ID: 926206096

View in Genome Browser
Species Human (GRCh38)
Location 2:10835272-10835294
Sequence GCTGGGGACTCCAGGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 416}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926206082_926206096 26 Left 926206082 2:10835223-10835245 CCATCTGCAGGAAGTGCTGTTTC 0: 1
1: 0
2: 2
3: 35
4: 308
Right 926206096 2:10835272-10835294 GCTGGGGACTCCAGGGACACAGG 0: 1
1: 0
2: 3
3: 34
4: 416
926206085_926206096 4 Left 926206085 2:10835245-10835267 CCATCCCAGGCCTGAGATGGTGG 0: 1
1: 0
2: 1
3: 36
4: 360
Right 926206096 2:10835272-10835294 GCTGGGGACTCCAGGGACACAGG 0: 1
1: 0
2: 3
3: 34
4: 416
926206091_926206096 -6 Left 926206091 2:10835255-10835277 CCTGAGATGGTGGAAAGGCTGGG 0: 1
1: 0
2: 2
3: 26
4: 327
Right 926206096 2:10835272-10835294 GCTGGGGACTCCAGGGACACAGG 0: 1
1: 0
2: 3
3: 34
4: 416
926206087_926206096 0 Left 926206087 2:10835249-10835271 CCCAGGCCTGAGATGGTGGAAAG 0: 1
1: 0
2: 0
3: 32
4: 232
Right 926206096 2:10835272-10835294 GCTGGGGACTCCAGGGACACAGG 0: 1
1: 0
2: 3
3: 34
4: 416
926206088_926206096 -1 Left 926206088 2:10835250-10835272 CCAGGCCTGAGATGGTGGAAAGG 0: 1
1: 0
2: 0
3: 24
4: 224
Right 926206096 2:10835272-10835294 GCTGGGGACTCCAGGGACACAGG 0: 1
1: 0
2: 3
3: 34
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926206096 Original CRISPR GCTGGGGACTCCAGGGACAC AGG Intronic
900326395 1:2110578-2110600 TCAGGGGACTCCAGGGACTTGGG - Intronic
901034311 1:6327149-6327171 CCTGGGGACCCCAGAGAAACTGG + Intronic
901201699 1:7470927-7470949 GCTGGGCACTCAGGGGAGACAGG - Intronic
901238148 1:7678544-7678566 GCTGGGGACGCCAGAGCCAGAGG + Intronic
901451140 1:9337682-9337704 GATGGGGACTCCCTGGCCACCGG + Intronic
901686721 1:10947463-10947485 GCCAGGGAGTCCAGGGGCACTGG - Intronic
901739089 1:11330571-11330593 GATGGTGACACCAGGGACAGGGG - Intergenic
901781766 1:11598982-11599004 TCTGGGGACTCCCAGGACCCTGG + Intergenic
902109011 1:14062276-14062298 TCTGGGAACTCCAGGAACAACGG - Intergenic
902336487 1:15757795-15757817 CCTGAGGCCTCCAGGGACCCAGG + Intronic
902368827 1:15993203-15993225 CCTGAGGACTCCAGAGACCCAGG + Intergenic
902470066 1:16643027-16643049 GCTGAGAAATCCAGGGTCACAGG - Intergenic
903263052 1:22141822-22141844 GCTGGGGTTTCCATGGAGACAGG - Intronic
903500823 1:23799462-23799484 GATTGGGACTCCAGGGTCGCAGG + Intronic
903769579 1:25755258-25755280 CCTGGGACCTTCAGGGACACTGG + Intronic
903772247 1:25771363-25771385 GCTGGGGACGGCAGGGCCTCTGG - Intronic
903804826 1:25997806-25997828 AGTGGGGATTCCAGGGGCACTGG + Intronic
904378879 1:30097899-30097921 GCTGGGGAGAACTGGGACACTGG + Intergenic
904714009 1:32453188-32453210 GATGTGGATTCCGGGGACACAGG - Intergenic
905183935 1:36182860-36182882 GCTGGGAATTCCAGGGACAAAGG + Intergenic
905352842 1:37359439-37359461 CCTGGAGAGTCCAGGGGCACAGG + Intergenic
906913691 1:49983862-49983884 TCTGGGGTCTCCTGGGCCACAGG - Intronic
907335297 1:53695612-53695634 CCTGGGGCCTCCCAGGACACAGG - Intronic
908824196 1:68117566-68117588 CCTGGGAGCTCCAGGGACCCTGG + Intronic
910724568 1:90324971-90324993 GGTACTGACTCCAGGGACACTGG + Intergenic
912447922 1:109751671-109751693 GCCGGGGACCCCTGGGACCCAGG - Exonic
915626013 1:157114629-157114651 TCTGGGGGCTTCAGGGAGACAGG + Intergenic
917485639 1:175452396-175452418 CCTGGGGACTGCATGGGCACAGG + Intronic
917788398 1:178483761-178483783 GCTGAGGACACCAGGGTCTCTGG - Intergenic
917854524 1:179089963-179089985 CCTGGAGACTGCAGGGTCACCGG - Intronic
918552362 1:185757829-185757851 ACTGGGGACTCCAAGGAGAGAGG - Intronic
918615212 1:186536580-186536602 GCTGGGGACTCCTGGAAAACTGG + Intergenic
920868751 1:209775516-209775538 GCTGGGGACTCCAGGCAGCTTGG + Intronic
921133227 1:212237577-212237599 GCTGAGAAGTCCAGGGACAAAGG + Intergenic
924385535 1:243495619-243495641 GCTGGGGACAGCAGGGCCGCAGG + Intronic
1063089499 10:2849760-2849782 TCTGTGGAATCCCGGGACACTGG + Intergenic
1065918073 10:30368623-30368645 GCTGGGGGCTCCAGGGGCAGGGG + Intronic
1066061114 10:31724327-31724349 GCTGGAGAGTCTAGGGAGACTGG + Intergenic
1066148387 10:32587303-32587325 GCTGGGGAGTCCAAGGTCAAGGG + Intronic
1067431388 10:46248231-46248253 GCAGGGCTCTCCAGGGACCCAGG + Intergenic
