ID: 926243530

View in Genome Browser
Species Human (GRCh38)
Location 2:11105469-11105491
Sequence GGTGTGGGAGAGGCAGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 547
Summary {0: 1, 1: 0, 2: 0, 3: 67, 4: 479}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926243526_926243530 -5 Left 926243526 2:11105451-11105473 CCATGACACAGAGTGACGGGTGT 0: 1
1: 0
2: 0
3: 6
4: 78
Right 926243530 2:11105469-11105491 GGTGTGGGAGAGGCAGCCGCCGG 0: 1
1: 0
2: 0
3: 67
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926243530 Original CRISPR GGTGTGGGAGAGGCAGCCGC CGG Intergenic
900102490 1:967790-967812 GGTGTCTGAGATGCAGCCACAGG - Intronic
900242845 1:1625131-1625153 TGTGTGGGCGAGGCAGCGGGCGG + Exonic
900245516 1:1634389-1634411 GGTGCGGGGCAGGCAGCCGGGGG + Intronic
900475296 1:2873568-2873590 GGCCTGGGACAGGCAGCCACTGG + Intergenic
900886873 1:5421393-5421415 AGCGTGGGAGAAGCAGCTGCAGG + Intergenic
900970131 1:5987465-5987487 GGTGGGGCAGAGGCAGCAGCAGG + Intronic
901636342 1:10671993-10672015 GGAGTGGGAGAGGCGGCTCCTGG + Intronic
901637791 1:10678395-10678417 TGTGAGGGAGAGGCAGCAGGTGG + Intronic
902134991 1:14297497-14297519 GATTTGGGAGAGCCAGCTGCAGG + Intergenic
902386518 1:16079024-16079046 TGTGAGTGTGAGGCAGCCGCTGG + Intergenic
902811879 1:18892592-18892614 GGAGAGGGAGAGGCAGGGGCAGG + Intronic
903181827 1:21608680-21608702 GGTCGGGGAGAGGAAGCCGGAGG - Intronic
903190241 1:21652085-21652107 GGTGGGGGAGGGGCTGCCCCGGG - Intronic
903875141 1:26468918-26468940 GGAGCGGAAGAGGCAGCAGCTGG + Exonic
904343359 1:29852432-29852454 GGTGTGAGAGAGACAGGCCCAGG + Intergenic
904642334 1:31939787-31939809 GGTGGGGGAGAAGCACCCACGGG - Intronic
904677133 1:32205494-32205516 GCTGTGGGAGGGGCAGTCGGGGG + Intergenic
904799537 1:33082589-33082611 GGTGAGGGAGAGGGGGCAGCAGG - Intronic
905303175 1:36999278-36999300 GAGGTGGGAGAGGAAGCTGCAGG + Intronic
905375017 1:37514411-37514433 GGAGGGGAAGCGGCAGCCGCAGG - Intronic
905886823 1:41496225-41496247 GGAGAGGGAGAGGCAGCTGCAGG - Intergenic
905894181 1:41534478-41534500 GGTGTGGGACAGGCCTCCGAAGG - Intronic
906125173 1:43423125-43423147 GGTGGGGGAAACGCAGCCGCAGG - Exonic
906345048 1:45009800-45009822 GGTATGGGATAGGGGGCCGCTGG + Intronic
906640654 1:47438816-47438838 GGTGTGGGTGCGGCGGCGGCAGG - Exonic
908753159 1:67444103-67444125 GGAGTGGGTGAGGCTGCTGCAGG + Intergenic
910859692 1:91731569-91731591 GATGTGGGGGAGGCATCCGCAGG - Intronic
911154511 1:94625117-94625139 GGTGGGTAAGAGGCAGCTGCAGG + Intergenic
912183348 1:107245122-107245144 GGTGGGGGAGGGACAGCGGCAGG + Intronic
913133422 1:115863800-115863822 AGTGTGGGAGAGGCTGCAACAGG + Intergenic
914847843 1:151292663-151292685 GGGGTGGGAGAGCCAGCTGTGGG - Exonic
915349445 1:155215235-155215257 CGTGTGGGAGAGGCAGCTGTGGG + Intergenic
915352643 1:155235917-155235939 CATGTGGGAGAGGCAGCTGTGGG + Intronic
916752966 1:167740344-167740366 GGAGTGGCAGAGGCAGCTGTGGG - Intronic
917964375 1:180169181-180169203 GGCGTGGGAGAGGGAGGGGCTGG + Intronic
918424363 1:184393125-184393147 GGTGTGGGATAGGAAGCAGAAGG - Intronic
919880496 1:201897754-201897776 GGAGTGGGACAGACAGCAGCTGG - Exonic
921037903 1:211400017-211400039 GCTGTGTGAGTCGCAGCCGCAGG - Intergenic
921183162 1:212647094-212647116 GGTGTGGGAGAAGCAGGTGCAGG + Intergenic
922102240 1:222486820-222486842 GGAGAGGGAGAGGCAGAGGCAGG - Intergenic
923148673 1:231215328-231215350 AGGGTGGGAGAGGCTGCCGCAGG - Intronic
924173866 1:241369507-241369529 CATGAGGGAGAGGCAGCCTCAGG - Intergenic
924365098 1:243284586-243284608 CGTGTGGGAGAGGGGGCCTCCGG - Intronic
924815641 1:247439443-247439465 GGTGTGGCAGAGGCATCTACAGG - Intronic
1062838409 10:651066-651088 GGTGTGGGAGAGACAAGAGCAGG - Exonic
1064028215 10:11866368-11866390 GGTGATGGAGAGGCACACGCAGG + Intronic
1064137563 10:12764007-12764029 GGTGGGGGAGAGGCAGGCTCAGG - Intronic
1067685936 10:48466142-48466164 GGTGTGGGACCGGCGGCCCCAGG - Intronic
1070933907 10:80279006-80279028 GGTGTGGGGCAGGCAGAGGCAGG + Intronic
1070979325 10:80631793-80631815 GGGCTGGGAGAGGCAGGCACTGG + Intronic
1071016023 10:80997994-80998016 GGTGATGGAGAGGCAGGCACAGG + Intergenic
1071572677 10:86706604-86706626 GCACTGGGAGAGGCAGCAGCAGG - Intronic
1071597585 10:86939514-86939536 GGAATTGCAGAGGCAGCCGCCGG - Intronic
1072723076 10:97792649-97792671 AGGCTGGGAGAGGCAGCAGCTGG + Intergenic
1073075962 10:100826191-100826213 GGGGTGGGGGATGCAGCCACTGG - Intronic
1073592793 10:104772321-104772343 GTTGTGGGAGAGCAAGCAGCTGG - Intronic
1075615995 10:123891437-123891459 GGAGTGGGAGCGGCGCCCGCAGG - Exonic
1075857596 10:125643254-125643276 GGCGGGTGAGAGGCAGCCCCAGG - Intronic
1076827104 10:132974597-132974619 AGTGGGGGAGAGGCAGGTGCGGG - Intergenic
1076881943 10:133243867-133243889 GGCTGGGGAGACGCAGCCGCAGG + Intergenic
1076886404 10:133264793-133264815 GGTGGGGCAGAGGCTGCAGCAGG - Intronic
1077177258 11:1196532-1196554 GGAGTGGGAGATGCAGCGGGAGG - Intronic
