ID: 926205568

View in Genome Browser
Species Human (GRCh38)
Location 2:10832716-10832738
Sequence GGTCTTCCTTCCAGGAGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926205559_926205568 17 Left 926205559 2:10832676-10832698 CCTGGGCTGGCTGAATCCTGCAG 0: 1
1: 0
2: 0
3: 43
4: 297
Right 926205568 2:10832716-10832738 GGTCTTCCTTCCAGGAGGTCGGG 0: 1
1: 0
2: 1
3: 19
4: 166
926205555_926205568 30 Left 926205555 2:10832663-10832685 CCCAGGCTCAGGCCCTGGGCTGG 0: 1
1: 1
2: 5
3: 82
4: 641
Right 926205568 2:10832716-10832738 GGTCTTCCTTCCAGGAGGTCGGG 0: 1
1: 0
2: 1
3: 19
4: 166
926205558_926205568 18 Left 926205558 2:10832675-10832697 CCCTGGGCTGGCTGAATCCTGCA 0: 1
1: 0
2: 3
3: 24
4: 213
Right 926205568 2:10832716-10832738 GGTCTTCCTTCCAGGAGGTCGGG 0: 1
1: 0
2: 1
3: 19
4: 166
926205560_926205568 1 Left 926205560 2:10832692-10832714 CCTGCAGTCAGCATCTCCCGCCT 0: 1
1: 0
2: 1
3: 17
4: 170
Right 926205568 2:10832716-10832738 GGTCTTCCTTCCAGGAGGTCGGG 0: 1
1: 0
2: 1
3: 19
4: 166
926205557_926205568 29 Left 926205557 2:10832664-10832686 CCAGGCTCAGGCCCTGGGCTGGC 0: 1
1: 1
2: 5
3: 79
4: 712
Right 926205568 2:10832716-10832738 GGTCTTCCTTCCAGGAGGTCGGG 0: 1
1: 0
2: 1
3: 19
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926205568 Original CRISPR GGTCTTCCTTCCAGGAGGTC GGG Intronic
900140565 1:1137842-1137864 GGTCCTCTGTCCAGGAGGTCTGG + Intergenic
901219877 1:7577490-7577512 GGACTTCCTTCCAGGCCGGCTGG - Intronic
901871610 1:12141881-12141903 GGTCCGCCTTGCAGGAGGGCTGG + Intronic
903688017 1:25146723-25146745 ACTCTCCCTCCCAGGAGGTCCGG + Intergenic
904965636 1:34370289-34370311 GGGCTTCCTTCCAGGTGTCCAGG + Intergenic
905181704 1:36171241-36171263 GCTGCTCCTTCGAGGAGGTCTGG - Exonic
907956684 1:59235247-59235269 CGTCTTCCTTCCTAGAGTTCAGG + Intergenic
908003607 1:59706267-59706289 GGTTTTAATTCCAGGAAGTCTGG - Intronic
916518344 1:165541104-165541126 GCCCATCCTTCCAGGAGGACAGG - Intergenic
920021653 1:202961039-202961061 GATTTTCCTTCCTGGAGGTGAGG + Intergenic
920060380 1:203223208-203223230 GGCGTTCCTTCCCTGAGGTCTGG + Exonic
921010231 1:211133940-211133962 GGTCATCCTCCCAGCAGCTCGGG + Exonic
921866563 1:220093451-220093473 GGTCTGCGTTCCAGGAAATCAGG + Intergenic
1063212188 10:3890901-3890923 GGGCTGCATTCCAGGAGGTTAGG + Intergenic
1068762736 10:60731789-60731811 GGACTTCATTCCAGGAGGGTAGG - Intronic
1071273839 10:84034712-84034734 GGTCTTCTTTCCAGGGGACCTGG - Intergenic
1072711707 10:97719775-97719797 GGTTTTCCTTCCAGGAGACCAGG + Intergenic
1072790966 10:98317673-98317695 AATTCTCCTTCCAGGAGGTCAGG + Intergenic
1073500326 10:103931421-103931443 GGTCATCCTACCTGTAGGTCAGG + Intergenic
1073812053 10:107163211-107163233 GCTCTTCATTAGAGGAGGTCAGG + Intronic
1074443319 10:113497585-113497607 GGGCTTCTGTCCAGGAGGTGAGG + Intergenic
1075334018 10:121596380-121596402 GGTCTGCCTTCTTGGAGGGCGGG - Intronic
1075673619 10:124281179-124281201 GGTCTGCATCCCAGGAGGTTTGG - Intergenic
