ID: 926207737

View in Genome Browser
Species Human (GRCh38)
Location 2:10846001-10846023
Sequence CACCCTTGTCCCAGCCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 323}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926207730_926207737 12 Left 926207730 2:10845966-10845988 CCTGACATTTTGTTGCCTGGTTG 0: 1
1: 0
2: 2
3: 13
4: 158
Right 926207737 2:10846001-10846023 CACCCTTGTCCCAGCCCTGGGGG 0: 1
1: 0
2: 5
3: 43
4: 323
926207731_926207737 -3 Left 926207731 2:10845981-10846003 CCTGGTTGCCTCTCTTGCCTCAC 0: 1
1: 0
2: 1
3: 66
4: 472
Right 926207737 2:10846001-10846023 CACCCTTGTCCCAGCCCTGGGGG 0: 1
1: 0
2: 5
3: 43
4: 323
926207728_926207737 15 Left 926207728 2:10845963-10845985 CCTCCTGACATTTTGTTGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 175
Right 926207737 2:10846001-10846023 CACCCTTGTCCCAGCCCTGGGGG 0: 1
1: 0
2: 5
3: 43
4: 323
926207727_926207737 21 Left 926207727 2:10845957-10845979 CCAGGGCCTCCTGACATTTTGTT 0: 1
1: 0
2: 0
3: 28
4: 242
Right 926207737 2:10846001-10846023 CACCCTTGTCCCAGCCCTGGGGG 0: 1
1: 0
2: 5
3: 43
4: 323
926207726_926207737 29 Left 926207726 2:10845949-10845971 CCTGGGAGCCAGGGCCTCCTGAC 0: 1
1: 0
2: 3
3: 48
4: 421
Right 926207737 2:10846001-10846023 CACCCTTGTCCCAGCCCTGGGGG 0: 1
1: 0
2: 5
3: 43
4: 323
926207725_926207737 30 Left 926207725 2:10845948-10845970 CCCTGGGAGCCAGGGCCTCCTGA 0: 1
1: 1
2: 4
3: 51
4: 338
Right 926207737 2:10846001-10846023 CACCCTTGTCCCAGCCCTGGGGG 0: 1
1: 0
2: 5
3: 43
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926207737 Original CRISPR CACCCTTGTCCCAGCCCTGG GGG Intergenic
900402710 1:2479137-2479159 CGCCCTGATCCCAGCCCTTGAGG - Intronic
900795732 1:4707181-4707203 CACCCTAATCCTGGCCCTGGCGG - Intronic
900871495 1:5307263-5307285 CTGCCTCGTCCCAGCCCTGCAGG + Intergenic
901064492 1:6488500-6488522 CCGCCCTGACCCAGCCCTGGTGG - Intronic
902239652 1:15080135-15080157 CACCCTTCTCCCAACCTCGGAGG - Intronic
902331960 1:15735176-15735198 CACCCTCTGGCCAGCCCTGGAGG - Intergenic
902379738 1:16047060-16047082 CAGCCTTCTGCCAGGCCTGGCGG + Intronic
902621003 1:17651222-17651244 CACCCTAGTCCTGGCCCTGGTGG + Intronic
902708696 1:18224035-18224057 CACCCTAGTCTCAGCCCTGCTGG - Intronic
903597043 1:24502894-24502916 CGCCCTAGTCCCAGCCCAGGGGG + Exonic
904115260 1:28157041-28157063 CACTCTAGTCCTGGCCCTGGCGG - Intronic
904328334 1:29741956-29741978 GACCCTAGCCCCAGCCCTGGAGG + Intergenic
904993357 1:34611988-34612010 CACACTGGTCTCTGCCCTGGTGG - Intergenic
905386089 1:37605405-37605427 CACGCTGAGCCCAGCCCTGGAGG + Intergenic
905776842 1:40673450-40673472 GACCCTATTCCTAGCCCTGGCGG - Intergenic
906149786 1:43581013-43581035 TACACTGGCCCCAGCCCTGGAGG + Intronic
906812262 1:48839962-48839984 CTCTCTGGTCCCAGCCTTGGTGG + Intronic
907480873 1:54744871-54744893 CACCCTGGGCCCTGCCCTTGAGG + Intergenic
907582399 1:55583973-55583995 CACCTCAGTCCAAGCCCTGGTGG - Intergenic
908829342 1:68163788-68163810 AATCCTTGTCGCAGCCCTGGAGG - Intronic
909593641 1:77380181-77380203 CACCATCATGCCAGCCCTGGAGG + Intronic
910089147 1:83441837-83441859 AACCCTTGTCCCTTACCTGGTGG + Intergenic
910848299 1:91625277-91625299 CACCTTAGCCCCAGCCCTGGTGG - Intergenic
913197625 1:116471182-116471204 CACCCTAGTCTGAGCCCTGTTGG - Intergenic
914313409 1:146487089-146487111 CACCACTATCCCTGCCCTGGTGG - Intergenic
914480381 1:148060591-148060613 CACCATCATCCCTGCCCTGGTGG - Intergenic
914500941 1:148246292-148246314 CACCACTATCCCTGCCCTGGTGG + Intergenic