1077311523 11:1890937-1890959 GGGGTGGGAGACGGAGACGCGGG + Intronic
1078327046 11:10389331-10389353 GGTGCTGGAGAGACAGCTGCAGG - Intronic
1078987299 11:16608094-16608116 GGTGGGGGAGAGGCAGGCTGAGG + Intronic
1079347415 11:19665077-19665099 GGAGAGGGAGAGGCAGTCCCAGG + Intronic
1079601537 11:22316767-22316789 GGTGGGGGAGAGACAGAGGCAGG - Intergenic
1081593594 11:44444202-44444224 GGTGCCTGAGAGGCAGCCGTGGG + Intergenic
1081705520 11:45180526-45180548 GCGGTGGGAGAGGGCGCCGCGGG - Intronic
1083186829 11:61022501-61022523 GGGGTGAGAGAGGCAGCTCCGGG - Intergenic
1083342521 11:61967750-61967772 TGTGGGGGAGGGGCGGCCGCTGG + Intergenic
1083941585 11:65899319-65899341 GGAGTGGGAGATGCCGCCGGCGG - Intronic
1083950603 11:65953579-65953601 GGCCTGGGAGCGGCAGCGGCAGG + Exonic
1084288223 11:68145596-68145618 GGGGTGGGAGGGGCAGCTTCAGG + Intergenic
1084330472 11:68427010-68427032 GGTGTGGGAGGGACTGACGCAGG - Intronic
1084673869 11:70623216-70623238 AGGGTGGGAGAGGCAGGCACAGG - Intronic
1084949616 11:72657463-72657485 GGAGTGGGAGGGGCAGGGGCCGG - Intronic
1086365859 11:86109774-86109796 GGAGAGGGAGAGGCAGAGGCAGG - Intergenic
1088459276 11:110065356-110065378 GGTAAGGGAGTGGCAGCTGCAGG - Intergenic
1089497430 11:118914724-118914746 GGTGTGGGAGAGGAGGCCTGGGG - Intronic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1090257075 11:125292374-125292396 GGAGTGGCAGTGGCAGCAGCAGG + Intronic
1090375020 11:126282608-126282630 AGTGTGGGAGGGGCAGACCCGGG - Intergenic
1090406551 11:126479216-126479238 GGTGTGGGAGATGCACCCCGAGG - Intronic
1091358702 11:134957759-134957781 GCTGTGGGAGGGGCGGCCTCTGG - Intergenic
1092630707 12:10372868-10372890 GTGGTGGGAGAGGCAGCCTTGGG + Exonic
1093436351 12:19139268-19139290 GGTGTGGGAGGGGGAGCCCCAGG + Intronic
1093715648 12:22378289-22378311 AGAGTGGGAGAGGCAGAAGCAGG + Intronic
1095049105 12:37541463-37541485 CGCGTGGGAGAGGGGGCCGCAGG - Intergenic
1096217458 12:49805928-49805950 GGGGTGGGAGAGGCACCCCTGGG - Intronic
1096406947 12:51350848-51350870 GGAGTGGGAGATGCAGCAGGAGG - Intergenic
1096462272 12:51828644-51828666 GGGATGGGAGAGGCACCCACAGG - Intergenic
1096679031 12:53242524-53242546 GGAGTGGGAGAGGGATCAGCTGG + Intergenic
1097104272 12:56611865-56611887 GCTGTTGGAAAGGCAGCTGCTGG + Exonic
1097144293 12:56929429-56929451 GCTTTGGGAGAGGCTGCCTCAGG - Exonic
1097281350 12:57846793-57846815 GGGGTGGGCGCTGCAGCCGCGGG - Intergenic
1097284852 12:57869373-57869395 GAGATGGGAGAGGCAGCGGCAGG - Intergenic
1098531528 12:71546947-71546969 GTGGTGGGAGAGGCAACCACTGG + Intronic
1101272477 12:103162264-103162286 GGTGGTGGAGAGGCCCCCGCAGG - Intronic
1101875970 12:108597248-108597270 GGTGGGGGTGGGGCAGCCCCCGG - Intronic
1101962377 12:109259656-109259678 GGTCAGGGAGGGGCAGCCCCAGG + Intronic
1102154646 12:110714976-110714998 GGTGTGGCAGAGGGAGCGGGTGG - Intergenic
1102184000 12:110933712-110933734 GGTGCGGGAGAAGCAGCGGTGGG - Intergenic
1102454879 12:113065196-113065218 GGTGGGGCAGGGGCAGCCTCAGG + Intronic
1102770093 12:115468331-115468353 GCTGTGGCAGAGGCAGCCTTAGG - Intergenic
1103005508 12:117417259-117417281 GAGGTGGGAGAGGCAGAGGCTGG + Intronic
1103563460 12:121804247-121804269 GGGGAGGGAGAGGCCGCGGCCGG + Intronic
1104624055 12:130338311-130338333 GGTGCGGGAGATGCAGGAGCCGG + Intronic
1104624069 12:130338353-130338375 GGTGTGGGAGATGCAGGAGCCGG + Intronic
1104624097 12:130338437-130338459 GGTGCGGGAGATGCAGGAGCCGG + Intronic
1104624111 12:130338479-130338501 GGTGTGGGAGATGCAGGAGCCGG + Intronic
1104624124 12:130338521-130338543 GGTGCGGGAGATGCAGAAGCCGG + Intronic
1104624138 12:130338563-130338585 GGTGTGGGAGATGCAGGAGCCGG + Intronic
1104624168 12:130338647-130338669 GGTGTGGGAGATGCAGGAGCCGG + Intronic
1104761757 12:131301000-131301022 GGTGTGGGTGGAGCAGCCACAGG - Intergenic
1104818015 12:131659784-131659806 GGTGTGGGTGGAGCAGCCACAGG + Intergenic
1112487810 13:99835601-99835623 GGTGTGGCAGAGACAGCTGATGG - Intronic
1112917756 13:104572207-104572229 TGTGTGTGAGAGGCAGGTGCTGG - Intergenic
1113119738 13:106913623-106913645 GGTGAGGGGCAGGCAGCCGGTGG - Intergenic
1113378423 13:109784041-109784063 GCAGTGGGAGCGGCAGCTGCAGG - Exonic
1113632029 13:111894322-111894344 AGCGTGGGAGAGGCCGCCTCTGG - Intergenic
1113726471 13:112606483-112606505 GGTGTGGGTGGGGCAGCCCGTGG - Intergenic
1113882924 13:113637912-113637934 GGTGTGGGAGAGGCGTCATCTGG + Intronic
1113928258 13:113952886-113952908 GGCGGGGCAGAGGCAGCCCCCGG + Intergenic
1114525778 14:23366200-23366222 GGGGAGGGAAGGGCAGCCGCGGG - Intergenic
1118325743 14:64779219-64779241 GGTGGAGGAGAGGCTGCCTCTGG - Exonic
1118350950 14:64972202-64972224 CGGGCGGGCGAGGCAGCCGCGGG - Intronic
1119379517 14:74219587-74219609 GGTGGGGGAGAGGGAGGCCCAGG - Intergenic
1119436325 14:74600068-74600090 GGTGGGGGAGAGCCAGCTGACGG + Intronic
1119753646 14:77098557-77098579 GGCGTGGGAGAGGGAATCGCGGG + Intronic
1119889235 14:78170315-78170337 TGTGTGGGAGAGGGAGGGGCCGG + Intergenic
