 21:25847510-25847532 CACATGTCCAGGGAGGGACTTGG + Intergenic
1180049962 21:45326572-45326594 CACATGCCCAGGGTGGGACTCGG + Intergenic
1180089997 21:45529100-45529122 CAAGAGCCCAGTGTGGGCCTCGG + Intronic
1181145269 22:20841402-20841424 CAAATGCCCAGAGGGGCTCTGGG + Intronic
1182436286 22:30332649-30332671 CACAGGCCCAGTGTGCTGCTTGG - Exonic
1184157430 22:42677256-42677278 CACATGTCAAGGGTGGGACTAGG + Intergenic
1184591192 22:45484496-45484518 CTCATGCCCACTGAGGGACTTGG - Intergenic
1184782499 22:46656196-46656218 CACTTGCCCAGTGTGGGTGCTGG - Intronic
1185382766 22:50517798-50517820 CAGACGCCCAGTGTGAGTCCTGG + Exonic
949880879 3:8659659-8659681 CCCATGCCCATTGAGGGTTTGGG - Intronic
950448000 3:13049121-13049143 ACCATGCCCAGTGTGGGTTCTGG - Intronic
951748796 3:26010537-26010559 CACATGTCAAGGGTGGGACTTGG + Intergenic
952972919 3:38665803-38665825 CACATGTCAAGGGTGGGTCTAGG + Intergenic
953210922 3:40874482-40874504 AACATGCCCAGTCTGGCTCCTGG + Intergenic
955622403 3:60878264-60878286 CACAAGCCTATTGTGGCTCTTGG - Intronic
955955176 3:64281362-64281384 CACATGTCCAAGGTGGGACTTGG - Intronic
959907805 3:111729962-111729984 CAAATGCCCAGTGAGGATCAAGG - Intronic
963947122 3:151158411-151158433 CACACCCCCAGTGTGTGTCAGGG - Intronic
964313704 3:155421078-155421100 CACAGTTCCAGGGTGGGTCTAGG - Intronic
966447890 3:180024001-180024023 CACATACCAAGTGTGTGCCTGGG + Intronic
966742238 3:183244438-183244460 CAGATGCCTATTGTGGGACTTGG + Intronic
967886615 3:194337776-194337798 ATCATGCCAAGTGTGGGTCAGGG + Intergenic
969575541 4:8034217-8034239 CACATGCCCAGGCTGTGTGTTGG - Intronic
969903533 4:10371982-10372004 CACATGCGCACTGGGGGACTGGG - Intergenic
970574219 4:17411821-17411843 CACATGCCCACTGGGGCTTTGGG - Intergenic
974293590 4:59965744-59965766 CACATGTCAAGTGTGGGACCAGG - Intergenic
976049008 4:80988600-80988622 CACAAGATCTGTGTGGGTCTAGG - Intergenic
979550748 4:121988427-121988449 TACATGCCCAATGTAGGTGTAGG - Intergenic
979632297 4:122917326-122917348 CAGGTGCCCACTGGGGGTCTTGG + Intronic
980994702 4:139769261-139769283 CTCATGCCCAGAGAGGCTCTGGG + Intronic
982959482 4:161818494-161818516 CACATGCCCAGTGGGGCTTTGGG + Intronic
984671161 4:182489500-182489522 CACATGCCCACTATGTGACTTGG - Intronic
985168401 4:187122560-187122582 CCCATGCCCATTGTGTGTATCGG + Intergenic
985575986 5:673706-673728 CACCTCCCCAGTGTGGGGCCGGG - Intronic
985793563 5:1945823-1945845 CACAGCCCCAGTGGGGGGCTGGG + Intergenic
986140492 5:5025618-5025640 TCCATGCCCTGTGTGGCTCTCGG - Intergenic
988111675 5:26830677-26830699 CACATGCCGAGGGAGGGACTTGG + Intergenic