1067437051 10:46285538-46285560 GCTTGGGAGTCCAGGGCCAGAGG + Intergenic
1067891453 10:50140025-50140047 GCTGGGGACTACAGGAAAGCTGG + Intergenic
1070593785 10:77818582-77818604 GCTGGAGCCTCCAGGGAGAAGGG - Intronic
1070676753 10:78417268-78417290 GATGGGGACTCCAGGTCCTCTGG - Intergenic
1070698675 10:78582752-78582774 GCCTGGAACTCCAGGGACAGAGG + Intergenic
1070850899 10:79560799-79560821 GCTGCAGGCTCCAGAGACACTGG - Intergenic
1070856300 10:79610475-79610497 GCTGCAGGCTCCAGGGACACAGG + Intergenic
1071546980 10:86536562-86536584 GCTGGGGCCTCCCGGGACCCGGG + Intergenic
1072151674 10:92689678-92689700 CCTGGGGACTCCAGGCACCCCGG - Intergenic
1072660662 10:97361596-97361618 ACGGGGGACTCCAGGTCCACTGG + Intronic
1073511268 10:104044042-104044064 GCTCTGGCCTCCAGGGACTCTGG - Intronic
1075445521 10:122510023-122510045 GCTGGGGACACCAGGGGCCGGGG - Intronic
1075630895 10:124000098-124000120 GCAGGGCACCCCAGGGTCACAGG + Intergenic
1075829766 10:125398350-125398372 GCTGGGAGCTCCAGGGTCCCAGG - Intergenic
1076472555 10:130729041-130729063 GCTGGGGCCTCCGGGCAGACGGG + Intergenic
1076499472 10:130924831-130924853 TCTGGTGACTTCAGGGACCCAGG - Intergenic
1076595280 10:131621107-131621129 GCTGGGGTCTCCTGAGACACTGG + Intergenic
1076746208 10:132515958-132515980 GCTGGGGAGGCCGGGGACCCTGG + Intergenic
1076796273 10:132799877-132799899 GCTGGGCAGTCCAGGGAGAGGGG - Intergenic
1076893881 10:133299360-133299382 CCTGTGGACGCCACGGACACAGG + Intronic
1077171569 11:1168620-1168642 GCTGGGGACACAAAGGACAAGGG - Exonic
1077190588 11:1254537-1254559 GCTGGAGACTCCAGGCCCCCAGG + Intronic
1077301011 11:1846994-1847016 GCTGGGGCCACCATGTACACTGG + Intergenic
1077362666 11:2147626-2147648 GCTGGGGTCGCCTGGGCCACAGG + Exonic
1077442408 11:2574858-2574880 ACTGGGGCCTTCGGGGACACAGG - Intronic
1077540862 11:3145914-3145936 GCTGAGGGTTACAGGGACACTGG + Intronic
1077585318 11:3447148-3447170 GCTGGGGAAGCCAGGGTCTCTGG + Intergenic
1078472602 11:11603723-11603745 GCTGGGGACTGCATGGACTAAGG + Intronic
1078882260 11:15463880-15463902 CCTGAGGACTCCAGGGCTACTGG + Intergenic
1079244437 11:18742552-18742574 CATGGGCACTCCAGGAACACGGG - Intronic
1080691648 11:34563726-34563748 GCAGGAGACTCCAGGGAAAGAGG - Intergenic
1081542446 11:44045649-44045671 GCCGGGGACTCCAGGCACATAGG - Intergenic
1081580578 11:44348894-44348916 GCTGGTGATGCCAGGAACACTGG - Intergenic
1081772180 11:45656848-45656870 GCTGGGGACTGCTGAGATACAGG + Intronic
1083329880 11:61892359-61892381 GCTGGGGACTCCCGAGACTGAGG - Intergenic
1083615473 11:64023963-64023985 GCTTGGGTCTCCAGGGGCCCAGG - Intronic
1083664865 11:64268875-64268897 GGTGGGGAGGCCAGGGAAACAGG + Exonic
1084242221 11:67829711-67829733 GCTGGGGAAGCCAGGGTCTCTGG + Intergenic
1084274594 11:68044901-68044923 GCGGGGGCCTTCAGGGACCCTGG - Intronic
1084517253 11:69643648-69643670 GCTGGGGACTCAAGGGAGCTGGG - Intronic
1084576216 11:69989549-69989571 GTGGGGGTCTCCAGGGCCACTGG + Intergenic
1084857332 11:71997623-71997645 CCTGGGGACCCCAGGGAAAGAGG - Intergenic
1085505804 11:77058178-77058200 GCTGGAGAATCCAGGGACCCTGG + Intergenic
1087423962 11:97966748-97966770 ACTGGGGTCTCCAGGCACAATGG + Intergenic
1089159190 11:116424489-116424511 GCTGGGCACAGCAGGGAGACGGG + Intergenic
1089407190 11:118207817-118207839 GCTGAGGAATCCATGGAAACAGG - Intronic
1089747634 11:120628333-120628355 GCTGGGGGCTCCTGGGACCATGG - Intronic
1090033922 11:123231611-123231633 GCTGGAGTCTTCAGGGACCCGGG + Intergenic
1090267778 11:125364377-125364399 GCTGGGGCCTCTTGGAACACTGG + Intronic
1090699027 11:129278781-129278803 AGTGGGGGCTCCAGGGACACCGG - Intronic
1090726149 11:129529182-129529204 GCTGGGGAGTCCAAGGTCAAGGG + Intergenic
1091251830 11:134150529-134150551 GGTGGGCACTGCAGGGACACTGG + Exonic
1091755116 12:3046256-3046278 CCTGGGGAGCCCAGGGATACTGG - Intergenic
1092412470 12:8264410-8264432 GCTGGGGAAGCCAGGGTCTCTGG + Intergenic
1092920611 12:13228395-13228417 GGTGGGAACTCCAGGTACTCTGG - Intergenic
1094835987 12:34322334-34322356 GCGGGGGACCCCAGGGATTCTGG - Intergenic
1095952809 12:47790808-47790830 GCTGGGATCGCCAAGGACACCGG + Intronic
1096378273 12:51132835-51132857 GCTGGGCTCTGCTGGGACACTGG - Intronic
1096551821 12:52378133-52378155 GCAGGGGACGCTGGGGACACAGG + Exonic
