ID: 926228603

View in Genome Browser
Species Human (GRCh38)
Location 2:10986046-10986068
Sequence CTGGCTCCCCTCACCCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926228603_926228614 10 Left 926228603 2:10986046-10986068 CCATGATGGGTGAGGGGAGCCAG No data
Right 926228614 2:10986079-10986101 AAGCTGGGACTGTGGTGGGATGG No data
926228603_926228611 2 Left 926228603 2:10986046-10986068 CCATGATGGGTGAGGGGAGCCAG No data
Right 926228611 2:10986071-10986093 GGGGACAGAAGCTGGGACTGTGG No data
926228603_926228618 29 Left 926228603 2:10986046-10986068 CCATGATGGGTGAGGGGAGCCAG No data
Right 926228618 2:10986098-10986120 ATGGCACATGGGCTGGACTGAGG No data
926228603_926228613 6 Left 926228603 2:10986046-10986068 CCATGATGGGTGAGGGGAGCCAG No data
Right 926228613 2:10986075-10986097 ACAGAAGCTGGGACTGTGGTGGG No data
926228603_926228609 -5 Left 926228603 2:10986046-10986068 CCATGATGGGTGAGGGGAGCCAG No data
Right 926228609 2:10986064-10986086 GCCAGGCGGGGACAGAAGCTGGG No data
926228603_926228617 22 Left 926228603 2:10986046-10986068 CCATGATGGGTGAGGGGAGCCAG No data
Right 926228617 2:10986091-10986113 TGGTGGGATGGCACATGGGCTGG No data
926228603_926228616 18 Left 926228603 2:10986046-10986068 CCATGATGGGTGAGGGGAGCCAG No data
Right 926228616 2:10986087-10986109 ACTGTGGTGGGATGGCACATGGG No data
926228603_926228608 -6 Left 926228603 2:10986046-10986068 CCATGATGGGTGAGGGGAGCCAG No data
Right 926228608 2:10986063-10986085 AGCCAGGCGGGGACAGAAGCTGG No data
926228603_926228615 17 Left 926228603 2:10986046-10986068 CCATGATGGGTGAGGGGAGCCAG No data
Right 926228615 2:10986086-10986108 GACTGTGGTGGGATGGCACATGG No data
926228603_926228612 5 Left 926228603 2:10986046-10986068 CCATGATGGGTGAGGGGAGCCAG No data
Right 926228612 2:10986074-10986096 GACAGAAGCTGGGACTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926228603 Original CRISPR CTGGCTCCCCTCACCCATCA TGG (reversed) Intergenic
No off target data available for this crispr