ID: 926206756

View in Genome Browser
Species Human (GRCh38)
Location 2:10839464-10839486
Sequence GAGGTGGGGTCTTTGAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 1, 1: 2, 2: 13, 3: 87, 4: 415}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926206756_926206760 -5 Left 926206756 2:10839464-10839486 CCACTTCTCAAAGACCCCACCTC 0: 1
1: 2
2: 13
3: 87
4: 415
Right 926206760 2:10839482-10839504 ACCTCCCAATACCATCACACTGG 0: 8
1: 130
2: 651
3: 1628
4: 2975
926206756_926206767 16 Left 926206756 2:10839464-10839486 CCACTTCTCAAAGACCCCACCTC 0: 1
1: 2
2: 13
3: 87
4: 415
Right 926206767 2:10839503-10839525 GGGCATTAGGATCTAATGCATGG 0: 1
1: 0
2: 0
3: 3
4: 83
926206756_926206762 -4 Left 926206756 2:10839464-10839486 CCACTTCTCAAAGACCCCACCTC 0: 1
1: 2
2: 13
3: 87
4: 415
Right 926206762 2:10839483-10839505 CCTCCCAATACCATCACACTGGG 0: 8
1: 117
2: 574
3: 1370
4: 2604
926206756_926206769 24 Left 926206756 2:10839464-10839486 CCACTTCTCAAAGACCCCACCTC 0: 1
1: 2
2: 13
3: 87
4: 415
Right 926206769 2:10839511-10839533 GGATCTAATGCATGGATTTTGGG 0: 1
1: 0
2: 1
3: 19
4: 178
926206756_926206768 23 Left 926206756 2:10839464-10839486 CCACTTCTCAAAGACCCCACCTC 0: 1
1: 2
2: 13
3: 87
4: 415
Right 926206768 2:10839510-10839532 AGGATCTAATGCATGGATTTTGG 0: 1
1: 0
2: 1
3: 23
4: 219
926206756_926206765 3 Left 926206756 2:10839464-10839486 CCACTTCTCAAAGACCCCACCTC 0: 1
1: 2
2: 13
3: 87
4: 415
Right 926206765 2:10839490-10839512 ATACCATCACACTGGGCATTAGG 0: 5
1: 63
2: 352
3: 942
4: 1860
926206756_926206770 25 Left 926206756 2:10839464-10839486 CCACTTCTCAAAGACCCCACCTC 0: 1
1: 2
2: 13
3: 87
4: 415
Right 926206770 2:10839512-10839534 GATCTAATGCATGGATTTTGGGG 0: 1
1: 0
2: 1
3: 18
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926206756 Original CRISPR GAGGTGGGGTCTTTGAGAAG TGG (reversed) Intergenic
902162056 1:14538607-14538629 GAGGAGGGGTCTTTAAGAGGTGG - Intergenic
902670258 1:17968214-17968236 GAGGTGGGATTTCTGGGAAGAGG + Intergenic
904198701 1:28805140-28805162 GAGCTGGATTCTGTGAGAAGGGG - Intergenic
904688118 1:32275038-32275060 GAGATCTGGGCTTTGAGAAGGGG + Exonic
904688422 1:32276250-32276272 TAGATGGGGGCTTGGAGAAGTGG + Intronic
905237318 1:36559071-36559093 GAGGTGGGCTCTTTGCTAAGTGG - Intergenic
905435210 1:37951103-37951125 GAGGTGGGGGCTCTGAGGAATGG + Intergenic
905651617 1:39660741-39660763 GAGGTGGGGACATAGAGAATGGG + Intronic
906560264 1:46751461-46751483 AAGGTGGGGCCTTTGGGGAGGGG - Intergenic
907246105 1:53110099-53110121 GAGGTGGGTTCTGGGAGATGAGG - Intronic
907733358 1:57088601-57088623 GAGGTGGGCACTGGGAGAAGGGG - Intronic
907993508 1:59606302-59606324 GAGGTGGCTTCTTAGAGAAAGGG - Intronic
908727162 1:67188847-67188869 GAGGTGGGGCCTTTAGAAAGTGG - Intronic
909187244 1:72503332-72503354 GAGATGGGGCCTTTAGGAAGTGG - Intergenic
909944553 1:81649131-81649153 GAGGTAGGGTATTCCAGAAGAGG - Intronic
910017636 1:82547116-82547138 GGGGTGTGGTCATTGAGATGAGG - Intergenic
910892567 1:92032887-92032909 GAGGTGGGACCTTTAAGAGGTGG - Intronic
911669366 1:100591159-100591181 GAGGTGGGGCCTTTATGAAGTGG - Intergenic
912153223 1:106883854-106883876 GAGGTGGTGTCATAGAGATGAGG - Intergenic
912963859 1:114219772-114219794 GAGCTGGGGTCCTTGTGCAGGGG + Intergenic
916158170 1:161879021-161879043 GAAGTCGAGTCCTTGAGAAGGGG + Intronic
916395286 1:164380286-164380308 GAGGTCGGGTCTATGAGGACAGG + Intergenic
916697627 1:167255728-167255750 GAGGTGGAATCTTTGAGAATCGG + Intronic
917789019 1:178487593-178487615 GTGGTGGGGACGCTGAGAAGGGG - Intergenic
918297094 1:183167219-183167241 GAGGTGGGTGCTTGGAGCAGGGG + Intergenic
918732516 1:188015821-188015843 GAGGTGGAGACTTTGGGAGGTGG - Intergenic
918738874 1:188102404-188102426 GAGGTGGAGTCTTTAAGAGGTGG - Intergenic
919193382 1:194252313-194252335 GAGGTGGAGTTTCTGAGAGGTGG + Intergenic
919410611 1:197237460-197237482 GAGGTGGGGCCCTTGTGAATGGG - Intergenic
919743914 1:200996729-200996751 GAGCTGGGGCCTGTGGGAAGGGG + Intronic
920261141 1:204688862-204688884 GTGGTGGGGGCTGTGAGGAGAGG + Intergenic
920601203 1:207325838-207325860 GATGAAGGGTCTTTGAGGAGAGG - Intronic
921727334 1:218538363-218538385 GAGATGGGGCCTTTGGGAGGTGG + Intergenic
922475704 1:225905697-225905719 GATGTGGGGTCTTTGGCAGGAGG + Intronic
922708480 1:227806792-227806814 GAGGTGGGGCCTTTGGGAGATGG + Intergenic
922743469 1:228029793-228029815 AAGGTGGGGCCTTTGGGAGGTGG + Intronic
922874769 1:228931845-228931867 GAGGAGTGGTCTGTGTGAAGAGG - Intergenic
922972657 1:229755944-229755966 GAGGTGGGACCTTTGGGAGGTGG - Intergenic
923036546 1:230288546-230288568 GAGGTGGGGTCTTAGGGAGGTGG + Intergenic
923361807 1:233219098-233219120 GAGGTGGGGTCATCCAGAGGTGG + Intronic
923623725 1:235597452-235597474 GAGGTGGGACCTCTGAGAGGTGG + Intronic
1062845769 10:703786-703808 TTGGTGGGGTTTCTGAGAAGGGG - Intergenic
