ID: 926209134

View in Genome Browser
Species Human (GRCh38)
Location 2:10856132-10856154
Sequence GTGTGTTGGGGGGGGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2981
Summary {0: 1, 1: 6, 2: 46, 3: 349, 4: 2579}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926209122_926209134 16 Left 926209122 2:10856093-10856115 CCGGAGGAGCTTGGCAGAAAAGT 0: 1
1: 0
2: 1
3: 13
4: 211
Right 926209134 2:10856132-10856154 GTGTGTTGGGGGGGGGTGGTGGG 0: 1
1: 6
2: 46
3: 349
4: 2579
926209121_926209134 19 Left 926209121 2:10856090-10856112 CCACCGGAGGAGCTTGGCAGAAA 0: 1
1: 0
2: 0
3: 7
4: 100
Right 926209134 2:10856132-10856154 GTGTGTTGGGGGGGGGTGGTGGG 0: 1
1: 6
2: 46
3: 349
4: 2579

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926209134 Original CRISPR GTGTGTTGGGGGGGGGTGGT GGG Intergenic
Too many off-targets to display for this crispr