ID: 926209888

View in Genome Browser
Species Human (GRCh38)
Location 2:10862052-10862074
Sequence ATGTAAAGACTGCACTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926209888_926209900 -4 Left 926209888 2:10862052-10862074 CCTCCCCAGTGCAGTCTTTACAT No data
Right 926209900 2:10862071-10862093 ACATGGTCGGGGGCATGGTGGGG No data
926209888_926209898 -6 Left 926209888 2:10862052-10862074 CCTCCCCAGTGCAGTCTTTACAT No data
Right 926209898 2:10862069-10862091 TTACATGGTCGGGGGCATGGTGG No data
926209888_926209901 13 Left 926209888 2:10862052-10862074 CCTCCCCAGTGCAGTCTTTACAT No data
Right 926209901 2:10862088-10862110 GTGGGGAAGTCCCTGAAAGCAGG No data
926209888_926209902 14 Left 926209888 2:10862052-10862074 CCTCCCCAGTGCAGTCTTTACAT No data
Right 926209902 2:10862089-10862111 TGGGGAAGTCCCTGAAAGCAGGG No data
926209888_926209899 -5 Left 926209888 2:10862052-10862074 CCTCCCCAGTGCAGTCTTTACAT No data
Right 926209899 2:10862070-10862092 TACATGGTCGGGGGCATGGTGGG No data
926209888_926209897 -9 Left 926209888 2:10862052-10862074 CCTCCCCAGTGCAGTCTTTACAT No data
Right 926209897 2:10862066-10862088 TCTTTACATGGTCGGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926209888 Original CRISPR ATGTAAAGACTGCACTGGGG AGG (reversed) Intergenic
No off target data available for this crispr