ID: 926256972

View in Genome Browser
Species Human (GRCh38)
Location 2:11212587-11212609
Sequence GTAGAAAATAGGAGGAGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926256972_926256975 -9 Left 926256972 2:11212587-11212609 CCAATACTCCTCCTATTTTCTAC 0: 1
1: 1
2: 1
3: 20
4: 208
Right 926256975 2:11212601-11212623 ATTTTCTACATAAACCCCAAAGG 0: 1
1: 0
2: 3
3: 23
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926256972 Original CRISPR GTAGAAAATAGGAGGAGTAT TGG (reversed) Intronic
907822945 1:57988686-57988708 GTAGAAAATTTGAGGGGTGTGGG + Intronic
908450237 1:64247430-64247452 TTGGAAAATAGGAGGTGTTTGGG + Intronic
908515110 1:64884369-64884391 GAAGAAAGTAGTAGGAGTGTGGG - Intronic
909140517 1:71858904-71858926 TTGGAAAATAGGAGCAGCATTGG - Intronic
909238902 1:73187047-73187069 GTAGAAAATATTAGCAATATGGG - Intergenic
909909435 1:81243953-81243975 TTTGAAAAAAGGAGGAGTATGGG - Intergenic
911526010 1:98986599-98986621 TGAGAAAATAGGAAAAGTATAGG + Intronic
912417813 1:109521994-109522016 GTAGAAAATACAAAGAGCATTGG + Intergenic
912531406 1:110325935-110325957 GTAGAAAAAAAGTGGAGTTTTGG - Intergenic
912784008 1:112581283-112581305 GGAGATAATTGGAGAAGTATGGG - Intronic
918230461 1:182526301-182526323 CTAGAAACTAGAGGGAGTATTGG - Intronic
918884536 1:190174801-190174823 GTAGAAAAAAGCAAGATTATTGG - Intronic
919699069 1:200612587-200612609 ATTGAAAATAGGAGGAGTATGGG - Intronic
922601241 1:226856126-226856148 AGAGAAAATAGGAGGAGGAAGGG - Intergenic
923113371 1:230911078-230911100 GTATAAAACATGAGGATTATGGG + Intronic
923502644 1:234578771-234578793 ACAGAAAAGAGGAGGAGTGTGGG + Intergenic
924561515 1:245159930-245159952 GTAGGAAATAGGAGGAGACATGG + Intronic
924832102 1:247607380-247607402 GTATAAAATTTGAGGAGTATGGG + Intergenic
1066705063 10:38168580-38168602 GTAAAAAATAGGTGGAGAAAAGG + Intergenic
1066951732 10:42125440-42125462 GTAGAAAATATGTGGTGTACAGG + Intergenic
1066985418 10:42461974-42461996 GTAAAAAATAGGTGGAGAAAAGG - Intergenic
1067096352 10:43303428-43303450 AAACAAAAAAGGAGGAGTATGGG - Intergenic
1067324712 10:45256461-45256483 CTAAAAAAGAGTAGGAGTATTGG + Intergenic
1068341381 10:55708594-55708616 TTAGAAAATAGCAGAAGTTTAGG + Intergenic
1070427294 10:76301753-76301775 TTAGAAAATAGGAGCTATATGGG + Intronic
1071123541 10:82308639-82308661 CTAAAAAACAGGAGGAATATTGG - Intronic
1071864159 10:89707617-89707639 GAAGAAAAAAGGAGGGGTAAGGG - Intronic
1073850175 10:107606398-107606420 GCAGAAACTAGTAGGAGTATTGG + Intergenic
1076210542 10:128640206-128640228 TTAGAAAACAGGAGGACTAGGGG - Intergenic
1076297343 10:129397050-129397072 ATATAAAATAGGAAGAGCATTGG - Intergenic
1078361365 11:10670603-10670625 ATAAGAACTAGGAGGAGTATTGG - Intronic
1079745041 11:24116026-24116048 GGGGAAAATAAGAGGAATATGGG - Intergenic
1080159779 11:29159913-29159935 AGAGAAAAGAGGAGGAGGATGGG + Intergenic
1082110114 11:48264802-48264824 AGGGAAAATAGGAGGAGTAAGGG + Intergenic
1082134965 11:48537497-48537519 GAAGAAGCTTGGAGGAGTATGGG - Intergenic