1063541253 10:6936503-6936525 GAGGTAGGGCCTTTAAGAGGTGG + Intergenic
1063544209 10:6964107-6964129 GAGGTGGGGCCTCTGGGATGTGG + Intergenic
1064388330 10:14919656-14919678 GAGCTTGGGTCTGGGAGAAGTGG - Intronic
1065783888 10:29195121-29195143 GAGGTGGGACCTTTAAGAAGTGG + Intergenic
1066285777 10:33964673-33964695 GCTGTGGGGTCTTGGATAAGTGG - Intergenic
1066533960 10:36370283-36370305 GAGGTGGGGCCTTTAGCAAGTGG + Intergenic
1067116214 10:43437217-43437239 GAGGTGCGGGCTGTGAGAGGGGG + Exonic
1067826078 10:49574013-49574035 GAGGAGTGGTCTTTGAGGTGAGG + Intergenic
1067913532 10:50371939-50371961 GAGGTGTGACCTTTAAGAAGTGG - Intronic
1068124632 10:52824069-52824091 GAGGTGGGATCTTTAAGAGGTGG - Intergenic
1069030153 10:63587739-63587761 GAGGTGAGGCTTTTGAGAAGTGG - Intronic
1069984290 10:72273302-72273324 CAGGTGGGGCCTTGGGGAAGGGG + Intergenic
1070841018 10:79487938-79487960 GAGGTGGTGTGTTTCAGAAACGG - Intergenic
1070932042 10:80267862-80267884 GAGGTGGGACCTTTCAGAGGCGG + Intergenic
1071177247 10:82940813-82940835 GAGGTGGGGCTTTTGGGAAGTGG - Intronic
1071697164 10:87888360-87888382 GAGGTGGAACCTTTCAGAAGTGG + Intronic
1072124125 10:92430473-92430495 GAGGTTGGGAGTTTGAGAACAGG + Intergenic
1072642351 10:97221507-97221529 GAGGTAGGGTCTTTGGTAGGAGG + Intronic
1073083928 10:100876575-100876597 GGGGTGGGGGCATGGAGAAGGGG - Intergenic
1074289915 10:112130697-112130719 GAAGTGGGGCCTTTGAAATGTGG + Intergenic
1074783572 10:116819458-116819480 AAGGTGGAGTCTTTGTGAATGGG + Intergenic
1075048443 10:119164752-119164774 TAGGTGGGGAAATTGAGAAGGGG - Intronic
1075161820 10:120031039-120031061 GAAGTAGGGCCTTTGGGAAGTGG + Intergenic
1075635915 10:124030175-124030197 CAGCTCGGGTCTTTGTGAAGGGG - Intronic
1075645496 10:124093423-124093445 GAGGTGGGGTCGGCGAGGAGCGG - Intronic
1075932257 10:126309247-126309269 CAGCTGGGGTTGTTGAGAAGGGG + Intronic
1075941763 10:126396050-126396072 GAAATGGTGCCTTTGAGAAGTGG + Intergenic
1076329455 10:129653980-129654002 GAGGTGGGGTCTCCAAGCAGGGG - Intronic
1077146379 11:1048078-1048100 GAGGTGGGGACTTGGGGAGGTGG + Intergenic
1077290028 11:1784823-1784845 GAGAAGGGGTCTGGGAGAAGCGG - Intergenic
1077353985 11:2106294-2106316 GATGTGGCGTCTCTGAGGAGTGG - Intergenic
1077447779 11:2607424-2607446 GAGGTGAGGCCTTTGGGAAGTGG + Intronic
1077805465 11:5587643-5587665 GAGGTGGAGCCTTTGGGAAGTGG - Intronic
1077978855 11:7278319-7278341 GAGGTGGGGGCCTTTAAAAGAGG - Intronic
1078587213 11:12602640-12602662 GAGGTAGCGTCTTGGAGAAAAGG - Intergenic
1079413055 11:20207940-20207962 GCGGTGGGGTGCTTTAGAAGTGG + Intergenic
1080624509 11:34016344-34016366 GAACTGGGGTCTATGAGAATGGG + Intergenic
1084568662 11:69945982-69946004 GAGCTGAGGACTTAGAGAAGAGG + Intergenic
1085540819 11:77268283-77268305 GAGGTGCGGTTTGTGAGATGTGG + Intronic
1086084325 11:82939301-82939323 GAGATGGGGTTTTGGAGATGGGG - Intronic
1086103809 11:83128755-83128777 GAGCTTGGGTCTTTGGGATGTGG - Intergenic
1086235745 11:84627931-84627953 GAGGTGGGGCCTGTGGGAGGTGG - Intronic
1086630609 11:89014526-89014548 GAAGTGGGGGCTCTGGGAAGTGG + Intronic
1088649554 11:111945455-111945477 GAGGAGGGTTCTTAAAGAAGAGG + Intronic
1088909442 11:114179862-114179884 GAGGGAGGTTCTTTGACAAGGGG + Intronic
1089508627 11:118981306-118981328 GAGGTGGGGTCTCTAAGGATGGG + Intergenic
1089917244 11:122170043-122170065 GAGGTAGGGCCTTTAAGAGGTGG + Intergenic
1090090448 11:123692359-123692381 GAGATGGGGCCTTTAAGAGGTGG - Intergenic
1090149657 11:124369462-124369484 GAGGATGGGTCTTTGATGAGAGG - Intergenic
1090777212 11:129975948-129975970 GAGGTGGGGTCATGGGGAAGAGG + Intronic
1091809461 12:3383489-3383511 GAGGTGGGGCCTCTGGGAGGCGG + Intronic
1091996756 12:4999988-5000010 TAGGTGGGGTCTTTGTGGATGGG + Intergenic
1092216693 12:6688837-6688859 AAGGAAGGGTCTTTGAGAAAGGG - Intronic
1092395076 12:8118807-8118829 GAGGTGGGCCCTTTTAGAGGTGG + Intergenic
1092794794 12:12099579-12099601 GAGGTGTGGTCCCTGAGAAAAGG - Exonic
1092826471 12:12404526-12404548 GAGGTGGGGCTTTTAAGAGGTGG - Intronic
1092847822 12:12600458-12600480 GCTGTGAGGTCTTTGAGATGAGG - Intergenic
1094408505 12:30145193-30145215 GAGAAGGTGCCTTTGAGAAGAGG + Intergenic
1095169432 12:39016743-39016765 GAGATGGGGCCTTTGGGAGGTGG + Intergenic
1096102795 12:48979677-48979699 GAGGTGGGGCCCTGGAGCAGTGG - Exonic
1096978319 12:55713291-55713313 GGGGAGGAGTGTTTGAGAAGAGG - Intronic
1097538954 12:60912019-60912041 GAAGTTGGGACTTTGAGAATGGG + Intergenic
1097779210 12:63684643-63684665 GATGTGGGGTATTGGAGTAGGGG - Intergenic
1097796772 12:63871009-63871031 GAGGTGGGGCCTGTGTCAAGTGG - Intronic
1098950844 12:76639168-76639190 GAGGTGGGATCTTTGGGAGGTGG - Intergenic
1100602405 12:96123041-96123063 GCAGTGGGGGCTTGGAGAAGTGG - Intergenic
1101049142 12:100842836-100842858 GAGGTGGGGCCTTTAGGAGGTGG - Intronic