1078105141 11:8353692-8353714 GGTCTTCCTCGGAGGAGGCCTGG + Intergenic
1080465808 11:32495970-32495992 GGCCTACCTTGCAGGAGCTCTGG - Intergenic
1087181411 11:95146002-95146024 CCTCTTCATGCCAGGAGGTCTGG - Intergenic
1087283894 11:96243573-96243595 GGTCTTCCTTCTTGGAGGTATGG - Intronic
1089292410 11:117445312-117445334 GGCCTTGAATCCAGGAGGTCCGG + Intronic
1089423145 11:118346910-118346932 GGTCTTCTGACCAGGTGGTCAGG + Intronic
1090922323 11:131217203-131217225 TGTCTTCCAGCAAGGAGGTCGGG + Intergenic
1091299538 11:134498625-134498647 GGACTTCATTCCAGGGGGTGTGG + Intergenic
1091691246 12:2598901-2598923 GGCCTTGGTTCCTGGAGGTCGGG + Intronic
1091879762 12:3967695-3967717 GGTCTTATGTCCAGGAAGTCCGG - Intergenic
1094061983 12:26324065-26324087 GGTCTTCCTGCCAGTAGTTTGGG + Intergenic
1096711751 12:53462546-53462568 GGTCATCTTTGCAGGTGGTCAGG + Exonic
1098034038 12:66284034-66284056 TGCCTTCCTTCTAGGAAGTCCGG - Intergenic
1100518278 12:95349486-95349508 GCTCTTCCTCCCAGAAAGTCCGG + Intergenic
1102037749 12:109781884-109781906 CCTCCTCCTGCCAGGAGGTCTGG + Intergenic
1102734450 12:115145895-115145917 GGTCTACCACCCAAGAGGTCTGG + Intergenic
1103743589 12:123107470-123107492 GCCCTTCCTTCCAGAAGGTGGGG - Intronic
1104676825 12:130716808-130716830 GATCTTCCCTGCAGGAGGCCGGG + Intergenic
1104944041 12:132407719-132407741 GGACTCCCTTCCGGGAGCTCAGG - Intergenic
1106419214 13:29571734-29571756 TTTCCTCCTTCCAGGAGGTCTGG + Intronic
1108683313 13:52797993-52798015 GTTCTTCCTGCCAGGTGGTATGG + Intergenic
1109031351 13:57193799-57193821 GGCCTTCCTTCCTGGGTGTCTGG - Intergenic
1111694219 13:91603211-91603233 TTTCTTCCTGCCAGGTGGTCTGG - Intronic
1112251525 13:97784996-97785018 GGTTTTCCTTCCAGAAAGCCAGG + Intergenic
1116216581 14:42024755-42024777 GGTCTGCCTTCCAGGATGACTGG + Intergenic
1117321305 14:54626132-54626154 ACTCTAGCTTCCAGGAGGTCAGG + Intronic
1117567259 14:57006717-57006739 GGGCTTCCTTTCAGGGGGACCGG - Intergenic
1118940102 14:70326364-70326386 TTTCTTCCTTGGAGGAGGTCAGG + Exonic
1120499530 14:85277761-85277783 AATCTTCCTTCCACTAGGTCAGG - Intergenic
1121858985 14:97298795-97298817 CGTCTTCCTTGGGGGAGGTCAGG + Intergenic
1125345991 15:38719605-38719627 GGTTTTTCTACCAGGAAGTCAGG - Intergenic
1125540656 15:40467920-40467942 GGCCCTCCTCCCAGGAGGTAGGG + Exonic
1128675781 15:69607540-69607562 GGTCTTCCCTCCAGACAGTCAGG + Intergenic
1129164873 15:73771239-73771261 GAGCCTCCTTCCAGGAGTTCTGG - Intergenic
1129684366 15:77676877-77676899 GGCCTTCCTTCTCAGAGGTCAGG + Intronic
1130228659 15:82079795-82079817 GCTCTGCCTTCAAGGAGCTCAGG + Intergenic
1131559613 15:93427890-93427912 GGTCTTCCTTCCACAAGATGTGG - Intergenic
1133294870 16:4746774-4746796 GGACGTCCTGCCAGGAGGTGAGG - Intronic
1138609143 16:58109174-58109196 GGGCTTCCTGCTAGAAGGTCAGG - Intergenic
1139788323 16:69411989-69412011 GGTCTTCCTACCTTGAGGTCTGG + Intergenic