1083353575 11:62048443-62048465 ATAGAAAAGAGGAGAAGTCTTGG + Intergenic
1084496838 11:69510126-69510148 GTAGAAACTGGGAGAAGTCTGGG + Intergenic
1085142858 11:74164406-74164428 TTAGGAAATAGAAGGATTATAGG - Intronic
1085217011 11:74842095-74842117 CTAGAAAATAGGTTGTGTATTGG + Exonic
1085220575 11:74870742-74870764 GTACAAAAGGGGAGGAGAATTGG - Intronic
1085788412 11:79475037-79475059 GTAGAAATTAGGATGATTATTGG - Intergenic
1087422208 11:97943787-97943809 GTAGAAATTTGTAGGAGTAAAGG - Intergenic
1088348685 11:108860499-108860521 GAAGAAAAGAGGAGGAAGATGGG + Intronic
1090476712 11:127028727-127028749 GTAGAAAAGACAAGGAGTTTAGG - Intergenic
1091024148 11:132127080-132127102 GTTTGAAATAGGAGGAGTTTTGG - Intronic
1091083836 11:132700591-132700613 ATTGATAATAGGAGGAATATTGG - Intronic
1092955223 12:13543286-13543308 GTAGAAATTAGGAGGTGGGTTGG - Exonic
1094454594 12:30618577-30618599 GTAGAAACTATGAGAAATATTGG - Intergenic
1095173767 12:39066214-39066236 GTAGAAAGGAGGAAAAGTATAGG + Intergenic
1095643483 12:44512795-44512817 TCAGAAGCTAGGAGGAGTATAGG + Intronic
1096867195 12:54571681-54571703 GAAGAAAAAGGGAGGAGTAGGGG - Intronic
1097316649 12:58178403-58178425 GGAGAAAAGACTAGGAGTATTGG + Intergenic
1097500629 12:60396203-60396225 GCAGAAAATAGGAAGATTGTAGG - Intergenic
1100014668 12:89994642-89994664 GTAGAAAATAGCATGACTTTGGG - Intergenic
1100750081 12:97688885-97688907 GCAGAAAATAGGAGAAGAAAAGG - Intergenic
1106095398 13:26638981-26639003 GTGGAAAATAGGAGGACAGTGGG - Intronic
1106514215 13:30439204-30439226 GTAGAAAATAGTAGGAATTAGGG + Intergenic
1106974663 13:35195360-35195382 GAACAAAATAGTAGGTGTATTGG + Intronic
1108468147 13:50739635-50739657 GTAAAAAATAGGTGGATTAGAGG + Intronic
1110519219 13:76455792-76455814 GAAGAAAAGAGGAGGAGGATGGG + Intergenic
1110739832 13:78981760-78981782 GGGAAAAATAGGAGGAGTCTTGG + Intergenic
1111020763 13:82446686-82446708 GTAGAATATGACAGGAGTATTGG - Intergenic
1111319922 13:86613823-86613845 AAAGAAAATAGGAGGAGTCAAGG - Intergenic
1111695548 13:91619000-91619022 GTAGAAAATAAGAGGAAATTTGG + Intronic
1111742113 13:92217492-92217514 GCAGAAAATATCAGGAGTAAGGG - Intronic
1116212926 14:41971165-41971187 GTAGAACAAAGTAGGAGTACTGG - Intergenic
1117533470 14:56681697-56681719 GTAGAAAATAGGAGATTTTTAGG - Intronic
1119158495 14:72433154-72433176 CCAGAAAACAGGCGGAGTATGGG - Intronic
1120467612 14:84880606-84880628 GTAGAAAATGGGAGGAGGAAAGG + Intergenic
1121206880 14:92176868-92176890 TTAAAAAATAGGAGGAGGAAAGG - Intergenic
1126330155 15:47523077-47523099 ATGGAAGATGGGAGGAGTATAGG - Intronic
1126391126 15:48153810-48153832 GTTGAACATAGGTGGAGTAATGG - Exonic
1128158339 15:65406454-65406476 TTAGAAAATAGTATGAGTACCGG + Intronic
1128847470 15:70913389-70913411 GTAGTAAGTGGGAGGAGTGTTGG + Intronic
1130349479 15:83078594-83078616 GTTGAAAAAAGGGGAAGTATTGG - Intergenic
1130643542 15:85702416-85702438 GTAGAAAATATGAGTAATTTGGG + Intronic
1131652435 15:94415594-94415616 GTAGAAAATAGGTGAACTTTAGG + Intronic
