ID: 926221950

View in Genome Browser
Species Human (GRCh38)
Location 2:10942235-10942257
Sequence CTGCTCGTTGTCCCTGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926221943_926221950 5 Left 926221943 2:10942207-10942229 CCATCCCTAGTAGGACAGAGCTG No data
Right 926221950 2:10942235-10942257 CTGCTCGTTGTCCCTGCCATGGG No data
926221940_926221950 25 Left 926221940 2:10942187-10942209 CCTCTGACCTGGAGATCATGCCA No data
Right 926221950 2:10942235-10942257 CTGCTCGTTGTCCCTGCCATGGG No data
926221941_926221950 18 Left 926221941 2:10942194-10942216 CCTGGAGATCATGCCATCCCTAG No data
Right 926221950 2:10942235-10942257 CTGCTCGTTGTCCCTGCCATGGG No data
926221946_926221950 1 Left 926221946 2:10942211-10942233 CCCTAGTAGGACAGAGCTGGGCG No data
Right 926221950 2:10942235-10942257 CTGCTCGTTGTCCCTGCCATGGG No data
926221947_926221950 0 Left 926221947 2:10942212-10942234 CCTAGTAGGACAGAGCTGGGCGC No data
Right 926221950 2:10942235-10942257 CTGCTCGTTGTCCCTGCCATGGG No data
926221939_926221950 30 Left 926221939 2:10942182-10942204 CCACACCTCTGACCTGGAGATCA No data
Right 926221950 2:10942235-10942257 CTGCTCGTTGTCCCTGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926221950 Original CRISPR CTGCTCGTTGTCCCTGCCAT GGG Intergenic
No off target data available for this crispr