1097029837 12:56082404-56082426 GCTGGGAACTCCAGGGTCCTTGG - Intronic
1097187388 12:57203068-57203090 GCTGTGGCCTTCAGAGACACGGG + Intronic
1097787741 12:63779850-63779872 GCTGGGGACTGCCTGGAAACGGG + Exonic
1098029861 12:66242548-66242570 GCTGGGTTCTCCAGGGAGAAGGG + Intronic
1099222960 12:79935393-79935415 GCTGGGGGCTCCCGGGAATCCGG + Intronic
1101712799 12:107284030-107284052 ACTGGTGACTCGAGGGACACAGG - Intergenic
1105327173 13:19381262-19381284 GCTGGGGCCTGCAGGGCCTCGGG - Intergenic
1105864475 13:24447083-24447105 GCTGGGGCCTGCAGGGCCTCGGG + Exonic
1106146658 13:27055245-27055267 GCTCGGGACTCCAGGTACTGAGG - Intergenic
1106327776 13:28710420-28710442 GCTGGGAATTGCAGGGACCCAGG + Intronic
1106584920 13:31048596-31048618 CCTGGTGACTCCATGAACACTGG + Intergenic
1107017519 13:35719595-35719617 GGGGGGGCCTCCATGGACACAGG + Intergenic
1108162878 13:47660932-47660954 TCTGGGGAATCCAGTGAGACTGG - Intergenic
1109053845 13:57520122-57520144 GATAGGAACTACAGGGACACCGG - Intergenic
1112119118 13:96390496-96390518 GCTGGGAACTCCAGGACCAAGGG - Intronic
1113592576 13:111511730-111511752 GCTAGGTCCACCAGGGACACAGG + Intergenic
1113643312 13:111973730-111973752 CCTGGGTTCTCCAGGGACCCCGG - Intergenic
1113805727 13:113109275-113109297 GTCGGGGACTGCAGGGACATGGG + Intronic
1113962535 13:114133375-114133397 GCTGGGGTCTGCAGGGGGACTGG - Intergenic
1113962550 13:114133414-114133436 GCTGGGGTCTGCAGGGGGACTGG - Intergenic
1113962739 13:114133850-114133872 GCTGGGGTCTGCAGGGGGACTGG - Intergenic
1115906507 14:38208709-38208731 GCTGGGGTCTCCAGAGAAAAGGG + Intronic
1116755264 14:48940425-48940447 GGTGGGGCCTCCAGGGGCAGTGG - Intergenic
1117013489 14:51494478-51494500 GCTGTGCCCTCCAGGCACACTGG + Intronic
1118079957 14:62347287-62347309 GCTCAGGACTCCAGGGAGCCAGG + Intergenic
1119480302 14:74954482-74954504 GCTGGGGACTCCCAGGGCAGTGG + Intronic
1122206632 14:100150925-100150947 GCTGGGGCCTCCGGAGCCACTGG + Intronic
1122582359 14:102778243-102778265 GCCGGCGACTCCCGGGGCACCGG + Intronic
1122867206 14:104611886-104611908 GCTGGGGACCCCAGGGAGGAGGG + Intergenic
1122928761 14:104923755-104923777 GTTGGGTCCTCCAGGGACTCTGG - Intergenic
1123054267 14:105561776-105561798 GGTGGGGGCTGCAGGGACAGAGG - Intergenic
1123078851 14:105682195-105682217 GGTGGGGGCTGCAGGGACAGAGG - Intergenic
1123107025 14:105846429-105846451 CCTGGGGCCTCCAGGGACCCAGG - Intergenic
1202899016 14_GL000194v1_random:25228-25250 ACTGTGGACTCCAGGGTCCCTGG + Intergenic
1123412605 15:20072861-20072883 GTGGGGGACTCCATGGACATGGG - Intergenic
1123473021 15:20568823-20568845 GCTGGGGGCTCCGGGGGCAAGGG - Intergenic
1123521947 15:21079974-21079996 GTGGGGGACTCCATGGACATGGG - Intergenic
1123644985 15:22431530-22431552 GCTGGGGGCTCCGGGGGCAAGGG + Intergenic
1123666277 15:22611306-22611328 GCTGGGGGCTCCGGGGGCAAGGG + Intergenic
1123733320 15:23163834-23163856 GCTGGGGGCTCCGGGGGCAGAGG - Intergenic
1123751454 15:23361226-23361248 GCTGGGGGCTCCGGGGGCAGAGG - Exonic
1124283823 15:28385130-28385152 GCTGGGGGCTCCGGGGGCAGAGG - Exonic
1124298874 15:28526484-28526506 GCTGGGGGCTCCGGGGGCAGAGG + Exonic
1124320098 15:28705712-28705734 GCTGGGGGCTCCGGGGGCAAGGG + Exonic
1124482414 15:30089705-30089727 GCTGGGGGCTCCGGGGGCAAGGG - Exonic
1124488873 15:30141807-30141829 GCTGGGGGCTCCGGGGGCAAGGG - Exonic
1124521163 15:30407504-30407526 GCTGGGGGCTCCGGGGGCAAGGG + Exonic
1124537499 15:30558716-30558738 GCTGGGGGCTCCGGGGGCAAGGG - Exonic
1124543957 15:30610771-30610793 GCTGGGGGCTCCGGGGGCAAGGG - Exonic
1124754657 15:32396516-32396538 GCTGGGGGCTCCGGGGGCAAGGG + Exonic
1124761157 15:32448871-32448893 GCTGGGGGCTCCGGGGGCAAGGG + Exonic
1124777477 15:32600192-32600214 GCTGGGGGCTCCGGGGGCAAGGG - Exonic
1125577907 15:40767635-40767657 GCTGGGCACTCCAGCGGCCCTGG + Exonic
1128078607 15:64843094-64843116 GGTGGGCACTGAAGGGACACAGG - Intronic
1129159652 15:73740249-73740271 CCAGCGGACCCCAGGGACACGGG - Exonic
1129188847 15:73926313-73926335 GCTGGGAACTCCAGGGACTGAGG + Intronic
1129606599 15:77028161-77028183 GCTGGGGACTCCAGGGGTGGAGG + Intronic
1129680506 15:77656074-77656096 GCTGGGCACTCAGGGGACAGGGG + Intronic