1121875420 14:97446869-97446891 GGTGTGTCAGAGGCAGCAACAGG + Intergenic
1122203688 14:100137680-100137702 GGTGGGGCAGAGGCGGGCGCTGG + Intronic
1122205770 14:100147225-100147247 GCTGTGGCAGAGGCACCCACGGG + Intronic
1122581955 14:102777035-102777057 GGTGCGGGCGAGGTGGCCGCGGG + Intergenic
1122657764 14:103273642-103273664 GGTGCGGCAGAGGCGTCCGCTGG - Intergenic
1122835479 14:104428662-104428684 TGGGTGGGAGGGGCAGCTGCAGG - Intergenic
1122901062 14:104782522-104782544 GGTGCGGGAGGGGCAGGCCCAGG + Intronic
1123025328 14:105421217-105421239 GCTGTGGGAGGGGCTGCCGCTGG - Intronic
1123158721 14:106256525-106256547 GCTGTGGGACAGGCAGAAGCAGG - Intergenic
1124631451 15:31339860-31339882 GCTGTGGGAGATGCAGCAGCGGG + Intronic
1125021066 15:34987714-34987736 AGTGGGGCAGAAGCAGCCGCCGG - Intronic
1125608708 15:40956873-40956895 TGTTAGGAAGAGGCAGCCGCTGG - Intergenic
1125727059 15:41873554-41873576 GGTGGAGGAGAAGCGGCCGCTGG - Exonic
1127849457 15:62900430-62900452 GGGGTAGGATAGGCAGCTGCTGG - Intergenic
1129336460 15:74854787-74854809 GGTGTGGCAGAGGCAGGCACAGG - Intronic
1130193469 15:81758097-81758119 GGTGTAGGGGAGGCAGCTGGTGG - Intergenic
1130330061 15:82915331-82915353 GGTGTGGAAGAGGCAGACAGTGG - Intronic
1131091033 15:89625184-89625206 GCTGTGGGAGAGGCGGGGGCAGG - Exonic
1132803177 16:1763973-1763995 GGTGGGGGCGTGGGAGCCGCGGG - Intronic
1132805066 16:1771541-1771563 GGTGCGGGAGCGGGATCCGCGGG + Exonic
1132938833 16:2496907-2496929 GGTGAGGGCCGGGCAGCCGCTGG + Exonic
1133481990 16:6179645-6179667 GGAGAAGGAGAGGCAGCAGCAGG - Intronic
1133775834 16:8894466-8894488 GGGCTGGGAGGGGCAGCCCCAGG - Intronic
1135382873 16:22008566-22008588 GATGGAGGAGAGGAAGCCGCCGG + Intronic
1137270655 16:46900514-46900536 GGAGTGGGAGGGGAAGACGCTGG - Intronic
1137830674 16:51540062-51540084 TCAGTGGGAGAGGCAGCGGCGGG + Intergenic
1138564245 16:57821224-57821246 GGTCTGGGAGATGCAGACCCAGG + Intronic
1139310188 16:66021515-66021537 GGTGGAGGAGTGGCAGGCGCTGG - Intergenic
1139583090 16:67884766-67884788 GGTGTTGGAGGCGGAGCCGCCGG + Intergenic
1139685033 16:68596879-68596901 GGTGTGGCAGAGGCAGCAGGTGG - Intergenic
1140727730 16:77828994-77829016 GGAGGGAGAGAGGCAGCCCCAGG - Intronic
1140831498 16:78755652-78755674 GGTTGGGGAGAGGAAGCCTCAGG + Intronic
1141178880 16:81739012-81739034 GGAGTGGGACAGGCAGGCCCAGG + Intergenic
1141200448 16:81893663-81893685 CGTGTGAGAGTGGCAGCCACAGG - Intronic
1142143649 16:88483533-88483555 GGGATGGGAGGGGCTGCCGCCGG - Intronic
1142212644 16:88815820-88815842 GGGGCAGCAGAGGCAGCCGCAGG + Intronic
1142341431 16:89525489-89525511 GGTGTGAGTGAGGGAGCAGCAGG + Intronic
1142376079 16:89707796-89707818 GGTGTAGGAGAGACAGCCCTGGG + Exonic
1142382739 16:89742906-89742928 GGTGCTGGGGAGGCAGCCTCAGG + Exonic
1142605671 17:1079850-1079872 GGGGTGGCAGAGGCAGCCCATGG - Intronic
1142738243 17:1915256-1915278 GGTGTGGGGGAGTCAGCCCCTGG + Intergenic
1142970899 17:3610859-3610881 GCTGGGGGAGAGGCACCTGCCGG - Exonic
1143263978 17:5621844-5621866 GGAAGAGGAGAGGCAGCCGCTGG - Intergenic
1143338656 17:6192210-6192232 GGGGTGAGACAGGCAGCCTCCGG + Intergenic
1143381290 17:6497955-6497977 GGAGCGGGTGAGGCAGCCGCAGG + Intronic
1143766057 17:9138468-9138490 GGTCAGGGAGAGGCAGCGTCTGG - Intronic
1144715616 17:17433568-17433590 GGTGGGGGAGGGGCAGCAGGTGG - Intergenic
1144771720 17:17763162-17763184 GGGGTGGGAATGGCAGCCCCTGG + Intronic
1144966266 17:19078594-19078616 GGCCTGGGAGAGGCAGCCCCTGG - Intergenic
1144981652 17:19173463-19173485 GGCCTGGGAGAGGCAGCCCCTGG + Intergenic
1144986572 17:19204776-19204798 GGCCTGGGAGAGGCAGCCCCTGG - Intergenic
1145306172 17:21676523-21676545 GGCGTGGGAGAGGGTACCGCGGG + Intergenic
1146172816 17:30646379-30646401 CGGGTGGGAGGGGCAGCCTCGGG - Intergenic
1146346273 17:32062390-32062412 CGGGTGGGAGGGGCAGCCTCGGG - Intergenic
1146466102 17:33088017-33088039 GGTGTGGGAAAGGGAGACTCAGG - Intronic
1146607387 17:34272401-34272423 TGTTAGGGAGAGGCAGCCACAGG + Intergenic
1146787981 17:35734891-35734913 GGTTTTGGAAAGGCAGCCACAGG + Intronic
1147756903 17:42774542-42774564 TGTGTGGGAGAGGAAGGGGCAGG + Intronic
1148440258 17:47708526-47708548 GGGCAGGGGGAGGCAGCCGCGGG + Intronic
1149678645 17:58488301-58488323 GGTGTGGGAGAGCTAGGCTCGGG - Exonic
1150453895 17:65291871-65291893 GGTAAGAGAGAGGCAGCCCCAGG - Intergenic
1150523523 17:65895548-65895570 GGTGTGGGAGAGAGAGACACTGG - Intronic
1151215514 17:72574277-72574299 GGTGTGGTGGAGGCAGCAGAGGG - Intergenic
1151447754 17:74178259-74178281 GGAGAGGGAGAGGGAGCCTCTGG - Intergenic
1151498389 17:74473427-74473449 GGTGTGGAGGAGGCAGCGGCAGG - Intronic
1151969198 17:77449266-77449288 TGTGTGGGGGATGCAGCCCCAGG + Intronic
1152229111 17:79105886-79105908 GGTGGGTGAGCGGCAGCAGCTGG - Intronic
1152268337 17:79309330-79309352 GGGGTGGGAGAGGAAGGCTCAGG - Intronic
1152280058 17:79379922-79379944 GGTGCGGGAGAGGCCGCGGCAGG - Intronic
1152697408 17:81804051-81804073 GGGGTGGGAGCGGCAGCCGAGGG - Intergenic
