ID: 926229695

View in Genome Browser
Species Human (GRCh38)
Location 2:10993058-10993080
Sequence GGTTGTCAGGGAGTAATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926229695_926229700 -10 Left 926229695 2:10993058-10993080 CCTCCAATTACTCCCTGACAACC No data
Right 926229700 2:10993071-10993093 CCTGACAACCTCCCTCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926229695 Original CRISPR GGTTGTCAGGGAGTAATTGG AGG (reversed) Intergenic
No off target data available for this crispr