1129695933 15:77740728-77740750 GGTGGGGAGTCCAGGGCAACAGG + Intronic
1129729078 15:77919288-77919310 GCTGGGGGCGCCAGGGATAGGGG + Intergenic
1129748392 15:78041355-78041377 GGTGGGGGCAGCAGGGACACAGG + Intronic
1129856041 15:78825934-78825956 TCTGGGCTCTCCAGGGACTCCGG + Intronic
1130943948 15:88536644-88536666 GGCGGGGACTCCAGCTACACAGG + Intronic
1131013949 15:89042151-89042173 GCTGAGGACTCAAGGGACAGAGG + Intergenic
1131248887 15:90818309-90818331 GCTGCAGGCTCCAGGGACAGAGG + Intergenic
1131251891 15:90836520-90836542 GCTGGGACCTCCAGAGACTCTGG - Intergenic
1131825754 15:96321822-96321844 GCTGGGGACTGCCGGGAGAGTGG - Intergenic
1131844199 15:96471566-96471588 GCTGGGGAAGCGAGGGAGACAGG - Intergenic
1132009455 15:98262926-98262948 GCTGGGGACTCCAGACATAAGGG + Intergenic
1132301637 15:100779726-100779748 ACTGGGGACCCCAGGGATGCTGG - Intergenic
1132647656 16:1006589-1006611 TCTTGGGACTGAAGGGACACTGG + Intergenic
1132685783 16:1161543-1161565 TCTGGGGTCTCCATGGCCACAGG + Intronic
1132720430 16:1313001-1313023 ACTGGGGACACCAGGCAGACAGG - Intronic
1132761733 16:1511817-1511839 GCTGGGGACACAGGGGACACAGG + Intronic
1133111337 16:3549879-3549901 GTTGGGGGCTCCAGGGACAGTGG + Intronic
1134624701 16:15715127-15715149 GCTGGGGGCTCGAGGGAGGCTGG + Intronic
1135190184 16:20348323-20348345 GCTGGGGTCTGCAGGGTCACAGG + Exonic
1135736432 16:24935194-24935216 GCTTGGGACACCAGGAAAACTGG + Intronic
1136615810 16:31397759-31397781 GCTAGGGACTCCTGGCTCACAGG + Intronic
1139750808 16:69107743-69107765 CCTGGGGACTCCTGGGCCGCAGG + Intronic
1140474133 16:75230136-75230158 GCATGGGACTGCAGGGAAACGGG + Intronic
1140476437 16:75241625-75241647 GTGGGGGACTCCATGGACATGGG - Intronic
1140857369 16:78989893-78989915 GCGGGGGATTCCAGGTACAGTGG + Intronic
1141151980 16:81570598-81570620 GCTGGGGCCTCCAGGAAGAAGGG - Intronic
1142125572 16:88408742-88408764 GCTGGGGTCTGCAGGGACGGGGG - Intergenic
1142263374 16:89052656-89052678 ACTGGGGACTCCGGAGGCACGGG - Intergenic
1142430417 16:90023242-90023264 CCTGGGCACTCCAAGGGCACTGG - Intronic
1143010289 17:3862288-3862310 TCAGGGGACACCAGGGACAGAGG + Intronic
1143118829 17:4595173-4595195 GCTGGCGGCTGCGGGGACACGGG - Exonic
1143393612 17:6575291-6575313 GCTGTGGGCTTCCGGGACACAGG + Intergenic
1144431717 17:15198622-15198644 TCTGGGAACTCCAGTGACACAGG + Intergenic
1145251847 17:21301087-21301109 GCTGGGGACACCTGGCATACTGG + Intronic
1145415363 17:22710063-22710085 GCTAGGGAGTCCAGGGCCACAGG - Intergenic
1145761784 17:27429641-27429663 CCTGAGGACTCCAGAGACCCAGG + Intergenic
1146486926 17:33250320-33250342 GCTGTGGCCTCCAGGGCCACGGG - Intronic
1147261860 17:39213472-39213494 GGTGGGGAGTGGAGGGACACTGG - Intronic
1147934688 17:44004922-44004944 TCTGGGGACTCGTGGGGCACCGG - Exonic
1148727631 17:49806187-49806209 GCTAGTGACACCAGGGTCACAGG + Intronic
1148807770 17:50272890-50272912 GCTGGGAACTCGAGAGAAACTGG + Intronic
1148885104 17:50766797-50766819 GCTGGGGAAGGCTGGGACACAGG - Intergenic
1150132597 17:62677375-62677397 CCTGGGCACTCCAGTGACGCCGG + Exonic
1151679476 17:75615922-75615944 GGTGGGGACTGCAGGGGCAGGGG + Intergenic
1151716884 17:75835561-75835583 GCTGGGGCCACCATGGACCCTGG + Intronic
1152026915 17:77815886-77815908 GCTGGAGACTGCAGGGCCAGAGG - Intergenic
1152227159 17:79097810-79097832 CCTGGGAACCCCAGCGACACCGG + Intronic
1152324370 17:79627117-79627139 GCTGGGGACTGCAGGAGCCCTGG + Intergenic
1152470247 17:80487163-80487185 GCTGGGCACACCAGGGAAGCAGG + Intergenic
1152938789 17:83154956-83154978 GCTGGGGACCCCACTGTCACTGG - Intergenic
1203162542 17_GL000205v2_random:64277-64299 ACCGGGGACGCCAGGGTCACCGG + Intergenic
1154353951 18:13610718-13610740 CCTCGGGGCTCCAGGGACAAGGG + Intronic
1155169179 18:23254626-23254648 GCTGGGAAGTCCAGGGTCAAGGG + Intronic
1157607575 18:48935524-48935546 ACTGGGGTCTCCAGGGGCCCAGG + Intronic
1157930141 18:51812556-51812578 CGTGGGGACTCCAGAAACACTGG + Intergenic
1157977439 18:52342021-52342043 GCTGCGGACTCCGGGGAGGCTGG - Intronic
1158896994 18:61923498-61923520 GCTGGGAAGTCCAGGGTCAAGGG + Intergenic
1160073489 18:75649350-75649372 TCTGGGCACAGCAGGGACACAGG - Intergenic
1160594169 18:79962906-79962928 GCTGGGGGCTGCAGGGACGAGGG - Intergenic