988913342 5:35868526-35868548 GCCATGACCAGTGTGGGTCCTGG + Intronic
990143500 5:52731942-52731964 CACATGTCAAGGGTGGGACTAGG + Intergenic
990620205 5:57550657-57550679 CCCCTGCCCTGTGTGGCTCTCGG + Intergenic
990792313 5:59495880-59495902 CACATGCCCACTGGGGCTTTGGG - Intronic
991658524 5:68927382-68927404 CACATGCCCTCTGGGGCTCTGGG - Intergenic
994533716 5:101000211-101000233 TTCTGGCCCAGTGTGGGTCTAGG - Intergenic
996259918 5:121454358-121454380 CTCAGCCCCAGTGTGGGTCTCGG + Intergenic
999314585 5:150575545-150575567 CACATCCCCAGCCTGGGCCTAGG - Intergenic
999563446 5:152830545-152830567 CTCCTGCCCAGTGTGTGTCATGG - Intergenic
1001266499 5:170278303-170278325 CACATGCAGAGTGGGGGGCTGGG + Intronic
1001410362 5:171507118-171507140 CACATGCCCAGTGCCTGTCATGG + Intergenic
1004222354 6:13757705-13757727 CACAGACCCACTGAGGGTCTTGG + Intergenic
1005390523 6:25328349-25328371 TACATGCTCAGTGTAGGGCTTGG + Intronic
1005883361 6:30076058-30076080 CACATGCCAAGAGTGAGCCTGGG - Intergenic
1007203816 6:40132933-40132955 CACTTGGCCAGTCTGTGTCTGGG - Intergenic
1007505417 6:42331805-42331827 CACATGGCCCGCGTGGGCCTGGG - Intronic
1009981243 6:70728256-70728278 CACAGGCCCAGTGTGGTTAATGG + Intronic
1010732223 6:79403402-79403424 CAGATGCCCAGGGTGGCTCTGGG + Intergenic
1011121707 6:83961393-83961415 CACATGTCGAGGGAGGGTCTTGG + Exonic
1013743782 6:113320487-113320509 CACATGTCAAGGGTGGGGCTAGG + Intergenic
1016759624 6:147722956-147722978 CTTGTGCTCAGTGTGGGTCTGGG + Intronic
1018664816 6:166125851-166125873 CACATGCACAGTGTGTTTCCTGG + Intergenic
1021141656 7:17033435-17033457 CAGATGCCCAGTGCCTGTCTTGG - Intergenic
1021790570 7:24200794-24200816 GACATGCTCAGTGTGGAGCTGGG - Intergenic
1022522611 7:31017732-31017754 CACATGCCCAGCCTGGCTCCAGG + Intergenic
1023280159 7:38561103-38561125 CACATGCCTGCTGTGGGTCTTGG - Intronic
1023684075 7:42717250-42717272 CACATGCCAAGGGTGGGGCCAGG + Intergenic
1023804858 7:43865436-43865458 CACATGACCAGGAAGGGTCTAGG + Intergenic
1027113826 7:75462552-75462574 CACATTCCCAGTGTGGTTTCTGG + Intronic
1030113913 7:106049106-106049128 GAGATTCCCAGTTTGGGTCTTGG - Intergenic
1030192397 7:106822600-106822622 CAAGGGCTCAGTGTGGGTCTTGG - Intergenic
1031232337 7:119123875-119123897 CACATGCCCACTGGGGGTTCAGG + Intergenic
1032718072 7:134527945-134527967 AAGATGCCCATTGTGGGCCTGGG + Exonic
1032722925 7:134565514-134565536 AAGATGCCCATTGTGGGCCTGGG + Intronic
1034099242 7:148437090-148437112 CACATGCCCACTGGGGCTTTAGG - Intergenic
1035141417 7:156766360-156766382 TACAGGCCCACTGTGGGGCTTGG + Intronic
