ID: 926247915

View in Genome Browser
Species Human (GRCh38)
Location 2:11134100-11134122
Sequence AAGTGTGACCAGCGGTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926247913_926247915 19 Left 926247913 2:11134058-11134080 CCAAAAAGCAAGCAGAGAAGCAA 0: 1
1: 0
2: 5
3: 82
4: 624
Right 926247915 2:11134100-11134122 AAGTGTGACCAGCGGTAAGAAGG 0: 1
1: 0
2: 0
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926247915 Original CRISPR AAGTGTGACCAGCGGTAAGA AGG Intronic
905044574 1:34985464-34985486 AAGTGTCCCCACCTGTAAGATGG - Intronic
911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG + Intronic
920172625 1:204081406-204081428 CGGTTTGACCAGCGCTAAGAGGG + Intronic
1062818593 10:517690-517712 ACGTGTCACCAGCAGAAAGATGG + Intronic
1067415983 10:46103530-46103552 AAGTGTGACCAGGGGTTAAGAGG - Intergenic
1069440453 10:68423782-68423804 AAGTGGGCCCAGCGGTAACGAGG + Intronic
1075210457 10:120486465-120486487 CAGTTTGACCAGCTGTAAAATGG + Intronic
1078665147 11:13318239-13318261 AACTGTGACCATAGGTAGGAAGG + Intronic
1078858555 11:15226494-15226516 AAGTGTGGCCAGAGGTGAAATGG - Intronic
1080379532 11:31753957-31753979 AAGTGTGACCAAATGTTAGAAGG + Intronic
1085023371 11:73222615-73222637 AAGTGTGACCTGCTGGAAAAAGG - Intronic
1094322409 12:29199847-29199869 TAGAGTGACCAGGAGTAAGATGG + Intronic
1097880391 12:64681286-64681308 AAGTGTGACCAAGGGCAAAAGGG - Intronic
1100958908 12:99940798-99940820 AAGTGGGACCAGAGCTTAGAGGG + Intronic
1104882752 12:132084036-132084058 CAGTGTGACCAGCGCTCAGCAGG + Intergenic
1109206950 13:59493012-59493034 AAGTGTGACCTGGGTTAGGATGG - Intergenic
1112237776 13:97651725-97651747 TAGTGTGCCCAGGGATAAGATGG + Intergenic
1113066999 13:106382772-106382794 AAGTGAGCCCAGGGGTAAGACGG + Intergenic
1114822920 14:26043225-26043247 AAGTGTAACCATGGGTAAGAGGG - Intergenic
1117331331 14:54715162-54715184 AAGTGTGACCAGTCCCAAGAGGG + Intronic
1120942151 14:89958673-89958695 AAGTGTGCCAAGTGGGAAGAGGG + Intronic
1120963962 14:90151011-90151033 AAGTGTGAACAGGAGGAAGAAGG - Intronic
1121168974 14:91836799-91836821 AAGGGAGACAAGCGGTAGGAGGG + Intronic
1124512645 15:30340215-30340237 AATTGGGACCAGCAGTGAGAGGG - Intergenic
1124730270 15:32190535-32190557 AATTGGGACCAGCAGTGAGAGGG + Intergenic
1125382459 15:39101907-39101929 AAATGGGACCAGTGGTATGAAGG + Intergenic
1126385379 15:48088542-48088564 AAGTGAAACCATGGGTAAGAGGG - Intergenic
1129416009 15:75380710-75380732 TAGTCTGACCAGCGCTAAGATGG + Exonic
1129976403 15:79826048-79826070 AAGTGTGCCCAGTGGTAAAGGGG - Intergenic
1131330406 15:91493331-91493353 AAGTGGAACCAACGGTAAGGGGG + Intergenic
1138234197 16:55366949-55366971 AAGTGTAACCTTCGGGAAGAAGG - Intergenic
1144670476 17:17129986-17130008 AAGTGTGACCAGGGAGGAGAGGG + Intronic
1150909023 17:69369037-69369059 AACTGTGAACAGTGGGAAGATGG - Intergenic
1152171310 17:78750889-78750911 AAGTGTGACCAGAGGTCTGTAGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1159053152 18:63440500-63440522 AAGTGTGACCAGCAGTCCGAAGG - Intergenic
1165998247 19:39860916-39860938 AAGTGTGACAAAGGCTAAGAAGG + Intergenic
925145911 2:1583272-1583294 AAGAGTGACCAGCGGGAGGGAGG - Intergenic
926247915 2:11134100-11134122 AAGTGTGACCAGCGGTAAGAAGG + Intronic
926989345 2:18660783-18660805 AAGAGTGACAAGTGGTAATATGG - Intergenic