918129052 1:181608911-181608933 CACCCCTGCCCCAGCCCTGTAGG - Intronic
919902721 1:202056111-202056133 CACCATTGTCTCCACCCTGGAGG - Intergenic
920261742 1:204692979-204693001 CACCCTAGTCCCAGCCCCACTGG + Intergenic
920442819 1:205992680-205992702 CGCCCGTGTCCCAGATCTGGAGG + Exonic
921399755 1:214708187-214708209 CACCCCATTCCCACCCCTGGTGG - Intergenic
922732926 1:227961319-227961341 CATCCTCATCCCAGCCCTGGTGG - Intergenic
922782426 1:228263858-228263880 GACCCCAGTCCCTGCCCTGGAGG + Intronic
922783453 1:228271652-228271674 TACCCTAGTCCCTGCCCTGGAGG + Intronic
923778887 1:237004240-237004262 CACACTTGGCACAGCCCAGGGGG + Exonic
1063465800 10:6243520-6243542 CACCCTAGTCCCATCAGTGGAGG + Intergenic
1063501501 10:6559259-6559281 AGCCCTGGTCCCAGCCCTTGAGG + Intronic
1067107884 10:43377607-43377629 CCCCCTTCTACCAGCCCTGCTGG - Intergenic
1067214024 10:44285529-44285551 AGCCCTTCTCCCATCCCTGGAGG - Intergenic
1069373051 10:67767260-67767282 CACCCTTGTCCCCTCACTAGAGG + Intergenic
1069922910 10:71828064-71828086 CACCTTTGTCCAGGCCTTGGTGG - Exonic
1070257516 10:74825231-74825253 CACCTCAGTCCCAGCCCTGGCGG + Intergenic
1070736054 10:78864488-78864510 CACCCTGCTCCCCACCCTGGTGG - Intergenic
1070793837 10:79205425-79205447 CAGCCTTGTGCCAGCCTTTGGGG + Intronic
1073309818 10:102532333-102532355 CACCCTGCTCCCTGCCCTAGAGG - Intronic
1074370274 10:112895067-112895089 CACCCTAGTCCCATCCCTGAAGG + Intergenic
1074533800 10:114314325-114314347 CAAACTTGCCCCAGGCCTGGAGG + Intronic
1074599509 10:114899613-114899635 CACCCTTGAACCAATCCTGGTGG + Intronic
1074704670 10:116120266-116120288 TACCCTTGACCCAGCACTGTTGG + Intronic
1074819557 10:117168170-117168192 CACCCTCGGCTCAGCCCCGGGGG - Intergenic
1075502887 10:122993971-122993993 CACCCCAGCCCCAGCCCTGCCGG - Exonic
1075917969 10:126186085-126186107 CACCCTTGCCACAACCCTTGGGG - Intronic
1076494594 10:130888858-130888880 CAACCTGCTCCCTGCCCTGGAGG + Intergenic
1077046661 11:549707-549729 CCACCTTCTCCAAGCCCTGGAGG - Intronic
1077102101 11:827012-827034 CAGCCTTGTCCCTGCTCCGGGGG + Intronic
1077109786 11:857157-857179 CACAACTGCCCCAGCCCTGGTGG - Intronic
1077126747 11:942859-942881 CAGCCTTGTCCCAGCCTGGAGGG + Intronic
1077197453 11:1288526-1288548 CACCCTTGTCTCTTTCCTGGAGG - Intronic
1077474734 11:2780953-2780975 CACCCCTGTGCCTGTCCTGGTGG + Intronic
1078012005 11:7579587-7579609 GAGCCTTGTCCCAGCCCCTGGGG + Intronic
1078059688 11:8035060-8035082 CACCCTAGTCTCAGCCCTGGAGG - Intronic
1080887218 11:36377538-36377560 CAGCCTGGTCCCACCCCGGGCGG - Intronic
1081761200 11:45577436-45577458 CATCCCTATCCCAGCTCTGGAGG + Intergenic
1081804489 11:45883046-45883068 CTCCCTTCTCCCAGCTCAGGTGG + Exonic
1081863665 11:46347996-46348018 CGCCCGTGTCCCGGCCCTGGGGG - Intronic
1083161659 11:60858213-60858235 CATCTTTCTCCCAGTCCTGGGGG - Intergenic
1083320573 11:61843523-61843545 CACCCTAATCCCAGCCCTGGTGG - Intronic
1083715219 11:64571452-64571474 CACCCTGATACCTGCCCTGGGGG - Exonic
1083990383 11:66242871-66242893 CACCTGTGTCCCAGCCCCTGGGG - Intronic
1084096718 11:66916145-66916167 CACACTTGGCCCAGCCCCTGTGG + Intronic
1084400152 11:68938797-68938819 CAGCCTTGTCTCTACCCTGGAGG + Intronic
1084915256 11:72424277-72424299 CACCCTTGCCCCATGCCTGGGGG + Intronic
1084915605 11:72426742-72426764 CAACCTTGTCCCTGCCCTTCAGG + Intronic
1084945050 11:72633910-72633932 CACCCATGACCCAGCGCTGAAGG + Intronic
1085049909 11:73375152-73375174 AACCCCTGCCCCAGCCCTGGAGG + Intergenic