1153544489 18:6192082-6192104 GGTGTGTGAGAAGGAGCTGCTGG + Intronic
1153886546 18:9473135-9473157 GGTGGGAGAGAAGCAGCCTCAGG + Intergenic
1156483941 18:37453029-37453051 GGTGTGTGAGGGGCAGCTGGGGG - Intronic
1157613528 18:48974236-48974258 GATGGGTGAGAGGCAGCTGCAGG - Intergenic
1158607251 18:58906564-58906586 GGTGTGGGAAATGCAGCTCCGGG + Intronic
1158723792 18:59949750-59949772 GGCATGGGAGAGGCAGACCCTGG + Intergenic
1160144468 18:76352209-76352231 GGCGTGGGAGAGGCAGGAGGAGG + Intergenic
1160431113 18:78813285-78813307 GGAGTGGGAGAGGAAGCCCCAGG + Intergenic
1160535814 18:79590771-79590793 AGTGTGGGAAAGGCAGCTGCAGG - Intergenic
1160584254 18:79903937-79903959 GATGTGGGACCGCCAGCCGCGGG - Exonic
1160951136 19:1667871-1667893 GGTGGGCGGGAGGCAGCAGCTGG + Intergenic
1160989969 19:1856521-1856543 GGTGTGGAGCAGGCAGCCCCAGG - Intronic
1161347853 19:3777052-3777074 GAAGTGGGAGAGGCAGGAGCAGG + Intergenic
1161648968 19:5472519-5472541 GGAATGAGAGAGCCAGCCGCAGG - Intergenic
1161743415 19:6039889-6039911 GGTGAGTAAGAGGCAGCCGGAGG - Intronic
1162292968 19:9792742-9792764 GGTGAGGGAGAGACAGGGGCGGG - Intronic
1162428586 19:10612786-10612808 GGATTGGGAGAGGCAGCCTTCGG - Intronic
1162552670 19:11366210-11366232 GGTCAGGGAGAGGGAGCCACAGG + Intergenic
1162825430 19:13248481-13248503 GGTGAGGGAGATGCAGCTCCAGG + Intronic
1162989610 19:14293708-14293730 CGGGTGGGAGGGGCAGCCTCGGG + Intergenic
1163216311 19:15879827-15879849 GGACTGGGGGATGCAGCCGCAGG + Exonic
1163222374 19:15930819-15930841 AGTGTGGGAGGAACAGCCGCTGG - Intronic
1163727841 19:18932616-18932638 GGTTGGGGAGAGTCAGCCGATGG + Intronic
1164466386 19:28490623-28490645 GGTGTGGGAGGGGCAGGGGAAGG + Intergenic
1164509913 19:28888737-28888759 GGTGTGGGACCTGCAGCCTCAGG + Intergenic
1164639361 19:29812632-29812654 CGTGGGGGAGGGGCGGCCGCGGG + Intronic
1164671782 19:30076549-30076571 GGGGTGGGAGAGGCAGGCCTGGG - Intergenic
1164990168 19:32676989-32677011 GGGGAGGGAGCGGCAGCAGCAGG - Exonic
1165006409 19:32811312-32811334 GTTCTGGGAGATGCAGCAGCTGG - Intronic
1165074658 19:33273991-33274013 GGAGGAGGAGAGGCAGCCTCAGG - Intergenic
1165108606 19:33488488-33488510 GGACTGGGACAGGCAGCAGCTGG + Intronic
1165601622 19:37059205-37059227 GGCGTGGGAGAGGGGGCCGCGGG - Intronic
1165785718 19:38460536-38460558 GGTGTGTGAGAGGCAGCGACTGG - Exonic
1165793350 19:38505265-38505287 GGTGAGGGGGAGGCAGCAGTTGG - Intronic
1165888938 19:39099136-39099158 CATGTGGGTGAGGCATCCGCAGG + Exonic
1166876648 19:45901870-45901892 GGTCTGGGAGAGGCGGCGGCGGG - Intronic
1167250529 19:48396440-48396462 GGTCTGGGAGAGGCAGAGGAGGG + Intronic
1167414464 19:49362726-49362748 GGTCTGGGAGAGGAAGCGGCTGG + Intronic
1167511559 19:49897756-49897778 GGTGGGGGAGAGGGAGCCAGGGG + Intronic
1167607364 19:50488577-50488599 GGTGGGGGAGAGGGGGCCCCGGG + Exonic
1168287475 19:55341871-55341893 GGTGAGGGCAAGGCAGGCGCGGG - Exonic
925005439 2:439823-439845 CTTGTGGGAGAAGCGGCCGCTGG + Intergenic
925048559 2:793299-793321 GGGGTGGGACAGGCAGGTGCTGG + Intergenic
925105039 2:1283591-1283613 GGTGTGGGACAGAAAGCCCCAGG - Intronic
925315373 2:2918967-2918989 GTTGTGGGAGATGTAGCCTCAGG + Intergenic
925328763 2:3042486-3042508 GGTGTGGGAGTCGCACCAGCTGG - Intergenic
925673524 2:6336706-6336728 GTTCTGGAAGAGGCAGCCACAGG - Intergenic
925851527 2:8086743-8086765 GGTGAGGAAGAGGCAGCCATGGG + Intergenic
926154987 2:10448573-10448595 GGGCGGGGAGAGGCGGCCGCAGG - Intergenic
926243530 2:11105469-11105491 GGTGTGGGAGAGGCAGCCGCCGG + Intergenic
927087122 2:19683165-19683187 GGTCAGGGAGAGGCAGGCTCTGG + Intergenic
927181005 2:20446878-20446900 GGGCTGGGAGAGGCAGCGACCGG - Intergenic
927323016 2:21770382-21770404 AGTGGGAGAGAGGCAGCCGGTGG + Intergenic
927512865 2:23655232-23655254 GGTGTGGGAGACGCAGCAACAGG - Intronic
927640502 2:24842545-24842567 GGTCTGGGACAGGCAGCTTCTGG + Intronic
928169014 2:28991593-28991615 GCTGTGGGAGCGGCAGCCCCAGG + Intronic
928341632 2:30447658-30447680 GGCGAGGGCGAGGTAGCCGCGGG + Intronic
929919393 2:46161652-46161674 GGTGTGGCAGAGGAAGCCAGGGG + Intronic
930704492 2:54490800-54490822 GGTGTGGGAGAGTCCCACGCAGG + Intronic
931921244 2:67018430-67018452 GGTGGGGCACTGGCAGCCGCAGG - Intergenic
932292406 2:70593738-70593760 GCTGTGGGACTGGCAGCAGCAGG - Intergenic
932609072 2:73185299-73185321 GGGGTGGGAAAGGCTGCCGGAGG + Intergenic
933278501 2:80306706-80306728 GGTGTTGAGGAGGCACCCGCAGG + Intronic
933407165 2:81875482-81875504 GGAGTGGGAGAGGAACCCACTGG + Intergenic
933735115 2:85488199-85488221 GAGGTGGGAGAGTCAGCCCCTGG + Intergenic
933934546 2:87191476-87191498 GGTTTGGGGGAGGCAGCAGAGGG - Intergenic
934575365 2:95397240-95397262 GATGTGGGAGGGGCAGCTGGAGG + Intergenic
934856498 2:97733293-97733315 AGTGTGGGAGCAGCAGCCCCTGG - Exonic
935629019 2:105196758-105196780 GGGGTGGGAGAGGCTGTGGCAGG - Intergenic
936302616 2:111315688-111315710 GGAGTGGGGGAGGCAGCCCAAGG + Intergenic