1104523548 12:129497395-129497417 GAGGTGGAGTCGTGGAGCAGGGG - Intronic
1104656657 12:130578668-130578690 GAGGGGAAGTCTCTGAGAAGGGG - Intronic
1104993362 12:132639426-132639448 AAGGTGGGGACAGTGAGAAGGGG - Intronic
1105013926 12:132774418-132774440 GACGTGGGGCCTCTGGGAAGGGG + Intronic
1105340381 13:19517632-19517654 GAGGTGAGGTCTCTGAGCAAGGG - Intronic
1106550277 13:30765146-30765168 GTGGTAGGGCCTTTGGGAAGAGG - Intergenic
1106757448 13:32837136-32837158 GAGGTGGGGCCTTTGGGAGATGG - Intergenic
1107112715 13:36715260-36715282 GATGTGAGGTCCTAGAGAAGAGG + Intergenic
1107474036 13:40717672-40717694 GAGGTGGGGCCTTTAAAAGGTGG + Intergenic
1107681388 13:42855444-42855466 GTGGTAGGGTCTTTGGGACGGGG + Intergenic
1107752966 13:43588918-43588940 GAGGTGGGGTGAGGGAGAAGTGG + Intronic
1107908500 13:45083665-45083687 GGGGTAAGGTCTCTGAGAAGAGG - Intergenic
1108091844 13:46857519-46857541 GAGGTGAGTCCTTTGAGAGGTGG - Intronic
1108499440 13:51056221-51056243 AGGGTGGGGTCTCTAAGAAGAGG - Intergenic
1108506878 13:51120268-51120290 GAGATGGGGACATTTAGAAGTGG + Intergenic
1108554193 13:51577139-51577161 GAGGTGGGGTACTTTAGAGGTGG + Intergenic
1108564950 13:51687270-51687292 GAGGAGGGGTTTTTCAGCAGGGG - Intronic
1110892850 13:80712000-80712022 GAGGTGGGGTATCTGAGATGTGG - Intergenic
1111866417 13:93774246-93774268 GAGGTTAGGTCTTCAAGAAGAGG + Intronic
1113181443 13:107632453-107632475 GAGGTGGGTTCCTTAGGAAGGGG - Intronic
1113672758 13:112186089-112186111 GAGGTGGGGCCTTTAGGAGGTGG + Intergenic
1113737211 13:112687617-112687639 GAGGTGGGGGCCTTGGGAGGTGG - Intergenic
1113967667 13:114163610-114163632 GGGGAGAGGACTTTGAGAAGAGG - Intergenic
1116050836 14:39801240-39801262 GAGGTGGGCTCTTGCAGGAGAGG + Intergenic
1116054056 14:39840676-39840698 GAGGTGGGGCTTTTGGGAATGGG + Intergenic
1116077671 14:40132471-40132493 GAGGTGTGCTCCTTGAGAATAGG - Intergenic
1116386762 14:44340407-44340429 GAGGCGGAGTCTTTGGGAGGTGG - Intergenic
1117456806 14:55905951-55905973 GAGGAGGGGCCTTGGAGGAGGGG - Intergenic
1118763544 14:68895193-68895215 GAGGTGGGGACTTTGAGTCCTGG + Intronic
1119095237 14:71823913-71823935 GAGGTGGGGAGTTTGAGACCAGG + Intergenic
1119642980 14:76328720-76328742 GAGGAGGCTTCTCTGAGAAGGGG - Intronic
1122189003 14:100025154-100025176 GAGGTGGGTGGTTTGAGAACAGG - Intronic
1122586121 14:102807636-102807658 GAGTTGGGGTTTTTGTGTAGGGG + Intronic
1124031390 15:26015656-26015678 GAGGTGCGGTCCTTGAGCAAGGG - Intergenic
1124137935 15:27051483-27051505 GAGGTGTGTCCTTTGGGAAGGGG + Intronic
1124243871 15:28053677-28053699 GAGGTGGGGCCTCTGAGGTGAGG - Intronic
1125154297 15:36568764-36568786 GAGGTGGGACCTTTGGGAGGTGG + Intergenic
1125330485 15:38577142-38577164 GAGGAGGTGTTTTAGAGAAGAGG + Intergenic
1125554606 15:40573767-40573789 TAGATGGGGTCGTTGAGAATGGG - Exonic
1126281950 15:46963758-46963780 GAGGTGGGGGATATGAGAATAGG - Intergenic
1126337481 15:47602928-47602950 GAGGTGAAATCTTTGAGAAGTGG - Intronic
1127171684 15:56309897-56309919 GAGGTGGGCACTGGGAGAAGGGG + Intronic
1127424213 15:58839180-58839202 GAGCTGTGGGCTTTGACAAGAGG + Intronic
1127503436 15:59575913-59575935 GAGGTTGGGCCTTTGTGAGGTGG - Intergenic
1128550706 15:68596364-68596386 GGGGTGGGGGTTGTGAGAAGGGG + Intronic
1128559139 15:68653132-68653154 GGGGTGGGGTCCTGGAGCAGCGG + Intronic
1129046306 15:72737494-72737516 GAGATGGGGGCTTTGTGAACTGG - Exonic
1129068668 15:72932765-72932787 GGGGTGGGGGATTTGAGGAGAGG - Intergenic
1129254163 15:74324831-74324853 GAGCTGGGGTCTTTGGGTGGAGG - Intronic
1129295085 15:74595844-74595866 GACGTGGGCTCTGTGAGATGAGG - Exonic
1129882882 15:79018750-79018772 GTGCTGGAGTCTCTGAGAAGTGG + Intronic
1130221673 15:82024730-82024752 GAGCTGAGCTCTTAGAGAAGTGG - Intergenic
1130415999 15:83695263-83695285 GTGGTGGGGTCTTTGAGAAGGGG + Intronic
1131095445 15:89651816-89651838 GAAGTGAGGGCTTTGGGAAGTGG + Intronic
1132279522 15:100601460-100601482 GAGGTAGAGTCTTTAAGAGGTGG - Intronic
1133473725 16:6099810-6099832 AGGGTGAGGTCTTTGAGAAAAGG - Intronic
1133774354 16:8885760-8885782 GAGATGGGGTCTTTGGGGAAGGG - Intergenic
1133847530 16:9469233-9469255 GAAGTGGGTTCTTTATGAAGAGG + Intergenic
1134275755 16:12774678-12774700 GAGGTGGGGCTTTTAAGAGGTGG + Intronic
1134384278 16:13757426-13757448 GAGGTGGGATCTTTAAGAGGTGG + Intergenic
1135044961 16:19147669-19147691 GGGGTGGTGTCATTGGGAAGGGG + Intronic
1135513232 16:23106760-23106782 GGGATGGGGGCTTTGAGAATTGG - Intronic
1135680341 16:24451049-24451071 GGTGTGGGGTCTTTGAGATGGGG - Intergenic
1135834984 16:25816976-25816998 GAGGTGGGGCCTTTAAGGTGTGG - Intronic
1135927974 16:26711875-26711897 GAGGTGGGGCCTTTGGGAGGTGG - Intergenic
1135968608 16:27055785-27055807 GAAGTGGGGTCTCTGCGAAGTGG - Intergenic
1136005467 16:27326053-27326075 GAGATGGGGAGGTTGAGAAGGGG - Intronic
1136674519 16:31890828-31890850 GAGGTGGGATCTTTAAGAAGTGG - Intronic