1160884842 19:1341069-1341091 GCAGGGGTTTCCAGAGACACAGG + Intergenic
1160987487 19:1845885-1845907 GCTGGAGCCTCCAGGGCCTCTGG - Intronic
1161439086 19:4280241-4280263 CCTGGGGACTCCAAGAACCCCGG + Exonic
1161687622 19:5711204-5711226 GCTGATGACACCAGGCACACAGG + Intronic
1161736309 19:5994329-5994351 TGAGGGGACTCCAGGGACGCTGG + Exonic
1162015749 19:7845726-7845748 TCTGGGGGCTTCAAGGACACTGG - Intronic
1163657826 19:18557955-18557977 GCTGGGGACTCCAGGGCCGCGGG + Intronic
1163710142 19:18841705-18841727 GCTGTGGGCTCCAGGGAGAGTGG + Intronic
1163862505 19:19749638-19749660 GCTGAGGACACCAGAGACCCAGG + Intergenic
1164826748 19:31289728-31289750 GCTAGGGGCTACAGGGACAGTGG - Intronic
1164884872 19:31769978-31770000 AATTGGGCCTCCAGGGACACAGG - Intergenic
1165438176 19:35808267-35808289 GCTGGTGACTCCAGGGAGTCTGG + Intronic
1165481244 19:36065786-36065808 GCTGGGCACACCAGCGGCACTGG + Intronic
1165708490 19:37992949-37992971 GCTGGGAGCACCAGGGACCCAGG - Intronic
1165907610 19:39203455-39203477 TCTGGGGACTCCAGGGTGAGGGG + Intronic
1166064239 19:40347742-40347764 GCTGGGAATTCCAGGGAAGCTGG - Intronic
1166315166 19:41985506-41985528 GCTGTGATCTCCAGGCACACAGG - Intronic
1166341498 19:42140189-42140211 GCTAGGGACTCCTGGGCCAAGGG - Intronic
1166753896 19:45179029-45179051 GCTTGGGACTCCGGGAACTCGGG + Intronic
1167077942 19:47260480-47260502 GCTGGGGGCTCCTGGGTCCCAGG - Intronic
1167696749 19:51019555-51019577 GGTGGGGACCCCCGGGCCACAGG - Intronic
1167779631 19:51590735-51590757 CCTGGGGAGTCCAGGTACAAGGG + Exonic
1168096715 19:54120020-54120042 GCTGGGGACACCGGAGCCACAGG + Intronic
1168259675 19:55186341-55186363 CCTGGGGGCTCCAGAGACCCTGG + Exonic
1168292030 19:55361695-55361717 GCTGGGGACTCCTGGGTCTGAGG - Intronic
925028800 2:633519-633541 GCGGGGGGTTTCAGGGACACTGG - Intergenic
926103307 2:10134405-10134427 GCTAGGGGCCCCAGTGACACGGG + Intergenic
926206096 2:10835272-10835294 GCTGGGGACTCCAGGGACACAGG + Intronic
927184744 2:20474049-20474071 GCTTGGGGATCCAGGGTCACGGG + Intergenic
927642943 2:24856982-24857004 TCTGGGGACTCTGGGGACACTGG - Intronic
933324209 2:80815257-80815279 GCTTGGAACTCCAGTGATACAGG + Intergenic
934278149 2:91589599-91589621 GCCGGGGACTCCGGGGACCTCGG - Intergenic
934743511 2:96743071-96743093 GCTGGGAGCTCCAGGACCACAGG + Intergenic
935026969 2:99286183-99286205 GCTGGGGACCCCAAGGTCAAGGG - Intronic
935725262 2:106018398-106018420 CGTGGTGACTCCAGGGACACAGG - Intergenic
936269326 2:111036682-111036704 TCGAGGGAGTCCAGGGACACTGG + Intronic
936526041 2:113242214-113242236 GCTGGGGACTGCAGGGGCTGGGG + Intronic
936920457 2:117683561-117683583 ACTGGGGACTCCAAGGACAGGGG + Intergenic
937262212 2:120593885-120593907 GCTGGGGACAGCAGCGACCCGGG - Intergenic
937270035 2:120643806-120643828 GGTGGGGACCCCAGGGATAAGGG - Intergenic
937527842 2:122792835-122792857 GGTGAGGACTCAAGGGACCCGGG + Intergenic
938694922 2:133826421-133826443 TCTGGGGACTCCCTGGCCACTGG - Intergenic
943344670 2:186724452-186724474 GCTGTGAGCTGCAGGGACACAGG - Intronic
943769735 2:191703599-191703621 GCAGGGCACCACAGGGACACAGG + Intergenic
945055910 2:205868849-205868871 ACAGAGGACACCAGGGACACAGG + Intergenic
945204357 2:207316212-207316234 GCTGGGGATGCTGGGGACACTGG - Intergenic
946233447 2:218307159-218307181 GCTGGGGACTGCTGCCACACGGG - Intronic
946241278 2:218357435-218357457 GGTGGGGACTGTGGGGACACTGG + Intronic
946242882 2:218367659-218367681 GCTGGGGGCTCCTGGGGCGCGGG + Intronic
946352128 2:219162055-219162077 GCTGGGGGATGCAGGGACAGAGG + Exonic
946371036 2:219281573-219281595 GCAGGGGACCCAGGGGACACGGG - Intronic
946883302 2:224197698-224197720 GTTTGGGACGCCTGGGACACTGG + Intergenic
947577458 2:231287175-231287197 GCTGTGGGCCCCAGGGTCACTGG - Intronic
947623011 2:231603174-231603196 CCTGGAGACTCCAGGCCCACAGG + Intergenic
947823481 2:233088766-233088788 GCTGGGGACACCAGGCACAGGGG + Intronic
948493158 2:238326909-238326931 GCTGGGGAGCCTAGGGACAGAGG - Intronic
948757296 2:240167099-240167121 GCTGTGCACTCCTGGGACAGCGG - Intergenic
948852253 2:240714180-240714202 GCTGGGGACTCCAGGGACCAGGG + Exonic
1168765897 20:381431-381453 GCTGGGGAAGCCAGGGACGGAGG + Intronic
1168876078 20:1173263-1173285 GCTTGGAACCCCAGGAACACTGG + Intronic
