ID: 926229579

View in Genome Browser
Species Human (GRCh38)
Location 2:10992456-10992478
Sequence TTTGTGGCCCACTGAGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926229574_926229579 -7 Left 926229574 2:10992440-10992462 CCACCTATATTGGACCTTTGTGG No data
Right 926229579 2:10992456-10992478 TTTGTGGCCCACTGAGAAGGTGG No data
926229570_926229579 15 Left 926229570 2:10992418-10992440 CCCTGTGTAGAGGCCACACTGTC No data
Right 926229579 2:10992456-10992478 TTTGTGGCCCACTGAGAAGGTGG No data
926229567_926229579 24 Left 926229567 2:10992409-10992431 CCCCAGATGCCCTGTGTAGAGGC No data
Right 926229579 2:10992456-10992478 TTTGTGGCCCACTGAGAAGGTGG No data
926229565_926229579 25 Left 926229565 2:10992408-10992430 CCCCCAGATGCCCTGTGTAGAGG No data
Right 926229579 2:10992456-10992478 TTTGTGGCCCACTGAGAAGGTGG No data
926229568_926229579 23 Left 926229568 2:10992410-10992432 CCCAGATGCCCTGTGTAGAGGCC No data
Right 926229579 2:10992456-10992478 TTTGTGGCCCACTGAGAAGGTGG No data
926229573_926229579 2 Left 926229573 2:10992431-10992453 CCACACTGTCCACCTATATTGGA No data
Right 926229579 2:10992456-10992478 TTTGTGGCCCACTGAGAAGGTGG No data
926229569_926229579 22 Left 926229569 2:10992411-10992433 CCAGATGCCCTGTGTAGAGGCCA No data
Right 926229579 2:10992456-10992478 TTTGTGGCCCACTGAGAAGGTGG No data
926229571_926229579 14 Left 926229571 2:10992419-10992441 CCTGTGTAGAGGCCACACTGTCC No data
Right 926229579 2:10992456-10992478 TTTGTGGCCCACTGAGAAGGTGG No data
926229576_926229579 -10 Left 926229576 2:10992443-10992465 CCTATATTGGACCTTTGTGGCCC No data
Right 926229579 2:10992456-10992478 TTTGTGGCCCACTGAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926229579 Original CRISPR TTTGTGGCCCACTGAGAAGG TGG Intergenic
No off target data available for this crispr