936343172 2:111655439-111655461 GGTGGGTGAGAGGCAGCTGAGGG - Intergenic
936358597 2:111774420-111774442 GGTTTGGGGGAGGCAGCAGAGGG + Intronic
937472751 2:122188092-122188114 GGTGGGAGAGAGGCAGGCCCAGG + Intergenic
937737940 2:125313996-125314018 GAGGTGGGACAGGCAGCTGCAGG - Intergenic
938289950 2:130143799-130143821 GGGGCGGGAGAGGAGGCCGCGGG + Intronic
938466573 2:131529138-131529160 GGGGCGGGAGAGGAGGCCGCGGG - Intronic
940420858 2:153478200-153478222 GGCGTGGGAGCGGTTGCCGCGGG + Exonic
941909647 2:170751707-170751729 GGGGTGGGAGAGGTATCGGCAGG + Intergenic
946167434 2:217873554-217873576 GGTGAGAGAGAGCCAGCCCCTGG + Intronic
946247473 2:218396025-218396047 GGCGTGGGAGTCGCGGCCGCCGG - Exonic
946306306 2:218858906-218858928 GGGGTGGGAGAGCCAGCTGCAGG - Intergenic
946416812 2:219543911-219543933 AGTGCGGGAGAGGGAGACGCCGG + Exonic
946836726 2:223780110-223780132 GGTGGTGGTGAGGCAGCCGGGGG - Intronic
947814906 2:233030289-233030311 GCAGTGGGAGAGGCAGAGGCAGG - Intergenic
948262599 2:236615178-236615200 GGTGGGGCACAGGCAGCTGCAGG - Intergenic
948456404 2:238106510-238106532 GGAGCTGGAGAGGCAGCCCCGGG - Intronic
948612514 2:239178922-239178944 TGTGTGTGCGAGGCAGCCACCGG + Intronic
948612533 2:239179012-239179034 TGTGTGTGCGAGGCAGCCACCGG + Intronic
948910303 2:240999242-240999264 GGGGCGGGGGCGGCAGCCGCCGG + Intronic
1169254448 20:4086277-4086299 GGGGAGAGAGAGGCAGCCGTGGG - Intergenic
1169867488 20:10217595-10217617 GGTGTTGGGGAGGCTGTCGCGGG - Intergenic
1171266799 20:23777565-23777587 GGAGAGGGAGCAGCAGCCGCGGG + Intergenic
1171494897 20:25548718-25548740 GGTGTGGGAGATGTGGCCGTGGG - Intronic
1171532838 20:25863474-25863496 GGCGTGGGAGAGGGGACCGCGGG + Intronic
1171533266 20:25865975-25865997 GGCGTGGGAGAGGCGACCGCGGG + Intronic
1171807082 20:29689634-29689656 GGCGTGGGAGAGGGGGCCGAGGG - Intergenic
1171847122 20:30284027-30284049 GGCGTGGGAGAGGGGGCCGCGGG - Intergenic
1172101639 20:32487358-32487380 GGTGGGGGAGAGGCAGAGGATGG + Intronic
1172109951 20:32538749-32538771 GGAATGGGGGAGGCAGCGGCAGG + Intronic
1172556891 20:35849954-35849976 AGTGTGGAAGTGGCAGCTGCTGG + Intronic
1172664666 20:36590933-36590955 TGTCTGGGAGAAGCCGCCGCCGG - Exonic
1173855699 20:46249307-46249329 GGTGTGGGAGATGGTGACGCTGG - Intronic
1174176975 20:48651402-48651424 GGTGAGGCCGAAGCAGCCGCGGG + Exonic
1175872819 20:62216496-62216518 GGGGTGGGTGAGGCGGCCGTAGG - Exonic
1175931796 20:62497028-62497050 GCTGTGGGAGGCGCAGCTGCGGG + Intergenic
1176052921 20:63130091-63130113 GGGGTGGGGGTGGCAGCCCCTGG - Intergenic
1176382751 21:6121285-6121307 GGAGTGGGGGCGGCAGCAGCGGG - Exonic
1176427620 21:6558576-6558598 GGTCTGGGTGAGGCAGCGGGCGG - Intergenic
1176679707 21:9812840-9812862 GGCGTGGGAGCGGGGGCCGCGGG + Intergenic
1176680844 21:9818474-9818496 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1176681413 21:9821299-9821321 GGCGTGGGAGCGGGGGCCGCGGG + Intergenic
1176681700 21:9822708-9822730 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1176681978 21:9824117-9824139 GGCGTGGGAGCGGGGGCCGCGGG + Intergenic
1176682259 21:9825518-9825540 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1176682538 21:9826927-9826949 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1176682816 21:9828346-9828368 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1176683096 21:9829743-9829765 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1176683375 21:9831153-9831175 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1176683655 21:9832562-9832584 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1176683934 21:9833965-9833987 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1176684212 21:9835374-9835396 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1176684493 21:9836775-9836797 GGCGTGGGAGAGGGGGCCGCGGG + Intergenic
1176684771 21:9838177-9838199 GGCGTGGGAGAGGGGGTCGCAGG + Intergenic
1176685072 21:9839600-9839622 GGAGTGGGAGAGGGGCCCGCGGG + Intergenic
1178331384 21:31696584-31696606 GGAGGAGGAGAGGCAGCAGCGGG + Exonic
1178404003 21:32310113-32310135 GGCGTGGTGGAGGCAGCCCCTGG - Intronic
1179133728 21:38661181-38661203 AGTGTGGGAGGGGGAGCCGCGGG + Intronic
1179703112 21:43166893-43166915 GGTCTGGGTGAGGCAGCGGGCGG - Intergenic
1179740718 21:43416954-43416976 GGAGTGGGGGCGGCAGCAGCGGG + Exonic
1180035557 21:45246353-45246375 GGTGTGGGAGGGGCAGACGGGGG + Intergenic
1180090462 21:45531288-45531310 GGGGCGGGAGAGGGAGCCTCCGG + Intronic
1180105641 21:45616575-45616597 TGGGTGGGTGAGGCAGACGCGGG - Intergenic
1180176650 21:46093786-46093808 GGTGTGGGAGCTGCAGGCTCTGG + Intergenic
1180824038 22:18851031-18851053 GGTGAGGGAAGGGCTGCCGCTGG - Intronic
1180868727 22:19134281-19134303 CGTGTGGCAGAGCCAGGCGCCGG + Exonic
1180901626 22:19377214-19377236 GGTGGGGGAGAGGTAGCCACAGG - Intronic
1181124464 22:20694185-20694207 GGTGAGGGAAGGGCTGCCGCTGG - Intergenic
1181188699 22:21123517-21123539 GGTGAGGGAAGGGCTGCCGCTGG + Intergenic