1138991160 16:62392559-62392581 TGGGTGTGGTCTTTAAGAAGTGG - Intergenic
1139204225 16:65010639-65010661 GCGCTGGGGTCTTTGATAAGGGG - Intronic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1139754406 16:69131808-69131830 GGGGTGGGGTCCTGGAGGAGTGG - Intronic
1139852528 16:69959706-69959728 GAGGAGGGGACTCTGAGAAAAGG - Intronic
1139881499 16:70182614-70182636 GAGGAGGGGACTCTGAGAAAAGG - Intronic
1140371010 16:74412891-74412913 GAGGAGGGGACTCTGAGAAAAGG + Intronic
1140645959 16:77030015-77030037 GAGGTGGGGACTTTAAGAGGTGG - Intergenic
1141163490 16:81644823-81644845 GAGATGGGGGCTTGGAGAGGGGG + Intronic
1141888552 16:86910513-86910535 GGGGTGGGGGCCTGGAGAAGAGG - Intergenic
1142627612 17:1202571-1202593 CAGCTGGGGCCTTTCAGAAGAGG - Intronic
1142850399 17:2701842-2701864 GAGGTGGGGGGCTGGAGAAGGGG - Intronic
1143581750 17:7831627-7831649 GAGGTGGAGTGTTAGAGATGAGG - Intronic
1143625012 17:8104686-8104708 GAGCTTGGCTCTTTGAGGAGAGG + Intronic
1144007087 17:11110566-11110588 GAGGTGGGGTCTTTGGAAGGTGG + Intergenic
1144382726 17:14718726-14718748 GAGGTGGGACCTTTGGGAGGTGG - Intergenic
1144533430 17:16063084-16063106 GTGGTGGTGTCTGTGAGAAGAGG - Intronic
1144647732 17:16987059-16987081 GTGGGGGGGCCTCTGAGAAGGGG - Intergenic
1145885564 17:28380399-28380421 GAGGAGGGGTATGTGGGAAGAGG - Intronic
1147599953 17:41739363-41739385 GGGCTGGGCTCTTTAAGAAGAGG - Intergenic
1147879393 17:43644195-43644217 GTGGTGAGGTCTTAGAGCAGCGG - Intronic
1148842748 17:50509122-50509144 GAATTGGGGTCCTTGGGAAGAGG + Intronic
1150681241 17:67286202-67286224 CTGGTGGAGGCTTTGAGAAGAGG - Intergenic
1151799016 17:76366516-76366538 GAGCTGGTGTCTGTGAGAAAAGG + Intronic
1151998918 17:77632496-77632518 GAGATGGGGCCTTTGAGAGGCGG + Intergenic
1152036422 17:77875836-77875858 GAGGAGGGGGCTTCAAGAAGGGG + Intergenic
1152089472 17:78238829-78238851 GAGGTGGTGTCTGGGAGAGGCGG + Intronic
1152179488 17:78809807-78809829 GAGATGGGGTTTTGGAGATGGGG + Intronic
1152806489 17:82359298-82359320 GAGGAGGGGTCTCTGAGGAGGGG + Intronic
1152884019 17:82837800-82837822 GAGGAGGTGTGTTGGAGAAGAGG - Intronic
1154299989 18:13184506-13184528 CAGGTGGGTTTTTTGGGAAGCGG + Intergenic
1155035104 18:22019429-22019451 GAAGTGGGATTTTTGAAAAGAGG + Intergenic
1156228473 18:35131597-35131619 GAGGTGGGGCCTTTGGGAGGTGG - Intronic
1157098383 18:44708041-44708063 GAGGAGGGGTCTATGAGAGGAGG + Intronic
1157445147 18:47738854-47738876 GAGGTGGGGACTTTGGGAGGTGG - Intergenic
1159627349 18:70710069-70710091 GAGGTGGGGTCTAAGAGAGGAGG - Intergenic
1159939893 18:74398769-74398791 GAGGTGGGGCCTTCGGGAGGTGG - Intergenic
1161270626 19:3387610-3387632 GAGGAGGCGTCTTTGAGGTGAGG + Intronic
1161414940 19:4140688-4140710 GAGTTGGGGGCTTGGAGGAGAGG + Intergenic
1161498211 19:4598727-4598749 GACATGGGGACTTAGAGAAGGGG - Intergenic
1161748290 19:6075126-6075148 GAGGTGGGAAGTCTGAGAAGAGG - Intronic
1161847226 19:6718840-6718862 GGGGTGGAGTCTCAGAGAAGGGG + Intronic
1162145751 19:8611291-8611313 GAGGTGGGGCCCTTGAGGAGGGG + Intergenic
1162145769 19:8611330-8611352 GAGGTGGGGCCCTGGAGGAGGGG + Intergenic
1162254321 19:9475987-9476009 TAAGTGTGTTCTTTGAGAAGAGG - Intronic
1162915629 19:13873101-13873123 GAGCTGGGCTCTTTGAGGACTGG + Intronic
1163717251 19:18879620-18879642 GAGGTGGGGCCTTGGCGAGGTGG - Intronic
1163717298 19:18879745-18879767 GAGGTGGGGCCTTGGTGAGGTGG - Intronic
1163717321 19:18879808-18879830 GAGGTGGGGGCTTGGTGAGGTGG - Intronic
1163720307 19:18895511-18895533 CAGGTGGGATGTTTGAGACGTGG - Intronic
1164473341 19:28554086-28554108 GAGATGGGGTCTGTGAAATGTGG - Intergenic
1164604138 19:29583982-29584004 GAGGAGGCTTCCTTGAGAAGGGG + Intergenic
1164668185 19:30056238-30056260 GAGGTGGGGACATAGAGAAGGGG - Intergenic
1164909557 19:31994771-31994793 GAGGTGGAGACTTTGGGAGGGGG - Intergenic
1165075905 19:33279767-33279789 CAGGTGGGGTCTTCCAGAAGTGG - Intergenic
1165170313 19:33887642-33887664 GAGGTGGGAGCTGTGAGGAGGGG - Intergenic
1165291496 19:34889723-34889745 GAGGAGGGGTCTGTAAGAAAAGG - Intergenic
1166359312 19:42246209-42246231 GTGGTGGGGTGATGGAGAAGGGG - Intronic
1166423985 19:42659663-42659685 AAGGTGGGGTCTTTCAGGTGGGG + Intronic
1166570846 19:43796147-43796169 GAGGTGGGGCCTTTGGGAGGTGG - Exonic
1167387735 19:49174027-49174049 GATCTGGGGTCTTTGAGAGCAGG - Intronic
1167424493 19:49423160-49423182 GGGGTGGGAACTTGGAGAAGTGG - Intronic
1167471788 19:49679704-49679726 GAGGTGGGGTGTTTAAGAAAGGG - Intronic
1168601278 19:57720604-57720626 GAGGTTGGGTCTTTGAGTGAAGG + Exonic
925104151 2:1275199-1275221 GAGGTGGAGCCTTTAAGAGGTGG - Intronic
925507492 2:4584310-4584332 GAGGTGGGGGAGTGGAGAAGTGG - Intergenic
926115571 2:10210796-10210818 GAGGTGGAGCCTTTGGGAGGTGG + Exonic
926206756 2:10839464-10839486 GAGGTGGGGTCTTTGAGAAGTGG - Intergenic