1085309912 11:75510171-75510193 CACCATGGCCCCAGCCCTGCTGG + Intronic
1085524485 11:77156514-77156536 GAGCCCTGCCCCAGCCCTGGAGG + Intronic
1085674851 11:78506962-78506984 TACCCCTCTCCCAGCCCTGAGGG + Intronic
1087986541 11:104688703-104688725 CACCCTTGTCTCAGACAAGGAGG + Intergenic
1089290848 11:117437323-117437345 CCCCATTGTTCCAGCCCTGCAGG + Exonic
1089456012 11:118626208-118626230 CACCCCTCACCCAGCCCTGCAGG + Intronic
1089562402 11:119350659-119350681 CATCCTTATTCCAGCCCCGGTGG + Intergenic
1090074689 11:123572873-123572895 CGCCCCTGTCCCAGCCATCGGGG - Intronic
1091169159 11:133505285-133505307 TCCCCTTGTCCCTGCCCAGGAGG - Intronic
1091696369 12:2630722-2630744 CTCCTGTGCCCCAGCCCTGGGGG - Intronic
1096464549 12:51841088-51841110 TGCCCTCTTCCCAGCCCTGGGGG + Intergenic
1096994322 12:55829520-55829542 CACCCTGGCCCCAGGCCGGGCGG - Exonic
1103477377 12:121228884-121228906 CTCTCCTGACCCAGCCCTGGAGG + Intronic
1103764424 12:123270985-123271007 CATCCTGGTCCCAGTCCCGGCGG + Intronic
1104964865 12:132504412-132504434 CAGCCTGCGCCCAGCCCTGGTGG + Intronic
1105972708 13:25445411-25445433 CTCCTTTATCCCTGCCCTGGAGG + Intronic
1107222624 13:38003522-38003544 CAGCCTTTTCCCAGCCCTCTGGG - Intergenic
1108275534 13:48805710-48805732 CATCCTTGTATCAGTCCTGGAGG - Intergenic
1112662168 13:101522386-101522408 CTCCATTGGGCCAGCCCTGGAGG + Intronic
1113314618 13:109165604-109165626 CATGCTTTTCCCAGCCCTGCGGG - Intronic
1113501150 13:110775472-110775494 CACCTCTGTCACAACCCTGGAGG + Intergenic
1113619291 13:111702020-111702042 CACCATTGTCCAAGCCACGGAGG + Intergenic
1113624820 13:111787281-111787303 CACCATTGTCCAAGCCACGGAGG + Intergenic
1114410442 14:22495836-22495858 CCCCCTTGTCCCTGCCATGCTGG + Intergenic
1114549010 14:23522657-23522679 GACCACTGTCCCAGCCCTGTTGG - Exonic
1114570618 14:23664790-23664812 CACTTTTGTCCCTCCCCTGGTGG - Intergenic
1114655455 14:24312873-24312895 ACTCCTTGTCCCAGCCCTGCCGG + Intronic
1114690918 14:24580460-24580482 CACCCATGTCCCAGCACTTTGGG + Intergenic
1114891229 14:26926065-26926087 TCCCCTTGTCCCAGCCCTGCAGG - Intergenic
1119439898 14:74621181-74621203 CAACCTAGACCAAGCCCTGGTGG - Intergenic
1121021678 14:90584098-90584120 CAGGCTTGACCCAGCCCTGCAGG - Intronic
1122237820 14:100342478-100342500 CACCTTCTTCCCAGCCCTGCAGG - Exonic
1122263313 14:100535282-100535304 CAGCCTTGGCCCAGATCTGGGGG - Intergenic
1122710556 14:103653977-103653999 CACCCTGGGCCTGGCCCTGGTGG + Intronic
1122781574 14:104146016-104146038 CACCCTTGCCACTGCCCTGCTGG - Intronic
1123006228 14:105325125-105325147 CGCCTGTGTCCCAGCCCTGAGGG + Intronic
1128233236 15:66049826-66049848 CACCCTTCTCCCAGAGCTGATGG + Intronic
1129004757 15:72363253-72363275 AACCCTGGTCCCTGCCCTTGAGG + Intronic
1129189465 15:73928908-73928930 CACCCTAGTCCTGGCCCTGGCGG + Intronic
1129331145 15:74827985-74828007 CCCCCTTCTCTCAGCCCTCGTGG + Intronic
1130018040 15:80202279-80202301 CACCCTAGTCCCATGCCTGCTGG - Intergenic
1130045136 15:80437622-80437644 CACCTCTGTCCCATCCCTGTAGG + Intronic
1130846525 15:87752734-87752756 TTCCCTTCTCCAAGCCCTGGGGG + Intergenic
1132302798 15:100786994-100787016 CACCCACTTCCCAGCCCTGAGGG - Intergenic
1133154538 16:3863799-3863821 CACCCTTGTCCCCACCCTTCAGG - Intronic
1133218551 16:4307947-4307969 CCCCCTCGTTCCTGCCCTGGGGG + Intergenic
1135133586 16:19871942-19871964 CACCCTTCTGCCAGCCCTGCAGG - Exonic
1136534611 16:30892588-30892610 CTCTCTTGGCCCAGCCGTGGGGG + Exonic
1137702723 16:50508408-50508430 CACCCCTGCCCCTGCCCTTGAGG - Intergenic