1181210500 22:21286976-21286998 GGTGAGGGAAGGGCTGCCGCTGG - Intergenic
1181650409 22:24256144-24256166 GGTGAGGGAAGGGCTGCCGCTGG - Intergenic
1182491401 22:30674573-30674595 GGTGTGGGGGAGGCATCAGAAGG + Intergenic
1182523807 22:30902856-30902878 GGTATGGGAGTGGAAGCTGCAGG - Intronic
1183229666 22:36573907-36573929 GCTGTGGGAGAGAGAGCAGCAGG + Intronic
1183302133 22:37063634-37063656 GATGTGGCAGAGGCAGCCCAGGG - Intergenic
1183421250 22:37713082-37713104 GGTGTGGGAAAGGGAGCCAATGG - Intronic
1183476871 22:38040401-38040423 GTGGTGGGAGAGGCAGCAGGGGG + Intronic
1184148350 22:42624460-42624482 GGTGGGGGTGGGGGAGCCGCAGG - Intronic
1184315251 22:43682909-43682931 AGTGCGGCAGAGGCAGGCGCTGG + Intronic
1184484332 22:44766904-44766926 GGTGGGGGTGGGGCTGCCGCAGG + Intronic
1184569609 22:45313718-45313740 GGTGAGGGAGAGACAGACTCAGG + Intronic
1184787451 22:46678745-46678767 GGTGTGGGTGAGGGATCCGGCGG + Exonic
1203216447 22_KI270731v1_random:8454-8476 GGTGAGGGAAGGGCTGCCGCTGG + Intergenic
1203274179 22_KI270734v1_random:76935-76957 GGTGAGGGAAGGGCTGCCGCTGG - Intergenic
949292718 3:2484904-2484926 GGTGTGCGAGAGGCACGGGCGGG + Intronic
953057422 3:39399231-39399253 GGTGTGGGAGAGGATGAAGCAGG + Intergenic
953793956 3:45968583-45968605 GGTGCGGGAGAAGCAGCTACGGG - Exonic
953886987 3:46719702-46719724 GGGGAGGGAGAAGCAGCCTCTGG + Exonic
954461070 3:50627383-50627405 GGTGTGGGAGAGGCATCCTGGGG - Intronic
954761376 3:52877180-52877202 GGTCTGGCAGAGGCAGGCACTGG - Intronic
956532012 3:70231293-70231315 GGTGTGGAAAAGGCAGGGGCAGG - Intergenic
960223742 3:115146936-115146958 GGGTCGGGCGAGGCAGCCGCCGG + Intronic
960702391 3:120451093-120451115 GGAGGGGGAGCGGGAGCCGCGGG - Exonic
960950125 3:122993779-122993801 GCTGTGGGGGAGGCAGGAGCGGG - Intronic
962201329 3:133403343-133403365 GGGGGGGAAGAGGCAGCTGCAGG - Intronic
962601269 3:136992403-136992425 GCTGCAGGAGAGGCAGCCACAGG + Intronic
962753645 3:138452143-138452165 GCTGTGGGGGTGACAGCCGCGGG - Intronic
964423303 3:156527796-156527818 AGTGTGGGAGAGGGATCCTCCGG + Intronic
964973093 3:162585284-162585306 GCTGTGGGATATGCAGCAGCTGG - Intergenic
966198935 3:177341455-177341477 GGTGGGGGAGGGGTAGCCGAAGG - Intergenic
966863575 3:184243940-184243962 GGAGCGGGACAGGTAGCCGCTGG + Exonic
966941451 3:184750492-184750514 GTTGGGGGAGAGGCTGCTGCCGG + Intergenic
967109922 3:186284153-186284175 GGAGTAGGAGAGGCAGCCAAGGG + Intronic
968054186 3:195678579-195678601 TGTGGAGGAGAGGGAGCCGCAGG + Intergenic
968101705 3:195970563-195970585 CGTGGAGGAGAGGGAGCCGCAGG - Intergenic
968425772 4:522291-522313 GGTGTGGGAGCTGCAGCTGAGGG + Intronic
968517179 4:1020334-1020356 CATGTCGGAGAGGCGGCCGCAGG - Intronic
968544486 4:1191776-1191798 GGTGTGTGCGAGGCAGCGGTTGG + Intronic
968660082 4:1795238-1795260 GGTGCCGGAGGGGCGGCCGCGGG + Intronic
968671297 4:1853183-1853205 TGTGTGGGAGAGGTGGCCTCTGG - Intronic
968671311 4:1853236-1853258 TGTGTGGGAGAGGGGGCCTCTGG - Intronic
969605232 4:8199175-8199197 GGTGACGGAGAGGCAGGCCCAGG - Intronic
969697704 4:8744507-8744529 GGTGTGGGGGAGGCACTCCCAGG + Intergenic
969835495 4:9836762-9836784 GGTGTAGGAGAGGATGCAGCAGG + Intronic
970433032 4:16006558-16006580 GGTGTTGGAGACACAGCCTCGGG + Exonic
970836051 4:20408928-20408950 GGGGTGGGAGAAGCAGCCCCAGG - Intronic
975402339 4:73952529-73952551 GCTGTGTGAGTCGCAGCCGCAGG + Intergenic
976774826 4:88697258-88697280 GCTGCGGCAGAGGCTGCCGCGGG - Exonic
978197913 4:105991899-105991921 AGTGAGGGAGAAGCAGCTGCAGG + Intronic
982276332 4:153640089-153640111 GGGGCAGGAGAGGCAGCTGCGGG + Intergenic
984706257 4:182849292-182849314 GGTGTGGGAGAGGCGCCAGAAGG - Intergenic
985492151 5:186443-186465 GAAGTGGGAGAGGCGGCCACTGG + Exonic
985823887 5:2178888-2178910 GGTGTGGGAGGGGCTCCCTCAGG + Intergenic
985895475 5:2748291-2748313 GGGGAGGGAGAGCCAGCCCCGGG - Intronic
986165941 5:5271476-5271498 GATGGGGGCGGGGCAGCCGCGGG - Intronic
987130369 5:14854726-14854748 GGGGTGGGAGAGGCTGGGGCAGG - Intronic
988586491 5:32511832-32511854 GGTGTGGGAAAGGAAGCCTGGGG + Intergenic
990463209 5:56048308-56048330 CTTGTGAGAGAGGGAGCCGCAGG - Intergenic
991081945 5:62610071-62610093 GGTGGGCCAGAGGCAGCCGGTGG - Intronic
992104212 5:73436832-73436854 GGTGAGGAAGGGGCGGCCGCGGG - Intergenic
996749823 5:126877175-126877197 GTTGTGGGAGTGGCAGCTGGAGG + Intronic
997636132 5:135408522-135408544 GGAGAGGGAGAGGCAGAGGCAGG - Intergenic
999411273 5:151351956-151351978 GTTGGGAGAGAGGCAGCAGCTGG - Intergenic
999448933 5:151664220-151664242 GGTGTGGGAGAGGTACCTGCAGG + Exonic
999768106 5:154755829-154755851 GGTGAGGAAGAAGCCGCCGCCGG + Intronic
1001686032 5:173595739-173595761 GGGGTGGGGGAGGCAGAAGCAGG + Intergenic
1001724999 5:173888934-173888956 CATGGGGGAGAGGAAGCCGCGGG + Exonic
1001772863 5:174308989-174309011 AGTCTGGGAGAGGCAGGCACGGG - Intergenic
1002174037 5:177391380-177391402 GGGCTGGCAGAGGCAGCAGCAGG - Intronic
