ID: 926228402

View in Genome Browser
Species Human (GRCh38)
Location 2:10984437-10984459
Sequence CTGGGCACTGAGAAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926228402_926228407 -6 Left 926228402 2:10984437-10984459 CCTGCCTCCTTCTCAGTGCCCAG No data
Right 926228407 2:10984454-10984476 GCCCAGTCCCCTCGGCTGGCAGG No data
926228402_926228406 -10 Left 926228402 2:10984437-10984459 CCTGCCTCCTTCTCAGTGCCCAG No data
Right 926228406 2:10984450-10984472 CAGTGCCCAGTCCCCTCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926228402 Original CRISPR CTGGGCACTGAGAAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr