ID: 926224181

View in Genome Browser
Species Human (GRCh38)
Location 2:10955567-10955589
Sequence CTGCCCTGCACCTGGGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926224174_926224181 -6 Left 926224174 2:10955550-10955572 CCTGGCCCTGCTTCCTCCTGCCC No data
Right 926224181 2:10955567-10955589 CTGCCCTGCACCTGGGCTCCAGG No data
926224168_926224181 25 Left 926224168 2:10955519-10955541 CCAGCAGGACAGCAAACAGGGCT No data
Right 926224181 2:10955567-10955589 CTGCCCTGCACCTGGGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926224181 Original CRISPR CTGCCCTGCACCTGGGCTCC AGG Intergenic
No off target data available for this crispr