1002417099 5:179126347-179126369 AGTGAGGGAGAGGCAGCCTAGGG - Intronic
1003097908 6:3156841-3156863 GCTGTGTGGGAGGCAGCAGCGGG - Intronic
1003264399 6:4552705-4552727 GGAGTGGCAGAGGGAGCCGAGGG - Intergenic
1003567263 6:7231505-7231527 TCGGTGGGAGAGGCAGCCTCTGG - Exonic
1003604051 6:7542944-7542966 GGGGTGGGAGAGGACGACGCTGG + Intronic
1004171806 6:13300927-13300949 GGTGTGCTAAAGGCAGCCCCTGG + Intronic
1004424151 6:15496488-15496510 GGTGGGGGGGCGGCAGCTGCGGG + Exonic
1007772513 6:44202799-44202821 GGTGGGGGAGGGGCAGTGGCTGG - Intergenic
1011702906 6:89972097-89972119 GGTGTGGCAGGAGCAGCAGCTGG + Intronic
1013123019 6:107157516-107157538 GGGGTGGGGGAGACAGCCCCAGG - Intronic
1013204382 6:107933693-107933715 GGAGAGGGAGAGGCAGGGGCAGG - Intronic
1013374736 6:109503668-109503690 TGTGTGAGAGAGGCAGGCACTGG + Intronic
1013757785 6:113481540-113481562 GGTGAGGGAGAGGAAGCTGAGGG + Intergenic
1014078603 6:117264907-117264929 GGTGTGGGACAGGCGGCGGGAGG + Intergenic
1016462050 6:144287123-144287145 GGCGTGGGAGACGCAGCCTGCGG + Intronic
1017311799 6:152983765-152983787 GCCCTGGGAGATGCAGCCGCAGG - Intergenic
1018370314 6:163162243-163162265 GGTCAGGGAGAGGCAGCTGCAGG + Intronic
1018470024 6:164086766-164086788 GGTGTGGGGGAGGATGGCGCGGG + Intergenic
1018915633 6:168130836-168130858 GCTGGGGGAGAGGCAGGCGGGGG + Intergenic
1018966708 6:168495656-168495678 AGTGTGGGAGTGGCAGACGCAGG - Intronic
1018990257 6:168668966-168668988 GGTGTGGGGGAGGGGGACGCGGG - Intronic
1018990312 6:168669107-168669129 GGTGTGGGGGAGGGGGACGCGGG - Intronic
1018990364 6:168669214-168669236 GGTGTGGGGGAGGGGGACGCGGG - Intronic
1019262244 7:88100-88122 GGTGGGGGAGAGGGTACCGCAGG + Intergenic
1019615470 7:1957607-1957629 GGTGAGGGCGGGGCAGCCTCTGG - Exonic
1019719503 7:2559589-2559611 GGTGGGAGGGAGGCAGCCCCAGG + Intronic
1020999936 7:15316271-15316293 GGGGTGGGAGAGGAACCTGCTGG - Intronic
1021886423 7:25144365-25144387 GTTCAGGGAGAGCCAGCCGCTGG + Intronic
1023860906 7:44217319-44217341 GGTGTGGTGGTGGCGGCCGCTGG - Exonic
1024553746 7:50585100-50585122 CGTGTGGCAGAGGAAGCCACAGG + Intergenic
1024934478 7:54698656-54698678 GGTATGGGAGAGGCCCCCACTGG - Intergenic
1025295013 7:57770036-57770058 CGCGTGGGAGAGGTGGCCGCAGG - Intergenic
1026742997 7:72990504-72990526 GCAGTGGGGGAGGCAGACGCTGG + Intergenic
1026802850 7:73410889-73410911 GCAGTGGGGGAGGCAGACGCTGG + Intergenic
1026807657 7:73437989-73438011 GGTGTGGGAAAGGCAGGGGGAGG + Intergenic
1026913965 7:74108758-74108780 GGTGTGGCAGAGGCAGGAGAGGG + Intronic
1027029112 7:74875208-74875230 GCAGTGGGGGAGGCAGACGCTGG + Intergenic
1027100738 7:75374574-75374596 GCAGTGGGGGAGGCAGACGCTGG - Intergenic
1027269176 7:76510830-76510852 CGATTGGGAGAGGCAGCCCCAGG + Exonic
1027319891 7:77004725-77004747 CGATTGGGAGAGGCAGCCCCAGG + Intergenic
1028503884 7:91550188-91550210 GGTGAGAGAGAGGAAGCAGCAGG - Intergenic
1029096023 7:98085806-98085828 GGTGTGGCAGAGGGAGGTGCAGG + Intergenic
1029514413 7:101016814-101016836 GATGGGGGAGAAGCAGCCGGTGG + Intronic
1029702690 7:102258032-102258054 GGGGTGGGGGAGGCACCCGTCGG + Exonic
1030074135 7:105721831-105721853 GGTCTGAGAGAAGCAGCCACAGG - Intronic
1030676522 7:112391419-112391441 GGTGTTTCTGAGGCAGCCGCGGG - Intergenic
1030676546 7:112391523-112391545 GGTGTTTCTGAGGCAGCCGCGGG - Intergenic
1030676570 7:112391627-112391649 GGTGTTTCAGAGGCAGCCGCGGG - Intergenic
1030676588 7:112391705-112391727 GGTGTTTCTGAGGCAGCCGCGGG - Intergenic
1030676612 7:112391809-112391831 GGTGTTTCTGAGGCAGCCGCGGG - Intergenic
1030676636 7:112391913-112391935 GGTGTTTCTGAGGCAGCCGCGGG - Intergenic
1030676661 7:112392017-112392039 GGTGTTTCTGAGGCAGCCGCGGG - Intergenic
1031990759 7:128197468-128197490 AGGGTGGGAGAGGCAGCAGGTGG + Intergenic
1032035260 7:128516958-128516980 GGTGGAGGGGAGGCAGCCACGGG + Intergenic
1032239522 7:130149927-130149949 GGTGCAGAAGAGGCAGCCGCAGG + Intergenic
1033220715 7:139524776-139524798 GGTGTGGGAGATGCAGGAGTTGG + Intronic
1033686283 7:143644088-143644110 GGAGTGGAAGAGGCAGATGCAGG - Intronic
1033689455 7:143723227-143723249 GGAGTGGAAGAGGCAGATGCAGG + Exonic
1033698330 7:143813533-143813555 GGAGTGGAAGAGGCAGATGCAGG + Intergenic
1033741128 7:144276700-144276722 GGCGTGGGAGAGGTGGCCGTGGG + Intergenic
1033752777 7:144372914-144372936 GGCGTGGGAGAGGTGGCCGTGGG - Intronic
1034413391 7:150952874-150952896 GGTGTGGGTGAGGCAGGCCATGG + Intronic
1034674707 7:152884105-152884127 GGTGCAGGAGAGGCACCCGCAGG + Intergenic
1034848719 7:154473286-154473308 GGTGTGGCTGAAGCAGCCTCAGG - Intronic
1035025499 7:155822339-155822361 GGAGGGGGAGAGGCTGCCACTGG - Intergenic
1035071196 7:156146245-156146267 GGTGTGGGGGAGCCAGCTGAAGG + Intergenic
1035663334 8:1363382-1363404 GAGGCAGGAGAGGCAGCCGCAGG - Intergenic
1036561430 8:9903249-9903271 GGTGCGGGACAGGCAGCCGGAGG + Intergenic
1037986040 8:23291231-23291253 AGTCTGGGAAAGGCAGCAGCAGG - Intronic
1039516335 8:38136979-38137001 GCTGTGGGGGAGGCTGACGCAGG + Intronic
