ID: 926210944

View in Genome Browser
Species Human (GRCh38)
Location 2:10868946-10868968
Sequence TGCCACGGCCTAGGGGCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926210924_926210944 30 Left 926210924 2:10868893-10868915 CCAAGGTCCAAACCACTCCTGTG No data
Right 926210944 2:10868946-10868968 TGCCACGGCCTAGGGGCCTGCGG No data
926210932_926210944 2 Left 926210932 2:10868921-10868943 CCAGGCCCTGGTTCAGCCCACCC No data
Right 926210944 2:10868946-10868968 TGCCACGGCCTAGGGGCCTGCGG No data
926210934_926210944 -4 Left 926210934 2:10868927-10868949 CCTGGTTCAGCCCACCCCATGCC No data
Right 926210944 2:10868946-10868968 TGCCACGGCCTAGGGGCCTGCGG No data
926210927_926210944 23 Left 926210927 2:10868900-10868922 CCAAACCACTCCTGTGGGTTTCC No data
Right 926210944 2:10868946-10868968 TGCCACGGCCTAGGGGCCTGCGG No data
926210929_926210944 18 Left 926210929 2:10868905-10868927 CCACTCCTGTGGGTTTCCAGGCC No data
Right 926210944 2:10868946-10868968 TGCCACGGCCTAGGGGCCTGCGG No data
926210933_926210944 -3 Left 926210933 2:10868926-10868948 CCCTGGTTCAGCCCACCCCATGC No data
Right 926210944 2:10868946-10868968 TGCCACGGCCTAGGGGCCTGCGG No data
926210931_926210944 13 Left 926210931 2:10868910-10868932 CCTGTGGGTTTCCAGGCCCTGGT No data
Right 926210944 2:10868946-10868968 TGCCACGGCCTAGGGGCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926210944 Original CRISPR TGCCACGGCCTAGGGGCCTG CGG Intergenic
No off target data available for this crispr