1140638984 16:76949782-76949804 GGTCTTTCTTCCAGGAGAAAAGG - Intergenic
1144226817 17:13157201-13157223 GGTCTGCCTTCAAGGACATCTGG - Intergenic
1144235836 17:13259493-13259515 GTTCTTCCTGCCAGAAAGTCAGG + Intergenic
1145282380 17:21477538-21477560 CATCTTCTTTCCATGAGGTCCGG + Intergenic
1148197072 17:45721742-45721764 CGTCTTCCTTCCAGAGAGTCAGG + Intergenic
1149997387 17:61412192-61412214 GGGCTTCCTCCCAAGAGGGCGGG - Exonic
1151320318 17:73348854-73348876 GGTCTGCCTTCCAGGGGCCCGGG + Intronic
1153224268 18:2886224-2886246 TGTCTGCCTTCCATGAAGTCAGG - Intronic
1154207967 18:12354167-12354189 GGTCTTCCTGCCTGGATTTCTGG + Intronic
1156510257 18:37630472-37630494 GGACTTTCTGCCTGGAGGTCTGG - Intergenic
1157921077 18:51713130-51713152 GGCCTCCCTTCCAGGAAGTATGG - Intergenic
1158238437 18:55347630-55347652 GGTCTTCCTCCCAGGCAATCAGG - Intronic
1159475554 18:68916517-68916539 GCTCTAGCTTCCAGGAAGTCAGG + Intronic
1160380796 18:78453840-78453862 GGTCTTCCTCCCATGAGCTGAGG - Intergenic
1161397696 19:4053134-4053156 GTTCTTCCTTCCTGGAGGGCTGG - Intronic
1162894867 19:13759215-13759237 AGTCGTCCTTCCAGGCGCTCTGG - Exonic
1164505965 19:28861427-28861449 GGTCTTCCTCCCAGATGCTCAGG - Intergenic
1164856426 19:31528123-31528145 TTTCTTCCTTCCACGAGGTCTGG - Intergenic
1166409367 19:42546628-42546650 GCTCGTCCTTCCAAGAGTTCTGG + Intronic
1167843941 19:52144833-52144855 GGGCCTGGTTCCAGGAGGTCAGG + Intergenic
925288493 2:2730948-2730970 TTCCTCCCTTCCAGGAGGTCTGG - Intergenic
925396546 2:3537343-3537365 GGTCTGCCTTCAAAGAGGGCAGG - Intronic
926205568 2:10832716-10832738 GGTCTTCCTTCCAGGAGGTCGGG + Intronic
927338445 2:21952476-21952498 GCTCTTACTTCAAGGAGGCCCGG + Intergenic
928140585 2:28725479-28725501 GGTCTGCAGTCCAGGAGCTCAGG + Intergenic
931746596 2:65296467-65296489 GGTCTTCCTCCCAGGCGGAGTGG - Intergenic
932857665 2:75254316-75254338 GGTCTTCCTTTTCGAAGGTCAGG + Intergenic
933663239 2:84944514-84944536 CCTTTTCCTTCCTGGAGGTCTGG - Intergenic
933844435 2:86314186-86314208 GGCCTTCCTGGCAGGAGGTAAGG - Intronic
933980174 2:87542914-87542936 GGTTCTCCTGCCAGTAGGTCAGG - Intergenic
935621798 2:105136517-105136539 TGTGTTCCTTCCAGGAGCTCTGG + Intergenic
935666025 2:105513482-105513504 GGGCTTCACTCCAGGAGGGCTGG - Intergenic
935727628 2:106037594-106037616 GGTCTCTGATCCAGGAGGTCTGG + Intergenic
936313653 2:111407877-111407899 GGTTCTCCTGCCAGTAGGTCAGG + Intergenic
936846362 2:116839910-116839932 GTTCTTCCTTCTAGGAGGGAAGG + Intergenic
937288654 2:120768736-120768758 GGTCCTGCTCCCAGGATGTCAGG + Intronic
937307688 2:120882209-120882231 CATCCTCCTTCCAGGAGGCCAGG + Intronic
940459870 2:153951369-153951391 GCTATTCTTTCCAGGAGGTCTGG + Intronic
943885096 2:193206512-193206534 GGTCTTACTTACAGTAAGTCTGG + Intergenic
944515796 2:200510250-200510272 GGTCTTCCATCCCGGAGGTAAGG + Intronic
947716490 2:232341829-232341851 GGGCTTCCTTACAGAAGGGCAGG - Intronic
948047950 2:234958041-234958063 AGTCTTCCTTCCAGGAAGTCAGG + Intronic