1132109115 15:99089283-99089305 GTGGAATAAAGGAGAAGTATGGG - Intergenic
1133625055 16:7563297-7563319 CTAGAAAATAGGAATACTATTGG - Intronic
1138778054 16:59748974-59748996 GTGGAAAATGGGAGGAATTTTGG + Intronic
1138904179 16:61310452-61310474 TCAGTAAATAGGAGAAGTATGGG + Intergenic
1146638427 17:34522792-34522814 GCAGAAAATTGGAGGAGTGTTGG + Intergenic
1147467889 17:40625925-40625947 TTAGAAAATTGGGGGACTATGGG + Exonic
1147939549 17:44036575-44036597 ATAGAAGAGAGGAGGAGTTTAGG - Intronic
1149207308 17:54263603-54263625 GTAGAAAATATGAGGAAGTTTGG + Intergenic
1149900875 17:60476889-60476911 GAAGAAAACATGAGGAATATTGG - Intronic
1150443534 17:65210773-65210795 GAAGAAAGTTAGAGGAGTATGGG - Intronic
1151192931 17:72411893-72411915 GTAGAGAAGAGGAGGAGAAAAGG + Intergenic
1152995319 18:401178-401200 AAAGAACATAGGAGGCGTATTGG - Intronic
1155345920 18:24856511-24856533 GTAGAAAAGATGAGGAGAAGTGG + Intergenic
1156417534 18:36912923-36912945 GGAGAAAATAGAAGGAGAAATGG + Intronic
1157083813 18:44556348-44556370 GCAGAAATAAGGAGGAGTAGGGG + Intergenic
1159301627 18:66579604-66579626 GTCAAAAAAAGCAGGAGTATAGG + Intronic
1159609776 18:70512572-70512594 GTAGAATACAGAAAGAGTATTGG + Intergenic
1159667527 18:71180152-71180174 ATACAAAATAGGAGGGGTTTGGG - Intergenic
1159933090 18:74334328-74334350 GGAGAAAAGAGGAGGAGGGTAGG + Intronic
1160287525 18:77558685-77558707 GGAGAAAACAAGAGGAGTGTGGG - Intergenic
1160578051 18:79868126-79868148 TTAGAGAATAGGAGAAGTTTGGG + Intronic
1162519739 19:11172815-11172837 GTGGAAACTAGAAGGAGTAGAGG - Intronic
1164292146 19:23878574-23878596 GAAGAAAATAGGAGGAGGAGAGG + Intergenic
1164324560 19:24180285-24180307 GGAGAAAAGGGGAGGAGAATGGG + Intergenic
1166533090 19:43554056-43554078 CCAGAAAATAGGAGAAGTCTGGG + Intronic
1167691671 19:50988466-50988488 GAAGAAAATGGGAGGAGAATGGG + Intergenic
926256972 2:11212587-11212609 GTAGAAAATAGGAGGAGTATTGG - Intronic
926396774 2:12451078-12451100 ATGGAAAAAAAGAGGAGTATTGG + Intergenic
926605880 2:14898002-14898024 GTTCAAAATAGTAGGAGTTTTGG + Intergenic
927333798 2:21897052-21897074 GGAGAAAATAGTAGGAGCCTTGG - Intergenic
931066885 2:58597705-58597727 ATAGAACATAGGGGAAGTATTGG + Intergenic
932652623 2:73575386-73575408 GTGGAAAAAAGGAGGAGGGTTGG - Intronic
932722805 2:74150146-74150168 GAAGATAAGAGGAGGAGAATGGG - Intergenic
932957226 2:76366590-76366612 GATAAAAATAGGTGGAGTATAGG - Intergenic
932958581 2:76385683-76385705 GTAGAATATAGAAGGGGTAGGGG - Intergenic
935287315 2:101576596-101576618 TAAGAAAAGAGGAGGAGTGTGGG - Intergenic
936082200 2:109439937-109439959 GAGGAAAATAGGAGGGGGATTGG + Intronic
937755531 2:125533450-125533472 GTATAGAATAGGTGGAGCATAGG + Intergenic
937803413 2:126107800-126107822 TTGGAAGATAGGAGGAGCATTGG + Intergenic
939067089 2:137496434-137496456 GTAGAAAATAGGCCCATTATTGG - Intronic
941339133 2:164284292-164284314 GTAGAGAAATGGAGGAGTAGTGG + Intergenic
941747927 2:169106843-169106865 TTTGAAATTAGGAGGAGTGTTGG - Intergenic