927095608 2:19745729-19745751 CAGGTGTGGTGTTTGGGAAGTGG + Intergenic
927472594 2:23386526-23386548 GAGGTGGTGTCGTTGGGGAGGGG + Intronic
928306079 2:30171452-30171474 GAGGTGAGGCCTTTGAGAGGTGG - Intergenic
929356017 2:41025516-41025538 GAGGTGGAATCTTTAAGAAGTGG - Intergenic
929815993 2:45232072-45232094 GAGGTGGGGTCTTTGGAAGGTGG - Intergenic
929818352 2:45254153-45254175 GAGGTGAGGTCTTGGACCAGGGG - Intergenic
930991840 2:57665622-57665644 GAGGTGGAGTCTTTAAGAGGTGG + Intergenic
932703068 2:74003861-74003883 GAGCTGGGGTGTTTGAGACAGGG + Intronic
932784758 2:74590371-74590393 GAGGTGGGGCCTTTGAATGGTGG - Intronic
934702234 2:96451678-96451700 GAGGTGGGGTCTCAGGGAAATGG - Intergenic
934937454 2:98475753-98475775 GGGGTGGGGGCTTTGGGAGGAGG + Intronic
934972558 2:98774909-98774931 GAGGTGGGGCGTTTGAGAGCTGG - Intergenic
935716468 2:105943606-105943628 GCGGTGGGGTTTTTGGGAGGTGG - Intergenic
935850112 2:107209473-107209495 GATGAGGCTTCTTTGAGAAGTGG - Intergenic
935855433 2:107268062-107268084 GAGGTGGGGCTTTTGGGAGGTGG - Intergenic
936082836 2:109446623-109446645 GAGGTGAGGTCTATGGGCAGGGG + Intronic
937025305 2:118692740-118692762 GAAGTGGATCCTTTGAGAAGAGG - Intergenic
937932878 2:127219693-127219715 GGGGAGGGGTCTTCGGGAAGCGG - Intronic
938766090 2:134461344-134461366 TAGATGGGGTATTTGAGAACTGG + Intronic
938781686 2:134590348-134590370 GAGCTGGGGTCTCTGAGAGTGGG - Intronic
940084645 2:149845246-149845268 GAGATGGGGCCTTTGGGAGGTGG - Intergenic
941187164 2:162331475-162331497 GAGGTGGGGCCTTTAGGAGGAGG + Intronic
941200423 2:162501772-162501794 GAGGTGGGACCTTTCAGAATAGG - Intronic
941449673 2:165644960-165644982 GAGGTGCCATCTATGAGAAGTGG - Intronic
941531710 2:166678632-166678654 GAGGTGGGGCCTTTGGGAGGTGG + Intergenic
941673174 2:168316881-168316903 GAGGTGAGACCTTTGAGAGGTGG - Intergenic
942296797 2:174525322-174525344 GAGGTGGGGTTTTTAAGAGGTGG - Intergenic
942523480 2:176829158-176829180 GATATGGGGGTTTTGAGAAGGGG - Intergenic
945258984 2:207826673-207826695 GAGTTGGGGTCTTGGGGAAGCGG + Intergenic
946071365 2:217036909-217036931 GAGGTCGGGAGTTTGAGAACAGG - Intergenic
946187961 2:217991875-217991897 GAGGTGGTGTCATTTAGAAAAGG - Intronic
947125066 2:226860156-226860178 GAGGTGGGGTGCATGAGAGGAGG + Intronic
947260493 2:228216486-228216508 GAGGTGGAATCTTTGAGAGGTGG + Intergenic
947385939 2:229590560-229590582 GAGGTGGGGCCTTTGAGAGGTGG + Intronic
947801451 2:232930704-232930726 GTGGTGGGGCCTTTGAGAGGTGG - Intronic
948364682 2:237447041-237447063 GAGGTGGGGTCTTTGGGAAGGGG - Intergenic
948723887 2:239920092-239920114 GAGGTGGGGCCTTTGGGAGGTGG + Intronic
948790640 2:240374812-240374834 GAGCTGGGGTCACTGAGGAGGGG - Intergenic
1168797392 20:620679-620701 GAGGTGGGGCCTTGAAGATGGGG - Intergenic
1168947549 20:1774041-1774063 GAGGCTGGGTCATGGAGAAGAGG + Intergenic
1169073126 20:2745829-2745851 GAGGAAGGGTCCTTGGGAAGGGG - Intronic
1169084324 20:2817205-2817227 GGGCTGGGGGCTTTGAGAAGAGG + Intronic
1169395045 20:5221640-5221662 GAGGTGGGGTCTTTAAGAGGTGG + Intergenic
1169939108 20:10917922-10917944 GAGGTGGGGCTTTTCGGAAGTGG + Intergenic
1170109655 20:12791114-12791136 GAGGTGGAGTTTTTAAGAGGGGG - Intergenic
1170451570 20:16489207-16489229 GAGCTGGGGCCTTGGAGAAGAGG + Intronic
1170766847 20:19297409-19297431 GAGCTGGGGTTCCTGAGAAGGGG - Intronic
1170968079 20:21094024-21094046 GAGGTGTGGTATTTGGGAAGGGG + Intergenic
1172571716 20:35975781-35975803 GAGTTGGGGCCTTCGAGCAGAGG + Intronic
1172800552 20:37573461-37573483 GAGGTGGGGGTATGGAGAAGAGG + Intergenic
1173110849 20:40188740-40188762 GTGGTGGGCTCCCTGAGAAGAGG - Intergenic
1173499042 20:43539179-43539201 CAGGGAGGGTCTTTGACAAGAGG + Intronic
1174124422 20:48292524-48292546 GAGGTGGGGTCCTGGAGAGAAGG + Intergenic
1174338502 20:49881895-49881917 GATGTGGGCTATTTGGGAAGGGG + Intronic
1174457464 20:50659836-50659858 GAGATAGGGTGTCTGAGAAGGGG - Intronic
1174503530 20:51002586-51002608 GATGTGGATTCTTTGAGAGGTGG + Intergenic
1175465400 20:59187273-59187295 GAGGTGGGTCCTTTGGGAGGTGG + Intergenic
1175880303 20:62254174-62254196 GATGTGGGGCCTTTGAGAGGTGG - Intronic
1176221720 20:63972452-63972474 GAGGTTGGCTCTTATAGAAGAGG + Intronic
1176733829 21:10524154-10524176 GAGGTGAGGTCTCTGAGCAAGGG + Intronic
1178023931 21:28443394-28443416 GAGGTGGAGTCTTTAAAAGGTGG + Intergenic
1179023215 21:37657735-37657757 TAAGTGAGGTCTTAGAGAAGAGG + Intronic
1179718606 21:43302837-43302859 GAGGTGGGTTGTTTGAGGGGTGG + Intergenic
1179725809 21:43340690-43340712 GAGGTGGGGTGTTTGAGCCGAGG + Intergenic
1180127230 21:45800840-45800862 GAGATGGGGTGTTTGAGCATGGG + Intronic
1180561580 22:16619629-16619651 GAGGTGAGGTCTCTGAGCAAGGG + Intergenic
1181643283 22:24216038-24216060 CAGGTGGGGCCTTTGGGATGTGG + Intergenic
1181986266 22:26801887-26801909 GAGGTGGGGCCTATGAGTAGTGG + Intergenic