931460552 2:62446891-62446913 AAGTTTCACCAGAGGTGAGAAGG - Intergenic
933378574 2:81513905-81513927 AAGTGTGAACAAGCGTAAGAGGG - Intergenic
937093688 2:119223011-119223033 AAATGTGACCACAGGTGAGAAGG + Intergenic
937941367 2:127288635-127288657 AAGTGGTACCAGAGTTAAGAAGG - Intronic
940685277 2:156841522-156841544 AAGTGAAACCACGGGTAAGAGGG - Intergenic
941160130 2:162026243-162026265 AAGTGTTCCCAGCTGTAAAATGG - Intronic
941726130 2:168862584-168862606 AAGTGAGACCAGCACTAAGCTGG - Intronic
943334720 2:186599910-186599932 GAGTGTGATCTGCAGTAAGAGGG - Intronic
943567184 2:189529902-189529924 AACTGTGATCAGTGCTAAGATGG + Intergenic
943797593 2:192016562-192016584 AAGTGTGAAAGGCTGTAAGATGG - Intronic
945372860 2:209041868-209041890 AAATGTGACCAGAGGTTTGAAGG + Intergenic
1171254854 20:23682286-23682308 AACTTTGACCAACAGTAAGATGG + Intergenic
1173398370 20:42702056-42702078 AAGTGTGACAAGTGGGAAGTGGG - Intronic
953998174 3:47536470-47536492 ACGTGTCACCAGCGGAAAGCCGG + Intergenic
963411014 3:144927834-144927856 AAGTGTGACCAGCATAAAGGAGG - Intergenic
968206561 3:196807505-196807527 AAGTGTGACCAGGTCTAAAATGG - Intronic
968212195 3:196858136-196858158 AACTCTGACCACCGGTGAGACGG - Intergenic
969483155 4:7457562-7457584 AGGTGTGAGCTGCGGTCAGAGGG + Intronic
972396250 4:38662221-38662243 AAGTGTGACCCAAGATAAGAAGG - Intergenic
979149892 4:117297942-117297964 GAATGTGAGCAGCAGTAAGATGG - Intergenic
979995505 4:127426333-127426355 GAGAGTGACCAGCGGTGAGTGGG - Intergenic
982522662 4:156438805-156438827 AACTGTGACAAGTTGTAAGAAGG + Intergenic
991571283 5:68055893-68055915 AGGTGAGACAAGGGGTAAGATGG - Intergenic
991894897 5:71384751-71384773 AAGTGTAATAAGCTGTAAGAAGG + Intergenic
997415768 5:133727453-133727475 AGGTGTGCCCAGTGGGAAGATGG - Intergenic
1000045335 5:157517607-157517629 AAGTGTGATAAGCACTAAGATGG - Intronic
1001227905 5:169961638-169961660 AATTGTGACAAGTGCTAAGAAGG + Intronic
1010049134 6:71482781-71482803 AAATGTGAGCAGAGGTGAGATGG - Intergenic
1012985612 6:105873208-105873230 AAGTGTGAGCAGAGATAAGTAGG + Intergenic
1015311123 6:131768247-131768269 AAGTGTGATAAGCGATAAGTGGG - Intergenic
1016276542 6:142359803-142359825 AAGTGTGAACAGAGCTAATAAGG + Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1021580808 7:22150817-22150839 AAGTGTAACCAGTGTTAACATGG - Intronic
1022118700 7:27285977-27285999 AGGTGAGACCTGCTGTAAGAAGG + Intergenic
1029863776 7:103603470-103603492 AGGTGTGACCAGGGGTACCAAGG - Exonic
1039047255 8:33461375-33461397 GAGTGTGACAAGCAGAAAGACGG + Exonic
1043299757 8:78713080-78713102 AACAGTGACTAGCAGTAAGATGG + Intronic
1047721617 8:127645382-127645404 AAATGTAACCAGCTCTAAGATGG - Intergenic
1048436511 8:134423465-134423487 AGGTTTGAACAGAGGTAAGAGGG - Intergenic
1050187034 9:2985568-2985590 AAGTGTGACCTTGGGTAAGGTGG - Intergenic
1051907576 9:22114216-22114238 AAGTTTGACCAGGTATAAGAGGG - Intergenic
1052227998 9:26112281-26112303 AAGTGTTACCAGTGCCAAGAAGG + Intronic
1056939954 9:90946516-90946538 AGGTGTGCCTAGCGGAAAGAAGG - Intergenic
1059386490 9:113968942-113968964 ACTTGTGCCCAGTGGTAAGAGGG - Intronic
1188541941 X:31260514-31260536 AATTGTGAGCACCGGAAAGACGG + Intronic
1194114045 X:89873804-89873826 AACTGTGGCCAGCGTTCAGATGG + Intergenic
1197878330 X:131135583-131135605 AAGTGTCACCAGAGATAAGGAGG + Intergenic