1040299022 8:46178422-46178444 GGTATGGGAGAGGCATCCTTAGG - Intergenic
1040330758 8:46384643-46384665 GGGATGGGAGAGGCATCCTCGGG - Intergenic
1040861695 8:52006346-52006368 GGTCAGGGAGAGGCAGGTGCTGG + Intergenic
1040881210 8:52206585-52206607 GGTGTGGCAGAGGCATCTGTAGG - Intronic
1041066301 8:54085805-54085827 GGTGGGGGGGGGGCAGCCCCCGG + Intronic
1042903124 8:73747280-73747302 GGTGTGGAAGGGGCTGCCCCAGG - Intronic
1048329796 8:133463826-133463848 GGTGAGAAAGGGGCAGCCGCGGG - Intronic
1049023775 8:139974849-139974871 GGAGAGGGAGAGGCAGCCGGAGG - Intronic
1049025207 8:139983762-139983784 GGTGTGAGAGAGGCCGGGGCGGG - Intronic
1049588178 8:143441433-143441455 GGTCTGGCAGAGGCAGCGGGTGG - Intronic
1049641915 8:143719673-143719695 GGTGTGGGCAAGGCAGCACCTGG + Intronic
1050106311 9:2170102-2170124 GGTGGGAGACAGGCAGCCACTGG - Intronic
1050719436 9:8569077-8569099 AGTTTGGGAGAGGAAGCCTCTGG - Intronic
1053123032 9:35560385-35560407 GAGGTGGCAGAGGCAGCCGGGGG + Exonic
1053784351 9:41643808-41643830 GGCGTGGGAGAGGGGGCCGCGGG - Intergenic
1053784883 9:41646539-41646561 GGCGTGGGAGAGGGGGCCGTGGG + Intergenic
1054160127 9:61667643-61667665 GGCGTGGGAGAGGGCGTCGCGGG - Intergenic
1054160659 9:61670370-61670392 GGCGTGGGAGAGGGGGCCGCGGG + Intergenic
1054160947 9:61671779-61671801 GGCGTGGGAGAGGGGGCCGCGGG + Intergenic
1054172306 9:61853941-61853963 GGCGTGGGAGAGGGGGCCGCGGG - Intergenic
1054172797 9:61856410-61856432 GGCGTGGGAGAGGGGGCCGCGGG - Intergenic
1054173086 9:61857781-61857803 GGCGTGGGAGAGGGGGCCGCAGG - Intergenic
1054173609 9:61860484-61860506 GGCGTGGGAGAGGGGGCCGTGGG + Intergenic
1054447165 9:65382968-65382990 GGCGTTGGAGAGGGGGCCGCGGG - Intergenic
1054447644 9:65385413-65385435 GGCGTGGGAGAGGGGGCCGCGGG - Intergenic
1054447937 9:65386823-65386845 GGCGTGGGAGAGGGGGCCGCGGG - Intergenic
1054448463 9:65389549-65389571 GGCGTGGGAGAGGGGGCCGTGGG + Intergenic
1054663931 9:67720297-67720319 GGCGTGGGAGAGGGGGCCGTGGG - Intergenic
1054664456 9:67723000-67723022 GGCGTGGGAGAGGGGGCCGCAGG + Intergenic
1054664743 9:67724391-67724413 GGCGTGGGAGAGGGGGCCGCGGG + Intergenic
1054665231 9:67726864-67726886 GGCGTGGGAGAGGGGGCCGCGGG + Intergenic
1055671676 9:78613110-78613132 GGGGTGGGAGAGGCTGCTACTGG + Intergenic
1056135123 9:83623360-83623382 GGAGAGGGCGCGGCAGCCGCGGG - Intronic
1056619584 9:88200539-88200561 GGTGTGAGAAAGGCAGATGCAGG + Intergenic
1056789818 9:89618168-89618190 GATGTGGGAGAGGCAGGGACAGG - Intergenic
1057584164 9:96314593-96314615 GGTGCGGGAGAGGGAGCATCAGG + Intergenic
1059256351 9:112934746-112934768 GGTTTGGGAGAAGCAGCACCTGG - Intergenic
1059465698 9:114467495-114467517 GGTGAGCGAGAGTCAGCCGGCGG + Intronic
1061052336 9:128204019-128204041 GGTGTGGGGGACGCTGCCCCCGG - Intronic
1061136923 9:128740050-128740072 GATGTGGGAGAGGACGCCGCAGG + Exonic
1061700483 9:132411286-132411308 GGTGCGGGAGTGGAAGGCGCAGG + Intronic
1061807961 9:133147090-133147112 GGGGTGGGAGGGGCAGCCCAGGG - Intronic
1061928288 9:133818488-133818510 GGTGTGGGATGGGCAGGTGCTGG - Intronic
1061968331 9:134029055-134029077 GCTGTGGGAGTGTCAGCCGGCGG - Intergenic
1062032456 9:134367788-134367810 GGTGTGGGAGAGGAACCCCAAGG - Intronic
1062192542 9:135255319-135255341 GGGGTGGGAGGTGCAGCCCCAGG + Intergenic
1062681626 9:137785109-137785131 GGTCTGGAAGAGGCAGGAGCTGG + Intronic
1203664875 Un_KI270754v1:15375-15397 GGCGTGGGAGCGGGGGCCGCGGG + Intergenic
1203665160 Un_KI270754v1:16784-16806 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1203665720 Un_KI270754v1:19601-19623 GGCGTGGGAGCGGGGGCCGCGGG + Intergenic
1203666296 Un_KI270754v1:22420-22442 GGTGTGGGAGAGGGGGCCACGGG + Intergenic
1203666869 Un_KI270754v1:25239-25261 GGCGTGGGAGCGGGGGCCGCGGG + Intergenic
1203667445 Un_KI270754v1:28059-28081 GGCGTGGGAGAGGGGGCCACGGG + Intergenic
1203668018 Un_KI270754v1:30878-30900 GGCGTGGGAGCGGGGGCCGCGGG + Intergenic
1203668593 Un_KI270754v1:33698-33720 GGTGTGGGAGAGGGGGCCACGGG + Intergenic
1203669157 Un_KI270754v1:36515-36537 GGCGTGGGAGTGGGGGCCGCGGG + Intergenic
1203669440 Un_KI270754v1:37924-37946 GGTGTGGGAGAGGGGGCCACGGG + Intergenic
1188037760 X:25337995-25338017 CTTGTGGGAGGGGCAGCCACTGG - Intergenic
1189399654 X:40655412-40655434 GGACTGGAAGAGGCAGCCACTGG - Intronic
1192212705 X:69137715-69137737 CGTGTGGGAGAGGCAGCCTGGGG - Intergenic
1192263884 X:69525327-69525349 GGTGAGGGTGAGGCAGGCTCTGG + Intronic
1192347214 X:70320674-70320696 GGTGTGGGAGTGGAGGCCGAGGG + Intronic
1192952275 X:76029590-76029612 AGTGTGGCAGCGGCAGCAGCGGG + Intergenic
1195350280 X:103989168-103989190 GGTGTGGCAGAGGCAGCGGGGGG - Intergenic
1196887370 X:120260958-120260980 GGTGAGGGAGAGGCAGACTGGGG + Exonic
1198321515 X:135521948-135521970 AGCGTGGCAGAGCCAGCCGCCGG + Intronic
1199640743 X:149858638-149858660 GGTGTGGGGGAGGCTGCAGTGGG - Intergenic
1200049869 X:153423065-153423087 GGGCTGGCAGAGGCAGCTGCTGG + Intergenic