1182990861 22:34766218-34766240 GAGGTGTGGCCTTTGGGAATAGG + Intergenic
1183489934 22:38110859-38110881 GGGTTGGGGTCCTTGAGGAGGGG - Intergenic
1183997405 22:41645475-41645497 GAGTCGGGGTCTCTGAGCAGTGG - Intronic
1184519851 22:44986878-44986900 CAGGTGGGGTCCTGGAGATGGGG + Intronic
1184542484 22:45136542-45136564 GGGATGGGGTAGTTGAGAAGTGG + Intergenic
1184757295 22:46524293-46524315 GAGCAGGGGTGATTGAGAAGTGG - Intronic
949256536 3:2053952-2053974 GAGGTGGGGCCTGTGGGAAGTGG + Intergenic
950011705 3:9728818-9728840 GAGGAGGAGTCTGTGAGAAGGGG - Intronic
950484869 3:13267081-13267103 GAGGTGGGGCCTCTGGGAGGTGG + Intergenic
950490273 3:13300473-13300495 GAGGTTGGGTCTTTGGGAGGTGG - Intergenic
950799086 3:15534855-15534877 GAGATTGGGTCTTTAAGAAGTGG - Intergenic
951710538 3:25581667-25581689 GAGGTGGGGTCTTTGGGCGGGGG + Intronic
952878879 3:37970741-37970763 CAGGAGGGGTCTCTGAGCAGAGG - Intronic
953084430 3:39653153-39653175 GGGGTGGGGTCATCGTGAAGGGG + Intergenic
953252644 3:41260686-41260708 GAGGCAGGGTCTTACAGAAGAGG + Intronic
954450918 3:50571247-50571269 GGACTGGGGTCTTTGAGAAGAGG + Exonic
954980006 3:54737344-54737366 GAGGAGGGGTCTTTTGGAGGTGG + Intronic
956887933 3:73579087-73579109 GAGGTGGGGTCTTGGGGAGGTGG + Intronic
957561845 3:81832409-81832431 GAGGTGGGGCCTTTGAGAGGTGG + Intergenic
957790734 3:84937614-84937636 CAGTTGTGGTATTTGAGAAGTGG + Intergenic
957856936 3:85891588-85891610 GAGACGAGGTCTTTAAGAAGGGG + Intronic
958859733 3:99431985-99432007 GAGGTAGAGTCTTTAAGAGGTGG + Intergenic
958884231 3:99708209-99708231 GCAGTGACGTCTTTGAGAAGTGG - Intronic
959302095 3:104615690-104615712 GAGCTGGTGTTTTTGAGAGGTGG + Intergenic
959745299 3:109769309-109769331 GAGGTGGAGTCTTAAAGAGGTGG + Intergenic
959877035 3:111395277-111395299 GAGGTGGGGTCTTTGGGAGGTGG + Intronic
960205075 3:114887186-114887208 GAGCTGGGGCCTTTAAGAGGTGG - Intronic
960573659 3:119208752-119208774 GATGTGGGGGCTTGGAGCAGAGG - Intergenic
960619416 3:119624357-119624379 GAGGTGGGGCCTTTGAGGGAAGG - Intronic
961664211 3:128486219-128486241 GCAGTGGCGTCTTGGAGAAGGGG + Exonic
962025239 3:131540841-131540863 CAGCAGGGGTCTTTGAGATGTGG + Intronic
962476045 3:135756331-135756353 GAGGAGGCTTGTTTGAGAAGAGG - Intergenic
962714908 3:138117546-138117568 GAGGTGGGGCCTTTGGGGGGTGG - Intergenic
962944402 3:140154177-140154199 CAGATGGGGTCTTCAAGAAGGGG + Intronic
963077955 3:141365547-141365569 GAGGTGGGGTCTTTCAGAGGTGG - Intronic
963344259 3:144075108-144075130 GAGGTAGGATCTTTAAGAGGTGG + Intergenic
963712990 3:148768735-148768757 GAGGTGGGACCTTTGGGAAATGG + Intergenic
964359347 3:155878136-155878158 GAGGTGAGGTCTTTGGGAGGTGG - Intronic
964389556 3:156183269-156183291 GAGGTGAGGGCTTTGAGAAGGGG + Intronic
968029068 3:195467247-195467269 GAGGTGGAGTGTGAGAGAAGAGG + Intergenic
968186124 3:196634556-196634578 GAAGTGGGGGCTAGGAGAAGTGG + Intergenic
968186170 3:196634708-196634730 GAAGTGGGGACTGGGAGAAGTGG + Intergenic
968186180 3:196634739-196634761 GAAGTGGGGGCTGGGAGAAGTGG + Intergenic
968186185 3:196634755-196634777 GAAGTGGGGACTGGGAGAAGTGG + Intergenic
968186195 3:196634786-196634808 GAAGTGGGGGCTGGGAGAAGTGG + Intergenic
968947444 4:3672794-3672816 GAGGTGAGGACTTTGGGAGGTGG - Intergenic
969284964 4:6197431-6197453 GAGGTGTGGTCTCTGAGCAAAGG - Intronic
969324305 4:6432037-6432059 GAGGTGGGGCCTTTGGGAGGTGG - Intronic
969338782 4:6527758-6527780 GTGGTGGGGCCTGTGGGAAGGGG - Intronic
970008141 4:11429325-11429347 GAGCTGGCGACTTAGAGAAGAGG - Exonic
972362097 4:38336175-38336197 GAGGTGAGGTCTTTAAGAAGTGG + Intergenic
975200531 4:71582959-71582981 GAGGTAGGGCCTTTGGGAGGTGG + Intergenic
975486602 4:74940551-74940573 GAGGTGGGGTCTTTAGGAAGTGG - Intronic
976067098 4:81200360-81200382 GAGCTGAGGTCTGTGAGAAAAGG - Intronic
976911592 4:90313624-90313646 GAGGTGGGGTGTGTGGGGAGAGG + Intronic
980704459 4:136474978-136475000 TAGGTGGGGCCTTTAAGAGGTGG + Intergenic
981423412 4:144577358-144577380 GAGGTGGGGCCTTTAAGAGATGG + Intergenic
982759358 4:159262458-159262480 GAGGTGGAGTCCTTGAACAGTGG - Intronic
983413763 4:167429186-167429208 GAGGTGGGACCTTTAAGAAGTGG - Intergenic
983895077 4:173072674-173072696 GAGGTGGGGCCTTTAAAAGGTGG + Intergenic
983895087 4:173072756-173072778 GAGGTGGGGCCTTTAAAAGGTGG - Intergenic
984041511 4:174740165-174740187 AAGCTGGGGTCTTTAGGAAGGGG + Intronic
986797049 5:11222859-11222881 GAGGTGGGATGTTGGAGATGGGG - Intronic
987653142 5:20770828-20770850 GAGGTGGGGTCTTTGGTAGGTGG - Intergenic
988522460 5:31958839-31958861 GAGGTCAGGAGTTTGAGAAGAGG - Intronic
989076440 5:37568258-37568280 CAGGTGTGGTGTTTGGGAAGTGG + Intronic
992501074 5:77344641-77344663 GAGGCAGGGCCTTTGGGAAGTGG - Intronic
992857816 5:80881263-80881285 GAGGTGGTGTGTTTGAGCAGAGG - Intergenic
995058371 5:107787486-107787508 AAGGTGGGGTCTTTGGGAGGTGG + Intergenic