1169044778 20:2526463-2526485 GGTTTTATTTCCAGGAGGTTAGG - Intergenic
1169747841 20:8961414-8961436 GGTCTTCCGTGTTGGAGGTCGGG - Intronic
1170446591 20:16434293-16434315 GGTCTTCTTCCCACGAGATCTGG - Intronic
1171316432 20:24199727-24199749 AGTCTTCCTTCCAGATGGCCAGG + Intergenic
1172082261 20:32351387-32351409 GTTCTGCCTTCCTGGAGGCCTGG - Intergenic
1173361608 20:42349755-42349777 AGTCCTCCTTCCTGGAGTTCTGG + Intronic
1174846801 20:53950313-53950335 GCTCTTTCTTCCAGGAGGAGGGG - Intronic
1175015570 20:55786390-55786412 CGTCTTCCTTCCATGATGTCTGG - Intergenic
1175316169 20:58048237-58048259 TGTCTTCATTCCAGGTTGTCTGG - Intergenic
1175501785 20:59456024-59456046 GGTCTTTATCCAAGGAGGTCAGG + Intergenic
1175765306 20:61588347-61588369 GGTCCTGCTTCCAGAAGGTCTGG + Intronic
1179072908 21:38089608-38089630 TGTGTTCCTTCCTGGAGGTTTGG - Intronic
1179726975 21:43346292-43346314 GGGCCTCCATCCAGGAGGACAGG - Intergenic
1180594526 22:16964556-16964578 GGTCTCCCCTCAAGGAAGTCTGG - Intronic
1181359112 22:22321752-22321774 GCTCTTCCCTCCAGGATGGCTGG - Intergenic
951750950 3:26035875-26035897 TGTCTCCCTTCCACAAGGTCTGG + Intergenic
952277118 3:31887704-31887726 TGTCTTACTTCCAGGAAGTTTGG - Intronic
953568382 3:44052213-44052235 GAAGTTCCTTCCAGGAGGCCCGG - Intergenic
954515705 3:51174875-51174897 GGGCCTCTTTCCAGGAGTTCAGG + Intronic
955044363 3:55346121-55346143 GGGCATCCTTCCATGAGGACAGG - Intergenic
957765069 3:84613718-84613740 GATCTAGCTTCAAGGAGGTCTGG - Intergenic
958717012 3:97796040-97796062 GGTCTTCCTTTTAGTACGTCTGG - Intronic
965330168 3:167362965-167362987 GGTCTTCAAACCAGGATGTCAGG - Intronic
968804214 4:2762089-2762111 GGCTTTCCTTCAGGGAGGTCAGG + Intergenic
975345747 4:73291264-73291286 GGCCTGCCTTCCAAGAGCTCTGG - Intergenic
988237666 5:28566476-28566498 TGTTTTCCTTCCTGGAGGTAGGG + Intergenic
990396027 5:55379647-55379669 GATCTTCCTTGCAGGAGATGAGG + Intronic
995100946 5:108304834-108304856 GGTCTTCCTTTCCGTAGGTAGGG - Intronic
996885217 5:128345715-128345737 GGAGTCCATTCCAGGAGGTCAGG - Intronic
997047643 5:130338107-130338129 CCTCTTGCTTGCAGGAGGTCAGG + Intergenic
997457416 5:134027444-134027466 TGCCTTCCTTCCAGCAGCTCAGG + Intergenic
999386249 5:151156410-151156432 GGCCTGCCTGCTAGGAGGTCAGG + Intronic
999464744 5:151792089-151792111 GCTGTTCCTTCAAGGAGGCCTGG + Intronic
999546343 5:152632703-152632725 GCTCCTCCTTCCAGGTGGTGGGG + Intergenic
999692873 5:154163868-154163890 GTCCTTCCTTCCAGGAGCTTAGG - Intronic
999743659 5:154575660-154575682 GGTCTTCCTCCCAGGCTGCCTGG + Intergenic
1000105543 5:158055525-158055547 AGTCTTCCTTCCAGGACGTAGGG + Intergenic
1001380175 5:171300861-171300883 GGTCTTCCTTACAAGGGGCCAGG - Intergenic
1001406123 5:171479096-171479118 GGTCTTTTTTCCTGGAGCTCTGG + Intergenic
1001685345 5:173590593-173590615 GGACTTCCCTACAGTAGGTCTGG - Intergenic
1003496359 6:6667013-6667035 GGGTGTCCTTCCAGGAGGTGGGG - Intergenic