1137781107 16:51098565-51098587 CAGCCTTGTGCCAGGCTTGGGGG + Intergenic
1137958057 16:52852924-52852946 CACTCATGTCCCAGCACTGGTGG + Intergenic
1138102978 16:54269250-54269272 CACCCCAGTCCCAGCCTTGCTGG + Intronic
1138391205 16:56670914-56670936 CACACTTGGCACAGCCCAGGGGG - Exonic
1139341463 16:66270505-66270527 CACCCCCAGCCCAGCCCTGGCGG - Intergenic
1139925036 16:70481326-70481348 CACCCTTGGCCCAGCCAGGGAGG - Intronic
1140775002 16:78241367-78241389 CATCCTTGTTCCAGCCTTGATGG + Intronic
1140931914 16:79635677-79635699 CAGACTTGTCCCTGCCCTTGAGG + Intergenic
1141427021 16:83951268-83951290 CACCCTCGTCCTGGCCCTGGTGG - Exonic
1142081664 16:88152556-88152578 CCCCCCTGTGCCAGCCCTGACGG + Intergenic
1142233542 16:88910899-88910921 CACACTTGGCACAGCCCTGGAGG - Intronic
1143459742 17:7094599-7094621 CTCCCTTGACCCAGCCCTTGAGG - Intergenic
1143496719 17:7316662-7316684 CACGCCTGTCCCAGCCCTTTGGG + Intronic
1146061396 17:29609297-29609319 CACCCTTGAGCCAGCCCGGTGGG + Intronic
1146262684 17:31432070-31432092 CACTGTTGCCCCAGCCGTGGGGG + Intronic
1146277220 17:31523490-31523512 CACCCTCCTCCCACCCCTGCAGG + Exonic
1146762443 17:35490178-35490200 CCGCCTCGTCCCAGCGCTGGTGG - Intronic
1146787223 17:35731317-35731339 CACCCTTCGCTCAGCCCTTGAGG + Intronic
1147914849 17:43880067-43880089 CCCCCGTTTCCCAGCCTTGGAGG + Intronic
1148051894 17:44773611-44773633 TGCCCTTGTCTTAGCCCTGGTGG + Intronic
1150002704 17:61451767-61451789 CCTCCTTGTCCCGGCCCAGGGGG - Intergenic
1151188843 17:72383076-72383098 CATCCTTGACCCACTCCTGGGGG - Intergenic
1151566375 17:74900823-74900845 CACCCTGGTCCAGGGCCTGGAGG + Intergenic
1151726986 17:75891018-75891040 CCCCGTTGTGCCAGGCCTGGAGG + Exonic
1151834802 17:76575515-76575537 CTGCCTTTTCCCAGCTCTGGCGG - Intronic
1152094276 17:78263906-78263928 CACTCTTGCCCATGCCCTGGTGG - Intergenic
1152252299 17:79218481-79218503 CACGCTCGGCCAAGCCCTGGGGG - Intronic
1152273789 17:79341964-79341986 CCCTCTTGCCCCAGCCTTGGGGG - Intronic
1152642928 17:81456673-81456695 AAGCCATGACCCAGCCCTGGTGG - Intronic
1152923643 17:83078247-83078269 CACCCTTGTCCCAGCTTTCCTGG + Intergenic
1155168219 18:23248018-23248040 CAGCCTTGTCCTAGCTCTTGGGG - Intronic
1155339812 18:24802651-24802673 CACCCTTTCCCAAGACCTGGAGG + Intergenic
1157621434 18:49019268-49019290 CACCAGTGTCCCAGGCCTGGCGG + Intergenic
1158392000 18:57051640-57051662 CACCCTGGCCCCTGCTCTGGGGG - Intergenic
1158647830 18:59263738-59263760 CACACCTCCCCCAGCCCTGGCGG - Intergenic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1160866763 19:1259650-1259672 CTGGCTTGACCCAGCCCTGGGGG + Intronic
1161119370 19:2516943-2516965 CACCCCAGCCCCAGCCCTGCTGG - Intronic
1161153983 19:2722841-2722863 CACCCTGACCCCAGCCCTGCGGG + Intronic
1161521429 19:4725930-4725952 CACCCTAATCCCAGCCCCGCAGG - Intergenic
1161748295 19:6075145-6075167 CACACATCTCTCAGCCCTGGAGG - Intronic
1161811931 19:6476276-6476298 CGCCCTTGTCCCGCCCCTAGGGG + Intronic
1161985471 19:7651066-7651088 CATCCATCTCCCTGCCCTGGTGG - Intergenic
1162564041 19:11435359-11435381 CAACCTTATCCCGCCCCTGGGGG + Intronic
1162769487 19:12940534-12940556 CGGGCTTGTCCCAGTCCTGGGGG - Exonic
1163294428 19:16403234-16403256 CACCCTCTTCCCAGTCCAGGGGG - Intronic
1163786600 19:19277906-19277928 CACCACAGCCCCAGCCCTGGTGG - Intronic
1164079822 19:21852400-21852422 GACCCTCGTCCCATCCCTGAGGG + Intergenic
1164569840 19:29365948-29365970 CAGGCTGGTCCCAGCCCTGGGGG + Intergenic
1166265638 19:41682614-41682636 CACCCAGGTCCCACCCCAGGTGG + Intronic