996936598 5:128956688-128956710 GAGGTGTGCTGTTTGAGAATTGG - Intronic
998107598 5:139478233-139478255 GAGTGGGGGTCTCTGAGGAGGGG - Intronic
998726263 5:145018287-145018309 GAGGTGTGACCTTTGAGAAGAGG - Intergenic
999906762 5:156149684-156149706 GAGGTGGGGACCTTGAGAGCTGG + Intronic
1000044726 5:157512818-157512840 GAAGTGGGTTGCTTGAGAAGCGG - Intronic
1000044728 5:157512834-157512856 GAAGTGGGCTGTTTGAGAAGTGG - Intronic
1000395662 5:160772403-160772425 GAGGTGGTGTCTGTGGGATGTGG + Intronic
1002506682 5:179684253-179684275 GTGGTGGCGTTTTTGAGACGGGG + Intronic
1002972817 6:2041652-2041674 GAGGTGGGGTCATGGGGAGGTGG + Intronic
1003435455 6:6083938-6083960 GAGGTGGGGTCTTTGGGAGGTGG + Intergenic
1003455542 6:6278509-6278531 GAGGTGAGGTATCTGAGCAGGGG + Intronic
1003687627 6:8320267-8320289 GAGGTGGGGCCTTTGGGAGGTGG - Intergenic
1004171775 6:13300749-13300771 GAGGTGGGGCCTTTGGAAGGTGG + Intronic
1004358571 6:14951207-14951229 GAGGTGGGAAGTCTGAGAAGTGG - Intergenic
1004886230 6:20053911-20053933 CAGGTGGGGGCTTTAAGAAAAGG + Intergenic
1007425058 6:41741136-41741158 CAGGTAGGGTCTTGGTGAAGGGG + Intronic
1007636427 6:43302470-43302492 GAGGTGGGGTCTCCGGGGAGTGG - Intronic
1007952548 6:45885165-45885187 GAAGTGGGGCCTTTGAGAGGAGG + Intergenic
1008064330 6:47031481-47031503 GAGGTGGAGTCTATGAGAGAAGG - Intronic
1008318102 6:50071955-50071977 CAGGTTGGGCCTCTGAGAAGGGG + Intergenic
1008431696 6:51425396-51425418 GAGAAGGGCTCTTTGACAAGTGG + Intergenic
1009947400 6:70355817-70355839 GAGGTGGGACCTTTGTGGAGGGG + Intergenic
1011350497 6:86417883-86417905 ATGGTGGGGGCTTTGGGAAGGGG - Intergenic
1011381499 6:86746598-86746620 GAACTGGGGCCATTGAGAAGAGG - Intergenic
1011706217 6:90003885-90003907 GGGGTGAAGTCTTTGGGAAGTGG - Intronic
1011980218 6:93365496-93365518 GAGGTCAGTTCTTTGAGCAGTGG - Intronic
1012054297 6:94385801-94385823 GATGTGGGGACTTTAAGAAATGG + Intergenic
1012443216 6:99281574-99281596 GAGGTGGGGCCTTTAAGAGGTGG + Intronic
1012560319 6:100572161-100572183 GAAGTGGGGGCTTTGGGGAGGGG + Intronic
1016653277 6:146487518-146487540 GAGATGTGGGCATTGAGAAGAGG - Intergenic
1017527296 6:155252772-155252794 CATGTGAGGTCTTTGAGAACTGG + Intronic
1017606707 6:156142547-156142569 GAGGTGGAGTCTTCTAGAACGGG + Intergenic
1018442222 6:163823774-163823796 GAGGTGGGGCCTTTGGGAGGTGG + Intergenic
1018753504 6:166828286-166828308 GAGGGCAGGTCTTTCAGAAGAGG - Intronic
1018891706 6:167987566-167987588 GATGTGGTGGCGTTGAGAAGCGG - Intergenic
1019097699 6:169598509-169598531 GAGGTGGGAACTTTAAGAGGTGG - Intronic
1022059830 7:26782527-26782549 GAGGTGGAGCCTTTGGGAATTGG + Intronic
1022981539 7:35609416-35609438 GAAGTGGGGACCATGAGAAGGGG - Intergenic
1023687802 7:42754260-42754282 GAGATGGGGTCTTTGCCCAGGGG + Intergenic
1024614745 7:51101925-51101947 AAGGTGGAGCCTTTGGGAAGTGG + Intronic
1025145048 7:56494913-56494935 GGGGTAGGGTCTCAGAGAAGAGG - Intergenic
1026430633 7:70343720-70343742 AAGGTGGGGCATTTGTGAAGGGG + Intronic
1027459929 7:78439514-78439536 GATGTGGGACCTTTGAGGAGGGG + Intronic
1028313343 7:89367527-89367549 GAGGTGAGTCCTTTAAGAAGGGG - Intergenic
1029041145 7:97576189-97576211 GAGGTGGAGTCATGGAGGAGAGG + Intergenic
1030371399 7:108703513-108703535 GAGATGGGGACTTTGAGGACAGG - Intergenic
1031223390 7:119002236-119002258 GACATGGGGCCTTTGGGAAGTGG - Intergenic
1031447786 7:121875203-121875225 GAGCTGGGGTCATGGAGAATGGG - Intronic
1031562648 7:123256521-123256543 GAGGTGGGGCCTTTAAGAGGTGG + Intergenic
1031997693 7:128243416-128243438 GGGCAGGGGTCTCTGAGAAGGGG + Intronic
1032206464 7:129870155-129870177 GAGGCCTGGTGTTTGAGAAGAGG - Intronic
1032700506 7:134374655-134374677 GGGGTGGGAGATTTGAGAAGGGG - Intergenic
1033583675 7:142758842-142758864 GAGAGGGGGTCTCTGAGCAGTGG + Intronic
1033811099 7:145012095-145012117 GAGATAGGGCCTTTGGGAAGTGG + Intergenic
1034613349 7:152392413-152392435 GAAGTAGGGTCATTGTGAAGTGG - Intronic
1034737139 7:153439873-153439895 GAGGTGGGGCCTTTTGGGAGGGG + Intergenic
1035962628 8:4154576-4154598 GAGGTGAGGTCTTTGGCAATAGG + Intronic
1036175487 8:6534023-6534045 GAGCTGGGAGCTTAGAGAAGTGG - Intronic
1036679277 8:10859142-10859164 GAGGTGGGTACTCTGTGAAGAGG - Intergenic
1036685738 8:10908758-10908780 GAGGTGGGGCCTTCAAGAGGTGG + Intronic
1037297594 8:17417480-17417502 GAGATGGGACCTTTGGGAAGTGG + Intergenic
1037453796 8:19043629-19043651 GAGATGGGGTTTTTAAGAGGTGG + Intronic
1037621490 8:20567187-20567209 AAGGTGGAGTCTTGGAGAGGGGG - Intergenic
1037676105 8:21051968-21051990 CAGGTGGGCTCATGGAGAAGAGG - Intergenic
1038001942 8:23399389-23399411 GAGGTGGGGCCTTTAAGAAGTGG + Intronic
1038421217 8:27435318-27435340 GAGGTGGGGCCTTTGGGAGGTGG - Intronic
1038437055 8:27543670-27543692 GAGCAGGGGTCTTTCAGAGGAGG + Intronic
1038680495 8:29662875-29662897 GAGGTGGGGCCTTTGAGAGGTGG - Intergenic