1171264826 20:23762750-23762772 ACTGGGGATTCCATGGACCCAGG + Intergenic
1171359411 20:24576678-24576700 GCTGGGGAGTCCAGGGACGGGGG - Intronic
1172903471 20:38351364-38351386 GCTGGGGAACTCAGGGACAGCGG + Intronic
1174035517 20:47666136-47666158 GGTGGGGACTTCAGTGGCACTGG - Intronic
1174035557 20:47666308-47666330 GGTGGGGACTTCAGTGGCACTGG - Exonic
1174459499 20:50672630-50672652 CCTGGGGGCAACAGGGACACAGG + Intronic
1175086604 20:56464738-56464760 GCTGGGAACTCCAAGGTCAAGGG + Intergenic
1175725060 20:61312538-61312560 GGTGGGGACTGCAGGGGCAAGGG - Intronic
1175828447 20:61949740-61949762 GCTGCGTCCTCCAGGGACGCGGG - Intergenic
1175991487 20:62791997-62792019 GCTGGGGACTGCATGGCCGCCGG - Intergenic
1176203734 20:63876910-63876932 CCTGGGTATTCCAGGGACCCGGG + Intronic
1177546207 21:22561949-22561971 CCTTGGGGCTCCAGGGCCACTGG + Intergenic
1179332339 21:40415956-40415978 GTTGGGAACTACAGGCACACAGG + Intronic
1179581984 21:42349906-42349928 CCAGGGGACCCCAGTGACACTGG + Exonic
1179791927 21:43760737-43760759 GCTGGGTCCTGCAGGGACAGGGG - Exonic
1180708297 22:17822964-17822986 GATGGGGACCCAGGGGACACTGG - Exonic
1180728587 22:17964253-17964275 GCTGTGGAATGCAGGGACAGAGG - Intronic
1180981440 22:19879865-19879887 GCTGGGGGCTTCTGGGCCACAGG + Intronic
1182280374 22:29214854-29214876 GCTGGGGACTCCAGGAGGATGGG - Intronic
1182298823 22:29326928-29326950 CCTGGGGACCCCAGGGTCAAGGG - Intergenic
1182418789 22:30238550-30238572 GCTGGGGACGCCAGGGCCTAGGG - Intergenic
1184130855 22:42515638-42515660 GGTGTGGGCTCCAGGGCCACTGG + Intronic
1184141031 22:42577468-42577490 GGTGTGGGCTCCAGGGCCACTGG + Intergenic
1184889218 22:47369247-47369269 GCTGGGGTCTGCAGGGCTACGGG + Intergenic
1185322214 22:50206839-50206861 GCAGGGGGCTCCAGGGCCACGGG + Intronic
950260820 3:11542569-11542591 ACTGGTGTCTCCAGGGACCCAGG - Intronic
950584671 3:13883731-13883753 AATGGGGAGTCTAGGGACACAGG + Intergenic
952240678 3:31528922-31528944 GCTTGGGACTCCATGGCTACGGG - Intergenic
952742576 3:36748607-36748629 CCTGGGGACTCTGAGGACACTGG + Intergenic
953454111 3:43028787-43028809 GCCAGGGCCTCCAGGGCCACAGG - Intronic
954133001 3:48569609-48569631 CCTGGGGCCTCCAGGCCCACGGG - Exonic
954299367 3:49691226-49691248 GCTGAGAAATCCAGGGTCACAGG + Exonic
954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG + Intronic
954426362 3:50445293-50445315 GCTGGGCTCTCCTGGGACCCTGG - Intronic
954463972 3:50643901-50643923 CCTGGCTACTCCTGGGACACAGG + Intronic
954623038 3:52006497-52006519 AGTGGGGACTCCAGGGCCTCAGG + Intergenic
954796137 3:53162013-53162035 GGTCGGGCCTCCAGGGACCCAGG - Intronic
954928627 3:54260365-54260387 GCTGGGAAGTCCAGGGTCAAAGG + Intronic
959617132 3:108361068-108361090 AATGGGGACTCCAGAGACCCTGG - Intronic
960088345 3:113614222-113614244 GCAGGAGACTGCAGGGACAAAGG - Intronic
960862874 3:122169218-122169240 CCAGTGGACTTCAGGGACACAGG - Intergenic
961033307 3:123625028-123625050 GCTGGATACTCAAGGGACCCAGG - Intronic
961890032 3:130123070-130123092 GCTGGGGAAGCCAGGGTCTCTGG + Intergenic
962705277 3:138037513-138037535 GCTGGGAAGTCCAGGGTCAAGGG + Intergenic
962713132 3:138103958-138103980 GCTGGGGACTGCATGGGCAGAGG + Exonic
962748036 3:138412018-138412040 GCTGGGGACTTGGGGGTCACAGG + Intergenic
962760811 3:138511826-138511848 GCTGGGGACTCATAGGAAACTGG + Intronic
962876513 3:139539577-139539599 GCTGGAGACTGCCGGGACAGCGG + Exonic
966252537 3:177882589-177882611 GATGGGGACACCTGGAACACAGG + Intergenic
968529705 4:1084941-1084963 GCTGGTGACGCCAGTCACACTGG - Intronic
968878230 4:3285541-3285563 GCTGAGGAGGCCACGGACACAGG - Intergenic
968948078 4:3676016-3676038 GCTGGGGACTCCGAGGACAATGG + Intergenic
968975603 4:3820735-3820757 GCTCAGGGCCCCAGGGACACAGG + Intergenic
968986457 4:3877942-3877964 GCTGAGCACTTCAGGGACAAAGG + Intergenic
969212805 4:5700689-5700711 TCTGGGGACTCCAGCCACTCTGG + Intronic
969450990 4:7273307-7273329 GCTGGGCACACCAGGGAAAGAGG - Intronic
969688466 4:8690025-8690047 CCTGGGGACACCAGGCAAACAGG + Intergenic
970201287 4:13609877-13609899 GCTTGGGACCCAAGGGACTCAGG + Intronic
970331895 4:14995150-14995172 AGTTGGGACTCCAGGAACACAGG - Intergenic
973583651 4:52370205-52370227 GCTGGGAAACCCAGGGATACTGG - Intergenic
