ID: 926243470

View in Genome Browser
Species Human (GRCh38)
Location 2:11105124-11105146
Sequence AACCTCGTCCTGTCACAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926243470_926243471 -3 Left 926243470 2:11105124-11105146 CCACGCTGTGACAGGACGAGGTT No data
Right 926243471 2:11105144-11105166 GTTGTTCCAGAACGTTTCAGAGG No data
926243470_926243473 8 Left 926243470 2:11105124-11105146 CCACGCTGTGACAGGACGAGGTT No data
Right 926243473 2:11105155-11105177 ACGTTTCAGAGGCTACCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926243470 Original CRISPR AACCTCGTCCTGTCACAGCG TGG (reversed) Intergenic
No off target data available for this crispr