1166466791 19:43039831-43039853 TGCCCTAGTCCCAGCCCGGGTGG + Intronic
1166472928 19:43095909-43095931 TGCCCTAGTCCCAGCCCGGGTGG + Intronic
1167714036 19:51129488-51129510 CACCCTTGTTCTTGCCCTAGTGG - Intronic
1168179865 19:54654608-54654630 CCACCTTGTCTCTGCCCTGGAGG + Intronic
925034530 2:675696-675718 CAGCCTTCTCCCAGCGCAGGAGG + Intronic
925100727 2:1243277-1243299 CAACACTGTCCCAGCCCAGGGGG + Intronic
926207737 2:10846001-10846023 CACCCTTGTCCCAGCCCTGGGGG + Intergenic
927139054 2:20117627-20117649 CACGCTGGCCCCAGCCCTGCTGG - Intergenic
927783483 2:25956732-25956754 CATCCTCCTCCTAGCCCTGGTGG - Intronic
931177628 2:59869855-59869877 CCTCCTTGTCCCAGTCTTGGAGG - Intergenic
932697642 2:73970047-73970069 CTCCCATGTGCCAGCGCTGGTGG - Intergenic
932779986 2:74553891-74553913 CACTCTTCTCCCAGCCCTTAGGG - Exonic
933978003 2:87527485-87527507 CACCCTCATCCCAGCCCATGTGG - Intergenic
935131810 2:100266241-100266263 CACCATTGTGCCAGCACTGGGGG + Intergenic
936151212 2:110023337-110023359 CAACCTCGTGCCTGCCCTGGGGG - Intergenic
936193463 2:110348032-110348054 CAACCTCGTGCCTGCCCTGGGGG + Intergenic
936315829 2:111423322-111423344 CACCCTCATCCCAGCCCATGTGG + Intergenic
937897762 2:126991407-126991429 CACCCTTTTCCCAGCCCTTTGGG + Intergenic
938243704 2:129761781-129761803 CCCTCTTGTCACAGCCCCGGTGG + Intergenic
938289055 2:130139986-130140008 CACCCCTGCCCCATCCCTGGGGG - Intronic
939233044 2:139455053-139455075 CACTCATGTCTCAGCTCTGGGGG + Intergenic
940282319 2:152000795-152000817 CAGTCTTGTCCCAGCCCAAGAGG - Intronic
942168644 2:173267390-173267412 CATCCTTGGCTCAGCCCTGCTGG + Exonic
944318279 2:198306890-198306912 GACCCTTGTCCCAGCCAGGCAGG + Intronic
945040431 2:205739428-205739450 TTCTCTTGTCCCAGCCCTGTTGG + Intronic
945622954 2:212165386-212165408 CACCATAATCCCAGCCCTGAGGG + Intronic
946009842 2:216555565-216555587 CACCAGTGTGCCAGGCCTGGGGG + Intronic
948182209 2:235990905-235990927 GAACCTTGCCCCACCCCTGGTGG - Intronic
948859787 2:240747201-240747223 CTCCCGAGTCCCAGACCTGGAGG - Intronic
1168810262 20:700260-700282 GACCTTTCTCCCAGGCCTGGGGG - Intergenic
1168887544 20:1270129-1270151 CACCCTTGTTCCAGTATTGGAGG + Intronic
1169191760 20:3662487-3662509 CACCCTGCTCCCAGCCCTGGGGG - Intronic
1171372165 20:24668908-24668930 AAGCCCTGTCCCAGCTCTGGAGG - Intergenic
1171382738 20:24745808-24745830 CAGCCAGGTCCCTGCCCTGGAGG - Intergenic
1172057898 20:32166814-32166836 AACCCTTGCACCAGCCCTTGTGG + Exonic
1172380360 20:34484940-34484962 CTCCCTTCTCCCAGCCCCAGAGG + Intronic
1172408903 20:34708586-34708608 TACCCTTCTCCCTGCTCTGGGGG + Intronic
1172648096 20:36483998-36484020 CACCTAACTCCCAGCCCTGGAGG + Intronic
1172798008 20:37556588-37556610 CACCCTAGTCCTGGACCTGGTGG + Intergenic
1173661151 20:44734633-44734655 CACCTGTGTCCCACCCCTGCTGG - Intergenic
1174767174 20:53265321-53265343 CTCCCTTGTCTCAGCCTTTGTGG - Intronic
1175116971 20:56689565-56689587 CACGCTGTTCCCAGCCCTGGTGG + Intergenic
1175136383 20:56827419-56827441 CAGCCTTGTCCCAGGCCGGGCGG - Intergenic
1175278767 20:57788734-57788756 GACTCTTATCCCTGCCCTGGAGG + Intergenic
1175290066 20:57869743-57869765 GAGACCTGTCCCAGCCCTGGGGG + Intergenic
1175293890 20:57895741-57895763 GACACCTGCCCCAGCCCTGGGGG + Intergenic
1176089286 20:63311856-63311878 CACCCTTGCCCCTGCCATGGAGG + Intronic
1176102596 20:63371360-63371382 GGACCCTGTCCCAGCCCTGGTGG + Intronic
1176104267 20:63378319-63378341 CAGCTGTGGCCCAGCCCTGGGGG + Intronic
