ID: 926229700

View in Genome Browser
Species Human (GRCh38)
Location 2:10993071-10993093
Sequence CCTGACAACCTCCCTCCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926229692_926229700 19 Left 926229692 2:10993029-10993051 CCAAATCTCACTCCAGCAGGTGC No data
Right 926229700 2:10993071-10993093 CCTGACAACCTCCCTCCTTTGGG No data
926229695_926229700 -10 Left 926229695 2:10993058-10993080 CCTCCAATTACTCCCTGACAACC No data
Right 926229700 2:10993071-10993093 CCTGACAACCTCCCTCCTTTGGG No data
926229689_926229700 29 Left 926229689 2:10993019-10993041 CCTGCAGGACCCAAATCTCACTC No data
Right 926229700 2:10993071-10993093 CCTGACAACCTCCCTCCTTTGGG No data
926229694_926229700 -3 Left 926229694 2:10993051-10993073 CCTAAGTCCTCCAATTACTCCCT No data
Right 926229700 2:10993071-10993093 CCTGACAACCTCCCTCCTTTGGG No data
926229693_926229700 7 Left 926229693 2:10993041-10993063 CCAGCAGGTGCCTAAGTCCTCCA No data
Right 926229700 2:10993071-10993093 CCTGACAACCTCCCTCCTTTGGG No data
926229691_926229700 20 Left 926229691 2:10993028-10993050 CCCAAATCTCACTCCAGCAGGTG No data
Right 926229700 2:10993071-10993093 CCTGACAACCTCCCTCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926229700 Original CRISPR CCTGACAACCTCCCTCCTTT GGG Intergenic
No off target data available for this crispr