974647569 4:64714880-64714902 GCTGGGGTCTCCAAGCACAATGG + Intergenic
978990625 4:115077714-115077736 GCTGGGAATTCCAGAGACTCAGG - Intronic
985836650 5:2276934-2276956 GCTGGGGACTCCCAGGGCACAGG - Intergenic
985972982 5:3392416-3392438 GCTGGGGAGGCCAGGGTGACTGG + Intergenic
985972994 5:3392443-3392465 GCTGGGGAGGCCAGGGAGGCTGG + Intergenic
986387052 5:7244821-7244843 GCTGGGGGATCCAGGGACGGAGG + Intergenic
986577202 5:9224821-9224843 GCTGGGGACTGTAGGGACAGCGG + Exonic
986587596 5:9335068-9335090 GATGGAGACTCTAGGGACGCTGG + Intronic
990169322 5:53030264-53030286 GCTGGTAAGACCAGGGACACTGG + Intronic
991155691 5:63432273-63432295 GCTGGGGATGCAGGGGACACTGG - Intergenic
995416843 5:111922246-111922268 ACTGGGGTCTCCAGGCACAATGG + Intronic
995977277 5:118054592-118054614 GCTGGGGACTCCTGGGCCTTCGG + Intergenic
998170822 5:139871090-139871112 GCTAGGGGCTGAAGGGACACAGG + Intronic
998891267 5:146748480-146748502 GATGGGGACTGGAGGGAAACTGG - Intronic
1000174960 5:158743003-158743025 GCTGGGGACTCACAGGGCACTGG - Intronic
1001342694 5:170862161-170862183 GGCTGGGACTCCGGGGACACCGG - Intronic
1001478440 5:172067980-172068002 GTTGGGGAATCCATGGTCACTGG - Intronic
1001630120 5:173168699-173168721 GTTGGGGACTGAAGGGACATTGG - Intergenic
1001990293 5:176110970-176110992 GATGGGTACTTCAGGGGCACAGG - Intronic
1002226579 5:177727170-177727192 GATGGGTACTTCAGGGGCACAGG + Intronic
1002267265 5:178044043-178044065 GATGGGTACTTCAGGGGCACAGG - Intronic
1002305347 5:178279676-178279698 GCTGGGTGCTCCAGGGACACAGG + Intronic
1002859376 6:1066538-1066560 GCTGGGGAGTGGAGGGACGCAGG + Intergenic
1003513249 6:6799127-6799149 GCTGGGAAGTCCAGGGTCAAGGG + Intergenic
1005813303 6:29531985-29532007 CCTGAGGACTGCAGGGACCCAGG + Intergenic
1006406730 6:33849865-33849887 CCTGGAGACTCCAGAGCCACAGG + Intergenic
1006615173 6:35321274-35321296 GCTGGGGATCCCAGGGCAACAGG + Exonic
1006680746 6:35795415-35795437 GCTGGGGTCTCCAGGGCCCACGG - Intronic
1009318394 6:62253720-62253742 AATATGGACTCCAGGGACACAGG - Intronic
1011743813 6:90389397-90389419 GCTGGGGCCTTCAGGGAAACTGG + Intergenic
1013663957 6:112327438-112327460 TCTGGGGACTACAAAGACACTGG - Intergenic
1016366019 6:143319460-143319482 TATGGGGACTCCAGGGAGAGTGG + Intronic
1017317786 6:153052269-153052291 GCTGTGCACTCCAGGCCCACTGG - Intronic
1017768288 6:157624913-157624935 GCTGGGAAGTCCACGGCCACGGG + Intronic
1019023831 6:168941646-168941668 GATGGGAACACCAGGTACACGGG + Intergenic
1019023845 6:168941705-168941727 GGTGGGAACACCAGGTACACGGG + Intergenic
1019023859 6:168941764-168941786 GGTGGGAACACCAGGTACACGGG + Intergenic
1019023886 6:168941886-168941908 GGTGGGAACACCAGGTACACGGG + Intergenic
1019023902 6:168941945-168941967 GGTGGGAACACCAGGTACACGGG + Intergenic
1019023917 6:168942004-168942026 GGTGGGAACACCAGGTACACGGG + Intergenic
1019023932 6:168942063-168942085 GGTGGGAACACCAGGTACACGGG + Intergenic
1019023946 6:168942122-168942144 GGTGGGAACACCAGGTACACGGG + Intergenic
1019023962 6:168942181-168942203 GGTGGGAACACCAGGTACACGGG + Intergenic
1019023976 6:168942240-168942262 GGTGGGAACACCAGGTACACGGG + Intergenic
1019023990 6:168942299-168942321 GGTGGGAACACCAGGTACACGGG + Intergenic
1019024002 6:168942358-168942380 GGTGGGAACACCAGGTACACGGG + Intergenic
1019262301 7:88380-88402 GCTGGAGGGTCCAGGAACACTGG - Intergenic
1019648691 7:2144620-2144642 GCTGGGGACGCCAGGCAGAGGGG + Intronic
1019703109 7:2483833-2483855 GCTGGAGTCTCCAGGGCCGCAGG + Intergenic
1019736280 7:2651265-2651287 CCTGTGGCCTCCAGGGACAAAGG - Intronic
1020876289 7:13698910-13698932 TCTGGGGACTCCAGGGAGGGAGG + Intergenic
1022595713 7:31711888-31711910 GCTTTGGATTCCAGTGACACTGG + Intergenic
1023843334 7:44108474-44108496 CCTGAGGGCTCCAGGGACGCAGG - Intronic
1025826770 7:65017143-65017165 GGTGGGGAGCACAGGGACACAGG - Intergenic
1025914321 7:65853592-65853614 GGTGGGGAGCACAGGGACACAGG - Intergenic
1027001633 7:74658156-74658178 GCCGGGGCCTGCAGGGACAGGGG + Intronic
1029658898 7:101945892-101945914 GCCGGGGACACCAGAGGCACAGG + Intronic
1029981919 7:104886914-104886936 CCTGGGGACCCCGGGGACCCCGG - Intronic
1030102900 7:105962049-105962071 GCAGGGGACACAGGGGACACTGG + Intronic