1176140485 20:63542697-63542719 CCCCTTTGTCCCAGCCAGGGTGG - Intronic
1179575457 21:42305704-42305726 CAGCCTTTTCCCAGCAGTGGAGG - Intergenic
1179950803 21:44707918-44707940 CACCCTTCCCGGAGCCCTGGGGG + Intronic
1180087596 21:45514931-45514953 CACACTTGTGCCAGCCCGGAGGG - Exonic
1180850828 22:19019227-19019249 CACCCCTGTCCCGGCCCCGGGGG - Intergenic
1181363121 22:22354083-22354105 CAGCCTTGCCTCAGCCATGGTGG - Intergenic
1182376076 22:29849053-29849075 AAACCATGTCCCAGCCCTTGAGG - Intergenic
1182472716 22:30558460-30558482 CAGCCCTGGCCCAGGCCTGGGGG - Intronic
1182542150 22:31049455-31049477 GTCCCTTGTCCCTGCCCTTGTGG - Intergenic
1182711703 22:32327383-32327405 CTGCCTTGTCAAAGCCCTGGTGG + Intergenic
1183618830 22:38960917-38960939 CACCCCAGACCCAGCCCTGCAGG - Intronic
1183624033 22:38990862-38990884 CACCCCAGACCCAGCCCTGCAGG - Intronic
1183987564 22:41577876-41577898 AGCGCTTGTCCCAGCCCTCGGGG + Exonic
1184399234 22:44264171-44264193 CTGCCTTGTCAAAGCCCTGGTGG + Intronic
1184679312 22:46061777-46061799 AACCCTCGTCCCTGCCCAGGCGG + Intronic
1184732572 22:46378783-46378805 CAGCCTTTGCCCAGCCCTGGGGG + Intronic
950016224 3:9756918-9756940 CACCCCTGTCCCAACCCCAGTGG + Intronic
950535166 3:13574384-13574406 CTCCATTGTGCCAGCCCTGCGGG + Intronic
950569595 3:13791901-13791923 CACCCTTCTCCGTGCCCTGGGGG + Intergenic
951868464 3:27333784-27333806 CACCTCTGTCCCAGCACTGCTGG - Intronic
952529222 3:34246091-34246113 TACCCTTGGCCCAGCCAGGGAGG - Intergenic
953352061 3:42223140-42223162 CGGCCCTGTCCCAGCTCTGGGGG - Exonic
953360821 3:42294832-42294854 CACATTTGTCCCGGTCCTGGAGG + Intergenic
953850706 3:46463868-46463890 CATCCTTGTCCCTGCCCTTCTGG - Intronic
953884639 3:46708384-46708406 CACCTTGGCCCCAGCCCTAGAGG - Intronic
954389432 3:50260921-50260943 CTCCATTGTCCCAGCACTGGTGG + Intergenic
955136907 3:56228051-56228073 CACTCTTCTGCCAGCCCTTGAGG - Intronic
955972094 3:64445739-64445761 CACCCTTGTCCCCAGCCTAGGGG + Intergenic
956728042 3:72172611-72172633 CATCCTAATCCCAGCCCTGTTGG - Intergenic
958557349 3:95697152-95697174 CAACTTTGTCCAAGCCCTGAAGG + Intergenic
961135668 3:124508284-124508306 CTCCCTGGTCACAACCCTGGAGG + Intronic
961701614 3:128748928-128748950 CACCCTTCTCCCTGCCCCAGTGG - Intronic
961780241 3:129316666-129316688 GAGCCTTGTCCCGGCCCGGGGGG + Intergenic
962222382 3:133574265-133574287 CACCTTCGTCACAGCCTTGGTGG - Exonic
962676677 3:137763163-137763185 AACCATTGTCCCAGGCCCGGCGG - Intergenic
966616549 3:181919591-181919613 CATCTTTGTCCCAGTACTGGTGG - Intergenic
968047168 3:195630945-195630967 CCTCCGTGACCCAGCCCTGGAGG + Intergenic
968307479 3:197659099-197659121 CCTCCGTGACCCAGCCCTGGAGG - Intergenic
968442369 4:630348-630370 CACCCTGGTCCCAGCCTGGCTGG - Intronic
969138879 4:5051970-5051992 CACCCTCGGCCGAGCCCTGCGGG + Intronic
969603315 4:8189541-8189563 CTCCCCTCTCCCACCCCTGGCGG - Intronic
970505429 4:16724463-16724485 CTTCCAGGTCCCAGCCCTGGAGG - Intronic
973905556 4:55526612-55526634 CACCTTTTCCCCAGACCTGGGGG - Intronic
976049057 4:80989444-80989466 GACCTTTGTCCAAGACCTGGAGG + Intergenic
979459524 4:120965530-120965552 GAACCTGGTCCCACCCCTGGCGG - Intergenic
979669039 4:123343112-123343134 CACCCCTGTCCCAGTGCTGCAGG - Intergenic
979770969 4:124524701-124524723 CACCATTGTCCCAGCTGGGGTGG + Intergenic
983634634 4:169884750-169884772 CAACCTTGTTCCTGCCTTGGAGG + Intergenic
983810462 4:172054451-172054473 AACACTTGTCACAGCTCTGGAGG + Intronic
985744436 5:1638187-1638209 CTCCAGTGACCCAGCCCTGGAGG - Intergenic