1035339884 7:158153432-158153454 CACATGCCCACTGGGGCTTTAGG + Intronic
1037632993 8:20675253-20675275 CTCATGCCCAGCTTGAGTCTCGG - Intergenic
1041128160 8:54666598-54666620 CACATGCCTATTGAGGCTCTGGG + Intergenic
1041806921 8:61861603-61861625 CAGATATCCAGTATGGGTCTTGG - Intergenic
1042228563 8:66534591-66534613 CAAGTGCCAAATGTGGGTCTGGG + Intergenic
1043365405 8:79527090-79527112 CACATGTCAAGGGTGGGACTAGG + Intergenic
1043661354 8:82746247-82746269 CATATGCCCATGATGGGTCTGGG - Intergenic
1045737772 8:105317904-105317926 CAAATGCCAACTGTGTGTCTTGG - Intronic
1046759769 8:118009188-118009210 CACATTCCCAGTGTAGCTCAGGG - Intronic
1047883188 8:129218811-129218833 CACATGCCCAGTGGGGCTTTGGG + Intergenic
1048198588 8:132352879-132352901 ATCATGCCCAGTGTGGAACTGGG - Intronic
1048245656 8:132795694-132795716 CAAATACCCACTGGGGGTCTTGG - Intronic
1048780570 8:137995082-137995104 CACATGCCAAGGGTGGGGCCAGG + Intergenic
1049874643 8:145008380-145008402 CACATGCCCAGTGTGTTTACTGG + Intergenic
1050943308 9:11486988-11487010 CAGATGCCTAGGGTGGGACTGGG + Intergenic
1053433048 9:38056192-38056214 CAAATGGCTAGTGTGTGTCTGGG - Intronic
1056338551 9:85601524-85601546 CACATACCATCTGTGGGTCTGGG + Intronic
1056430891 9:86526791-86526813 CACATGCCCAGTGTTCTTCAAGG - Intergenic
1056729205 9:89150215-89150237 CAGATACCCACTGGGGGTCTTGG + Intronic
1058707656 9:107650528-107650550 CACCTCTCCAGTGTGGCTCTTGG + Intergenic
1059319936 9:113461669-113461691 TAAGTGCCCAGTGTGGGCCTCGG + Intronic
1059464637 9:114460107-114460129 CCCAAGCCCAGTGTGGTTCCTGG - Intronic
1059558453 9:115306859-115306881 CACATGTCAAGGGTGGGTCCAGG - Intronic
1059570913 9:115434617-115434639 CATATGCCAAGGGTGGGACTAGG + Intergenic
1060327537 9:122631810-122631832 CACATACCCTGTGTGGGTGTAGG - Intergenic
1061368097 9:130182903-130182925 CACAGGTGCAGTGTGGGTTTTGG + Intronic
1061616756 9:131785367-131785389 GACAGGCCCAGTGGGGATCTGGG - Intergenic
1062450080 9:136611486-136611508 GGCAGGCCCAGTGTGGGGCTTGG + Intergenic
1203516035 Un_GL000213v1:2329-2351 CACATGCCCTCTGGGGCTCTGGG + Intergenic
1203658942 Un_KI270753v1:23574-23596 CACATGCCCAGAGGGAGTGTTGG + Intergenic
1186169473 X:6861718-6861740 CACTTGCCCAGTGAGCTTCTTGG - Intergenic
1187371673 X:18714232-18714254 CTCATGCTCAGTGTGGTACTTGG + Intronic
1189196631 X:39159178-39159200 AACAAGGCCAGTGTGGATCTGGG + Intergenic
1189995948 X:46637983-46638005 CAGAAGCCCAGGGTGGTTCTTGG - Intronic
1196403254 X:115337980-115338002 CACATGGCTTGTGTGGGTGTAGG + Intergenic
1201731665 Y:17211071-17211093 CACATGCCCTCTGTGGCTCCAGG + Intergenic