1030409721 7:109160788-109160810 GCAGGGCACTGCAGGGGCACAGG - Intergenic
1032174146 7:129610455-129610477 CATGGGGACTCCAGAGACAGAGG + Intergenic
1034488545 7:151381047-151381069 GCTTGGGATTCCAGGAACCCAGG - Intronic
1034959966 7:155358951-155358973 GCCGGGGACTCAGGGGGCACAGG + Intronic
1035203132 7:157279339-157279361 TCTGGGGACTCCAGGGCCGCGGG + Intergenic
1035313992 7:157986983-157987005 GCGGGGTTCTCCTGGGACACAGG - Intronic
1036242638 8:7092595-7092617 GCTGGGGGCCCCCAGGACACGGG - Intergenic
1036492642 8:9242174-9242196 ACTGGGGAAGCCAGGAACACAGG + Intergenic
1036594610 8:10200571-10200593 ACTGGGAATTCCTGGGACACAGG + Intronic
1036852807 8:12216187-12216209 GCTGGGGAAGCCAGGGTCTCTGG + Intergenic
1036874178 8:12458709-12458731 GCTGGGGAAGCCAGGGTCTCTGG + Intergenic
1037588772 8:20295866-20295888 CCTGGTGACCCCAGTGACACTGG - Intronic
1038338104 8:26661702-26661724 TCTTGGGACCCCAGGGACCCTGG + Intergenic
1038578608 8:28727300-28727322 ACTAAGGACTCCAGGAACACAGG - Intronic
1039119301 8:34128226-34128248 GCTGAGGACTCCAAGGAAAAGGG - Intergenic
1039294418 8:36133869-36133891 ATTGCAGACTCCAGGGACACAGG - Intergenic
1043982656 8:86659064-86659086 GCTGGGGGCTCCAGGAGCAGGGG + Intronic
1044705464 8:95004270-95004292 GCTATGGGCTCCAGGAACACTGG + Intronic
1044733770 8:95256385-95256407 GCTAGGTACTGCAGGCACACTGG - Intronic
1044911100 8:97059680-97059702 ACTGGGAATTCCAGGGTCACTGG + Intronic
1047124825 8:121948452-121948474 GCTGAGGAGTGCAGGCACACAGG + Intergenic
1048554053 8:135457822-135457844 GATGTGGACTCCAGGCGCACGGG - Exonic
1049255806 8:141613113-141613135 GCTGGGGACCCCTGGGAGAAGGG + Intergenic
1049706673 8:144046291-144046313 GCTGAGGCCTCCAGGGACTGAGG - Intronic
1049741578 8:144243479-144243501 GCTGGGTCCTGCAGGGACGCAGG - Exonic
1049757383 8:144316754-144316776 GCTGGGGGCTTCAGGGTCCCTGG + Intronic
1050785054 9:9390145-9390167 GTTGGGGATTCCTGGGACAGCGG + Intronic
1052835390 9:33246362-33246384 ACCGGGGGCTCCAGAGACACAGG + Intronic
1052860876 9:33437049-33437071 CCTGGGGCCACCAGGGAGACTGG - Intergenic
1053273354 9:36765326-36765348 GCTGGGGACTCCAGGTTTTCTGG + Intergenic
1053479061 9:38402647-38402669 CCTGGAGGCTCCAGGAACACAGG + Intergenic
1056800539 9:89687692-89687714 GCTGGGAAGTCCAGGGTCAAGGG + Intergenic
1057144298 9:92748055-92748077 GCAGGGAACTCCAGGGGTACAGG + Intronic
1057704113 9:97385781-97385803 GCTGGGCCCCCCAGGGACCCTGG - Intergenic
1059225672 9:112670840-112670862 GGTGGGGACGCCAGGCACCCAGG - Intergenic
1059420285 9:114186370-114186392 ACTGGGGCTACCAGGGACACAGG + Intronic
1059436699 9:114281495-114281517 CCTGGGGACTCCAAGGAAAGTGG + Intronic
1060383633 9:123201599-123201621 GCTGTGGTCTGCAGGGATACTGG + Intronic
1060509335 9:124220774-124220796 CCTGGTGACTCCAGGGCCCCAGG - Intergenic
1061052230 9:128203670-128203692 GGCGGGGACTCCAGGGATCCCGG - Intronic
1061300424 9:129701531-129701553 GCAGGGGACACCAGTCACACTGG + Intronic
1061503059 9:131014592-131014614 GCTGGGCACTACTGGGGCACAGG - Intronic
1062196659 9:135278046-135278068 GCTGGGGACCCAAGGGGAACAGG + Intergenic
1062268913 9:135699906-135699928 CCTGGGGGACCCAGGGACACAGG + Intergenic
1062270148 9:135704571-135704593 TCTGGGGCCACCAGGGCCACTGG - Intronic
1062539768 9:137036366-137036388 CCTGGGGCCCCCAGGGACTCTGG - Exonic
1062562080 9:137146197-137146219 GCTGGGGCCTCCAGGGAGCGAGG - Intronic
1062585456 9:137247487-137247509 GCTGGGGAGCCCTGGGACAGGGG - Intronic
1187442479 X:19332672-19332694 GCTGGGAACTCCTGGGGCCCTGG - Intergenic
1189469747 X:41304445-41304467 GCCGGGGACTCCAGCACCACTGG + Intergenic
1192576533 X:72247357-72247379 TCTGGAGAGTCCAGCGACACTGG - Intronic
1193198192 X:78658065-78658087 GCTGGAGGCGCCAGGGACTCTGG + Exonic
1196747045 X:119080359-119080381 TCAGGGGCCCCCAGGGACACAGG + Exonic
1197754169 X:129983239-129983261 GCGGGGGTCTCCATGGAAACGGG + Intronic
1199713345 X:150488090-150488112 GCTGTAGATGCCAGGGACACTGG - Intronic
1200093253 X:153645439-153645461 GCCGGGGACTCCCAGGACCCTGG - Intronic
1200238223 X:154479339-154479361 ACTGGGGCCTCCAGGGACAAGGG - Intergenic
1202202368 Y:22367135-22367157 GCTGAGGAGTGCAGGCACACAGG - Intronic
1202604639 Y:26628338-26628360 GCTGGGGCCTGCAGGGCCGCGGG + Intergenic