1039134696 8:34308394-34308416 GAGGTGGAATCTTTAAGAGGTGG + Intergenic
1039866492 8:41508829-41508851 GAGCTGAGATCTTAGAGAAGGGG + Intronic
1040419290 8:47224156-47224178 GAGTTGGGGTCTCTGTGTAGAGG + Intergenic
1040729614 8:50427638-50427660 GAGGTTGAGCCTTTGAGAACAGG - Intronic
1040957785 8:52997076-52997098 GAGGTAGGGCCTTTAAGAGGTGG - Intergenic
1041499500 8:58524727-58524749 GAGGTGGGATCTTTAAGAGGTGG + Intergenic
1042867508 8:73368675-73368697 GAGGTGGGGCCTTTTAGAGCTGG - Intergenic
1044805531 8:96004850-96004872 GTTGGGGGCTCTTTGAGAAGTGG + Intergenic
1044959083 8:97512404-97512426 GACTTGGGCTCTTGGAGAAGGGG + Intergenic
1047166861 8:122449111-122449133 GGGGTGGGGTCTTAGAGACTGGG - Intergenic
1047452866 8:124981993-124982015 GAGGTGGTACCTTTAAGAAGTGG - Intergenic
1048228754 8:132616438-132616460 GTGGTGGGGTCAGTGAGATGTGG + Intronic
1048230303 8:132633564-132633586 GAGGTGAGGTATTTAGGAAGGGG + Intronic
1048582357 8:135740310-135740332 GTGGTGGGGCCTTTGGGAAGTGG - Intergenic
1048794998 8:138141534-138141556 GAGATGGGGTCTTTGTGAATGGG + Intronic
1048899189 8:139021853-139021875 GTGGTGGGGTCTGTGAGAAGTGG + Intergenic
1049178453 8:141207994-141208016 GAGCTGGTGTCTCTCAGAAGCGG + Intronic
1049367375 8:142246972-142246994 GATGTGTGTTCATTGAGAAGGGG - Intronic
1049943270 9:569332-569354 GAGGTGGGGCCTTTAAGAGGTGG + Intronic
1050067278 9:1773190-1773212 GAGGTGGAGTATTTAAGAGGAGG - Intergenic
1051550986 9:18329064-18329086 GAGGTGGGGCCTTTGGGGAGTGG + Intergenic
1052172753 9:25421900-25421922 GAAGTGGGATCTTTGAGAGGTGG - Intergenic
1052323098 9:27189505-27189527 AAGATGTGGTCTTTGAGATGGGG + Intronic
1052889253 9:33682436-33682458 GAGCTGGGGTTTATGAGCAGAGG - Intergenic
1053628931 9:39910542-39910564 GAGATGGGGTCTTTTGGGAGGGG + Intergenic
1054214956 9:62340160-62340182 GAGATGGGGTCTTTTGGGAGGGG - Intergenic
1054672525 9:67815189-67815211 GAGATGGGGTCTTTTGGGAGGGG + Intergenic
1055336022 9:75234433-75234455 GAGGTGGGGCCTTTCAGAGGTGG + Intergenic
1056288053 9:85111332-85111354 GAACTGGTGTCTTTGAGACGAGG - Intergenic
1056847638 9:90054685-90054707 GAGGTTGGGTCTTAGAGGAAGGG - Intergenic
1057421979 9:94920072-94920094 GAGGTTGGGAGTTTGAGAGGGGG + Intronic
1057855049 9:98595307-98595329 GAGGTAGGGCCTTTGGGAAGGGG - Intronic
1057871609 9:98722369-98722391 GAGTTGGGGGCTTAGTGAAGAGG + Intergenic
1059180528 9:112208453-112208475 TAGGTGGGGTCAGTGAAAAGAGG - Intergenic
1059236077 9:112761668-112761690 GTGGTGCCGTCTTTGAGAGGGGG + Intronic
1059324888 9:113498046-113498068 GAGGTGGGGACACTGAGAATGGG + Exonic
1059954424 9:119500799-119500821 GAGTTGGGTTCTTTGAGAAAAGG - Intronic
1060006676 9:120006467-120006489 GAGGTGGGTTCTGGGAGATGGGG - Intergenic
1060526488 9:124324010-124324032 GAGGTGGGGACTGTGGGAGGGGG - Intronic
1185758119 X:2668241-2668263 GAGGTGGGGTCTTTAGAAGGTGG + Intergenic
1186432836 X:9519670-9519692 GCGCTGGTGTCTTTGGGAAGCGG + Intronic
1186626076 X:11295347-11295369 GGGGTGGGGCCTCTGAGAACAGG - Intronic
1187938261 X:24356864-24356886 GAGGTGGGGTCTTTGGGGGGCGG - Intergenic
1188727245 X:33601235-33601257 GAGGTGGGAGCTTTAAGAGGTGG - Intergenic
1189486450 X:41436410-41436432 GAGGTGGGGCCTTTAAGAGGTGG + Intergenic
1189489417 X:41458156-41458178 GAGGTGGGCTCTTTAAGAGGTGG - Intronic
1190107961 X:47572740-47572762 GAGGTGGAATCTTGGAGAACCGG + Exonic
1191852802 X:65598232-65598254 GAGGTGGGGTCGGGGGGAAGAGG + Intronic
1194126211 X:90020258-90020280 GAATTGGGGTCTTTGAGGACTGG + Intergenic
1195116822 X:101707530-101707552 GAGATGAGGCCTTTAAGAAGTGG - Intergenic
1196076862 X:111587237-111587259 GAAGTGGAGTCTTTAAGAGGTGG + Intergenic
1196580730 X:117376043-117376065 GAGGTGGAGCCTTTGGGAGGTGG + Intergenic
1196599374 X:117584545-117584567 CATGTAGGGTCTTGGAGAAGGGG - Intergenic
1196717461 X:118824747-118824769 GTGGGGGGCACTTTGAGAAGGGG + Intronic
1196799609 X:119530968-119530990 GAGGTCAGGAGTTTGAGAAGCGG - Intergenic
1197084835 X:122459797-122459819 AATTTGGGGTATTTGAGAAGTGG - Intergenic
1197635288 X:128907897-128907919 GAGGTGGGGTTTTTAAGAGGTGG - Intergenic
1198389889 X:136163115-136163137 GAGGTGGGGCCTCTAAGAGGTGG - Intronic
1198438039 X:136636273-136636295 AAGCTGGGGAATTTGAGAAGTGG - Intergenic
1198832735 X:140767939-140767961 GAGGTGAGATCTTTAAGAGGTGG - Intergenic
1198990509 X:142509032-142509054 TAGGTGGGTTCCTTGAGAATGGG - Intergenic
1199205467 X:145144326-145144348 GAGGTGGGACTTTTGAGAGGTGG + Intergenic
1200125929 X:153814891-153814913 GAGGAGGGGTCTTTGTGAACAGG - Intronic
1200168432 X:154053430-154053452 GAGATGGGGTATTTGAGAGGTGG - Intronic
1200284840 X:154810690-154810712 GAAGTGGGGCCTTTTAGAGGTGG - Intronic
1200419647 Y:2951077-2951099 GAGGTGAGGTCTTGAAAAAGTGG - Intronic
1200962757 Y:9010186-9010208 GAGGTTAGTTCTTTGAGAACTGG - Intergenic
1202085535 Y:21132968-21132990 GAGGTGGGGTCTTGTGGGAGGGG - Intergenic