985933178 5:3075391-3075413 CACCCTTGCCCCTCCCCAGGAGG + Intergenic
986627641 5:9737550-9737572 CACCCTTGTCATCGCCCTGGAGG - Intergenic
986998750 5:13637624-13637646 CACCCTTTGCCCAGCACTGTGGG + Intergenic
987316709 5:16730999-16731021 CATACTTGTGCCAGCCTTGGAGG - Intronic
990295682 5:54399121-54399143 CACCCTCCTCCCTGCCCAGGAGG - Intergenic
992027135 5:72681473-72681495 CTCTCATGTCCCAGTCCTGGTGG + Intergenic
992158861 5:73981222-73981244 CACCATTTTCCCAGCCTTGCTGG - Intergenic
992608858 5:78490252-78490274 CACCCTAGTCCTAGCTCTGGTGG - Intronic
993487572 5:88505286-88505308 CACTCTACACCCAGCCCTGGAGG + Intergenic
996524063 5:124459102-124459124 CAGGCTTGCCCCAGCCCTGCAGG - Intergenic
997197683 5:131990636-131990658 CAGCTTTGTTCCAGCCCTTGGGG - Intronic
997511664 5:134458784-134458806 CTCCAATGTCCCAGCCCTGCTGG - Intergenic
997597809 5:135118842-135118864 CACCCGTGTCTCAGCTGTGGAGG + Intronic
997607046 5:135182687-135182709 CCCCCTTGAGCCAGGCCTGGGGG - Intronic
998205690 5:140155454-140155476 AACCCTGGCCCCAGCCCTGGGGG - Intergenic
998692553 5:144603193-144603215 CACACTTGTCCCATCCTTAGAGG - Intergenic
999365115 5:151018464-151018486 CACCTTAATCCCAGCCCTGGTGG - Intergenic
999450235 5:151672406-151672428 GACCCTTGTCCCAGGGCTGCCGG - Intronic
1001295921 5:170498928-170498950 CACCCTTTCCCCTGCCCTGAAGG + Intronic
1002058410 5:176611772-176611794 CACCCTTGTCCTGTCCCAGGGGG - Intergenic
1002099720 5:176851423-176851445 CACCCCGGCCCCAGCTCTGGCGG + Intronic
1002134453 5:177099132-177099154 CTCCCTGGTTCCTGCCCTGGAGG - Intergenic
1002458975 5:179363301-179363323 CACCCATGTTTCAGCTCTGGGGG + Intergenic
1002705875 5:181160665-181160687 CGACCTGGCCCCAGCCCTGGGGG - Intergenic
1005298356 6:24448055-24448077 CACATTTTACCCAGCCCTGGTGG + Intronic
1006424612 6:33956320-33956342 CCTCCTTGTCCCAGCACAGGGGG + Intergenic
1006589206 6:35141666-35141688 GAGCCTGGCCCCAGCCCTGGCGG - Intronic
1007110421 6:39310419-39310441 CCCCCGTTTCTCAGCCCTGGGGG - Intronic
1007335854 6:41154409-41154431 CTCCCTTTCCCCACCCCTGGAGG - Intergenic
1007389286 6:41541048-41541070 CAGCCTCGCCCCAGTCCTGGGGG + Intergenic
1010031925 6:71280198-71280220 CACTCTAGTCCCAGCCCTGCAGG - Intergenic
1017715990 6:157213487-157213509 CACCTTTTTCGCAGACCTGGGGG + Intergenic
1017893197 6:158656217-158656239 CCCTCTTCTCCCAGGCCTGGCGG + Intronic
1018202679 6:161410251-161410273 AGCCCTTGTCCCAGAGCTGGTGG + Intronic
1018669273 6:166166554-166166576 CTCGCTGGTCCCAGACCTGGCGG + Intronic
1019486835 7:1293290-1293312 CACCCCTTTGCCGGCCCTGGGGG - Intergenic
1021141662 7:17033459-17033481 CAGCCTCGGCCAAGCCCTGGTGG - Intergenic
1022097358 7:27149065-27149087 CACTGCTGTCCCAGGCCTGGCGG + Intronic
1022660485 7:32362093-32362115 CATCGTTCTCCCCGCCCTGGGGG - Intergenic
1024797813 7:53038533-53038555 CACTCTTGTCCAAGCCATGAAGG + Intergenic
1027306001 7:76898275-76898297 AACCCTTGTCCCTTACCTGGTGG + Intergenic
1028173603 7:87628405-87628427 CACTCGTGCCCCAGCCCGGGAGG - Exonic
1029521291 7:101064319-101064341 CACCCATGTCCCAGGCCACGTGG + Intergenic
1030314615 7:108101835-108101857 CACTCTAGTCCCAGTCCTGCAGG + Intronic
1030907700 7:115206844-115206866 GACCCTTGACCCAGCCCTGGAGG + Intergenic
1031519280 7:122743579-122743601 CACCCATGCCCCAATCCTGGAGG - Intronic
1031583509 7:123505697-123505719 CCCTCTTGTCACAGGCCTGGAGG - Intronic
1031915549 7:127559702-127559724 AACTCTGGTCCCAGCCCTGTAGG + Intergenic
1031975444 7:128090670-128090692 CTCCCTTCTCCCAGCCCTCCTGG + Intronic
