ID: 926229694

View in Genome Browser
Species Human (GRCh38)
Location 2:10993051-10993073
Sequence AGGGAGTAATTGGAGGACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926229694_926229698 -4 Left 926229694 2:10993051-10993073 CCTAAGTCCTCCAATTACTCCCT No data
Right 926229698 2:10993070-10993092 CCCTGACAACCTCCCTCCTTTGG No data
926229694_926229700 -3 Left 926229694 2:10993051-10993073 CCTAAGTCCTCCAATTACTCCCT No data
Right 926229700 2:10993071-10993093 CCTGACAACCTCCCTCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926229694 Original CRISPR AGGGAGTAATTGGAGGACTT AGG (reversed) Intergenic
No off target data available for this crispr