1004086553 6:12455038-12455060 GGTCTTGGTTCCAGCAGATCTGG - Intergenic
1005331681 6:24756725-24756747 GGACTTCATTCCAGGAGGTTAGG - Intergenic
1005763157 6:28986216-28986238 AGTCTTCCCTCCGGGAGGTAGGG + Intergenic
1006838850 6:37015424-37015446 GGTGGTCCTGCCTGGAGGTCTGG + Intronic
1011247924 6:85339366-85339388 TGGCTTCCTAACAGGAGGTCAGG - Intergenic
1013480737 6:110550614-110550636 AGTTTTCCTTCCAGGAGGACAGG + Intergenic
1014222757 6:118815016-118815038 GTTCTTCCTTTCAGGAGGAGGGG + Exonic
1014258826 6:119192549-119192571 GGTCTTTCTAACAAGAGGTCTGG - Intronic
1014279860 6:119429772-119429794 GCTTTTCCATCCAGGAGGCCTGG + Intergenic
1018762479 6:166904112-166904134 GGACTTTCTGCCAGAAGGTCGGG + Intronic
1018789529 6:167136334-167136356 TGTGCTCCTTGCAGGAGGTCAGG + Exonic
1019310824 7:359811-359833 GGCCCTCCTCCCAGGTGGTCTGG + Intergenic
1019716995 7:2543687-2543709 GGGCTTCCGTCCAGGGGCTCTGG + Exonic
1021217461 7:17934505-17934527 GGTCTGCCTTCCATGTGGGCAGG + Intronic
1026457429 7:70584847-70584869 TGTCTTCATTCCAGAAGCTCTGG + Intronic
1028728469 7:94117009-94117031 GTTTATCCTTCCAGTAGGTCTGG - Intergenic
1028931283 7:96415532-96415554 GGTCTTCCTCCCAGGAGCCTGGG + Intergenic
1032784080 7:135186904-135186926 GGGGTTCCTCCCTGGAGGTCTGG - Intronic
1034763112 7:153692406-153692428 GGATTTGCTTCAAGGAGGTCAGG + Intergenic
1035309440 7:157955826-157955848 GGTCTTCATACGTGGAGGTCAGG + Intronic
1037722724 8:21458729-21458751 CCTCTTCCTCCCGGGAGGTCAGG - Intergenic
1037802872 8:22044609-22044631 GGCCTCCCTTCCAGGGGGTGGGG - Intronic
1042206442 8:66334319-66334341 GCTCGTCCTTCCAGGAGGGCTGG + Intergenic
1042987810 8:74603665-74603687 GGTCATCTTTGCAGGCGGTCAGG - Intronic
1043381363 8:79705661-79705683 GGCTTTACTTCCAGGAGGTCTGG - Intergenic
1043402138 8:79894201-79894223 GGTCCACCATCCAGGAGGCCAGG - Intergenic
1047706961 8:127509007-127509029 AGTGCTCCTTCCAGGAGCTCAGG + Intergenic
1049183364 8:141234957-141234979 GGTCTGCCTTCCCCGAGGACAGG + Intronic
1049313851 8:141948360-141948382 GGCCTTTCATCCAGGAGGCCTGG + Intergenic
1049436448 8:142588321-142588343 GGTCTTACCTCCAGGAGGCCAGG - Intergenic
1051503988 9:17808058-17808080 GCCATTCCTACCAGGAGGTCTGG + Intergenic
1051599956 9:18862785-18862807 GGTCTTCCCTCCTGCAGGCCAGG + Intronic
1053277803 9:36796545-36796567 GGCCTTCCTTCCAGGCTGTGAGG + Intergenic
1057948103 9:99347568-99347590 GCTCTTCCATCCTGGAGATCTGG + Intergenic
1058400404 9:104610839-104610861 TATCATCCTTCCATGAGGTCAGG + Intergenic
1060186704 9:121568106-121568128 GGTCAGCCTTCCAGGGGTTCAGG + Intronic
1062382245 9:136292057-136292079 CCTCTTCCTTCCAGGCGGCCTGG + Intronic
1185603775 X:1355494-1355516 GGACTTCCTTCCAGGGGCCCAGG + Intronic
1192554783 X:72080873-72080895 TGCCTTACTGCCAGGAGGTCTGG - Intergenic
1200093905 X:153648340-153648362 GGCCCTCCTTCCAGGGGGTTCGG + Intronic
1200235225 X:154464831-154464853 AGTGCTCCTTCCAGGAGGGCAGG + Exonic