ID: 926233404

View in Genome Browser
Species Human (GRCh38)
Location 2:11021764-11021786
Sequence TATGAAGGAGTAGTCGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926233401_926233404 12 Left 926233401 2:11021729-11021751 CCGGGATGATGGCATGTTCATCT No data
Right 926233404 2:11021764-11021786 TATGAAGGAGTAGTCGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926233404 Original CRISPR TATGAAGGAGTAGTCGAGGC TGG Intergenic
No off target data available for this crispr