ID: 926227776

View in Genome Browser
Species Human (GRCh38)
Location 2:10980701-10980723
Sequence GCCCAGAGCAGGCCCCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926227776_926227785 1 Left 926227776 2:10980701-10980723 CCAGCCAGGGGCCTGCTCTGGGC No data
Right 926227785 2:10980725-10980747 CGGCATGGTGCTTGTTATCGGGG No data
926227776_926227782 -1 Left 926227776 2:10980701-10980723 CCAGCCAGGGGCCTGCTCTGGGC No data
Right 926227782 2:10980723-10980745 CCCGGCATGGTGCTTGTTATCGG No data
926227776_926227786 2 Left 926227776 2:10980701-10980723 CCAGCCAGGGGCCTGCTCTGGGC No data
Right 926227786 2:10980726-10980748 GGCATGGTGCTTGTTATCGGGGG No data
926227776_926227784 0 Left 926227776 2:10980701-10980723 CCAGCCAGGGGCCTGCTCTGGGC No data
Right 926227784 2:10980724-10980746 CCGGCATGGTGCTTGTTATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926227776 Original CRISPR GCCCAGAGCAGGCCCCTGGC TGG (reversed) Intergenic
No off target data available for this crispr