1032001802 7:128270783-128270805 CTCCCCTGTCCAGGCCCTGGGGG - Intergenic
1034489942 7:151387688-151387710 CAGCCTTCTCCCACCCCTGCGGG - Intronic
1036987866 8:13556917-13556939 CAGACTTTTTCCAGCCCTGGTGG + Intergenic
1037609513 8:20464422-20464444 CATCCTAGTCCCAACCCTGGTGG + Intergenic
1037709954 8:21347633-21347655 CCCCCATGTCCCTCCCCTGGGGG - Intergenic
1039928302 8:41959385-41959407 AACCCTTGTCCCATTGCTGGCGG + Intronic
1041143116 8:54843743-54843765 CACCCTTGCTCCAGTCCTGCAGG + Intergenic
1043163049 8:76870234-76870256 TGACCTTGTCCCAGGCCTGGAGG + Intergenic
1047803438 8:128333568-128333590 CACCCTAGTGCCAGTCCTGTTGG - Intergenic
1048930994 8:139315312-139315334 TACCCTAGTCCCAGCCCTGGTGG + Intergenic
1049238750 8:141525886-141525908 CACCCCAGCCCCAGACCTGGTGG + Intergenic
1049400973 8:142427072-142427094 CATCCCTGTCCCTGGCCTGGAGG - Intergenic
1049404838 8:142447715-142447737 CCCCCTCCTCCCAGTCCTGGCGG - Intergenic
1049614964 8:143572059-143572081 CACCCTGTCCTCAGCCCTGGAGG - Exonic
1049686785 8:143942287-143942309 CACCCCCATCCCAGCCCAGGCGG + Intronic
1050413298 9:5388549-5388571 CACTCTTTCCCCAGCCCTTGAGG + Intronic
1051666358 9:19470277-19470299 CACCCTGGCCACATCCCTGGAGG + Intergenic
1052739456 9:32379544-32379566 CTCCCTTGCCCCATCCTTGGTGG - Intergenic
1053569489 9:39288935-39288957 CACCCTAGTCCTGGCCTTGGTGG + Intergenic
1053835450 9:42129955-42129977 CACCCTAGTCCTGGCCTTGGTGG + Intergenic
1054091120 9:60847920-60847942 CACCCTAGTCCTGGCCTTGGTGG + Intergenic
1054112531 9:61123476-61123498 CACCCTAGTCCTGGCCTTGGTGG + Intergenic
1054127657 9:61330074-61330096 CACCCTAGTCCTGGCCTTGGTGG - Intergenic
1054595175 9:67058655-67058677 CACCCTAGTCCTGGCCTTGGTGG - Intergenic
1056754292 9:89372439-89372461 CACCCTGGTACCAGCCGTGAAGG - Intronic
1057052315 9:91935270-91935292 CACCCCTGCCCCTGCCCTGCGGG + Intronic
1058939197 9:109797663-109797685 CACACATGCCCCTGCCCTGGCGG - Intronic
1059459590 9:114421287-114421309 CAACCTTGTCCCAGCTCAGGGGG - Intronic
1061798210 9:133100728-133100750 GTCCCTAGTCCAAGCCCTGGAGG + Intronic
1061801168 9:133114122-133114144 CACCCTTCCCCCACCCCCGGGGG + Intronic
1061869474 9:133513149-133513171 CAGCTATCTCCCAGCCCTGGAGG + Intergenic
1062461927 9:136665863-136665885 CGCCCTCGACCCAGCCCGGGCGG - Intronic
1062600758 9:137317699-137317721 CACCCTCCTGTCAGCCCTGGGGG + Intronic
1062653376 9:137589965-137589987 CACCCTCGGCCCTGCCCTGCCGG - Intronic
1186725416 X:12353068-12353090 CACTCTCGTCCTAGCCCTGCGGG - Intronic
1187349121 X:18495728-18495750 CACTCTTCTCATAGCCCTGGTGG + Intronic
1187464919 X:19518613-19518635 TGCCCTCGTTCCAGCCCTGGCGG + Intergenic
1188071661 X:25725929-25725951 CACCCCTCTCCCAGCCCAAGAGG - Intergenic
1189236549 X:39491480-39491502 CATCCCTGTCCCATCCCTGTAGG + Intergenic
1192331247 X:70177158-70177180 CACACTTGTTCCTGCCCTAGTGG - Intergenic
1192502056 X:71660830-71660852 CACCCCTATCACTGCCCTGGGGG - Intergenic
1195344134 X:103931849-103931871 CACCCCTCTCCCCTCCCTGGAGG - Intronic
1195975817 X:110525289-110525311 CACCGTAGTCCCAGCCCTGATGG - Intergenic
1200062338 X:153489133-153489155 CACCCTTGTCCCAGTCATGAGGG - Intronic
1200244525 X:154516022-154516044 CATCTTCGTCCCAGCCCCGGAGG - Exonic
1200247564 X:154534230-154534252 CACCCTTGTCTGAGTTCTGGAGG + Intronic
1200274032 X:154715074-154715096 CACTCTTGTGCCTGTCCTGGAGG + Intronic
1201145824 Y:11065012-11065034 CACCCTTGCCCCAGTGCTGATGG + Intergenic
1201377975 Y:13342612-13342634 CACACTTGTCTCAGACCTGAAGG + Intronic