947049351 2:226024607-226024629 GTAGAAAGAAGGACGAGTAGAGG - Intergenic
948276853 2:236715482-236715504 GGAGAAAATGGGAGGAGAAATGG + Intergenic
948823907 2:240565267-240565289 GTAGAACATGGAACGAGTATTGG - Intronic
1168774946 20:439610-439632 GGAGAAAGTAGGAGAATTATTGG + Intronic
1169260112 20:4131529-4131551 GTAGAACATAGGAGGTTTTTAGG + Intronic
1169666560 20:8043109-8043131 GTATAAAACAGGAGGTATATGGG - Intergenic
1173722682 20:45273197-45273219 GTAGAAAAAAGGAGAAGGTTGGG - Intergenic
1174838490 20:53879860-53879882 GAAGAAGAGAGGAGGAGTAGGGG + Intergenic
1175891462 20:62317867-62317889 GAAGAAAAGAGGGGGAGTATGGG + Intronic
1177777714 21:25587758-25587780 GTAGTAAATAGAAGGAGAATGGG + Exonic
1178494154 21:33072590-33072612 GTGGGAAATATGAGGATTATAGG + Intergenic
1182424977 22:30267017-30267039 GAAGAAAACAGGAGGAGGAGCGG - Intergenic
1184575575 22:45362532-45362554 GTAGATAATGGGAGAAGTCTAGG - Intronic
950276981 3:11670171-11670193 GTAGAAAAAGGGAGGATGATAGG - Intronic
953376014 3:42429165-42429187 GTAGAAATCAGGTGGAGGATGGG + Intergenic
956198814 3:66684012-66684034 GAAGAAAAGAGGAGGAGGAAGGG - Intergenic
959820811 3:110733264-110733286 GTTGAAAATAGCAGGTGTGTTGG - Intergenic
960831450 3:121853709-121853731 ATAGAAAATAGAAGGAATAGAGG - Intronic
964438691 3:156680590-156680612 GAAGAAACTAGCAGGATTATTGG + Intronic
965115677 3:164484568-164484590 GGAGAAAATGGGAAGAGAATGGG + Intergenic
965269280 3:166591864-166591886 GAGGAAAATAGGAGGAGCACAGG - Intergenic
966621419 3:181968293-181968315 GTAGAAAATTGGAACAGTACAGG + Intergenic
969141147 4:5074023-5074045 GTAGAAAATAGAAAAAATATTGG - Intronic
969727779 4:8934090-8934112 AGAGAAAATAGGAGGAGGAAGGG - Intergenic
971112189 4:23600125-23600147 ATAGAGAATAGGAGGTGTATTGG + Intergenic
973218972 4:47704099-47704121 GTAGAAAAGCGGAGGAGCCTGGG - Intronic
973245319 4:48004634-48004656 AGAGAAAATAGGAGGAGGAAGGG + Intronic
974116776 4:57588820-57588842 GTAGGGAAAAGGAGGACTATGGG - Intergenic
974241573 4:59255459-59255481 GTTGAAAAAAAGAGGTGTATGGG - Intergenic
975351697 4:73354513-73354535 ATAGAAAATAGGAGGGTAATGGG + Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
976777199 4:88719671-88719693 GAAGAAAAAAGGAGGAGGAGAGG - Intergenic
981035615 4:140165477-140165499 GTAGAAAAATGGAGAATTATTGG - Intergenic
982044077 4:151424339-151424361 TTAGAAAAAAGGAGGAGTGCTGG + Intronic
982212965 4:153055835-153055857 ATAAACAATAGGAGGAGTAGGGG + Intergenic
983065547 4:163206111-163206133 GAAGAAAATAGTAGGAATAAGGG + Intergenic
984572939 4:181414999-181415021 GTACAAGGTAGGAGGAGTCTTGG - Intergenic
985214249 4:187633371-187633393 GCAGAAAATAGCAGGGCTATGGG + Intergenic
988769936 5:34422234-34422256 AGAGAAAATAGGGGGAGTGTAGG - Intergenic
991169920 5:63612289-63612311 GTAGAATATAAGAGGTTTATAGG + Intergenic
991598087 5:68324707-68324729 GTAAAATATAGGAGGAGACTGGG - Intergenic
992884791 5:81147735-81147757 GTAGAGAGGAGGAGGATTATAGG - Intronic
993274310 5:85836548-85836570 GTTGAAAATAGGAGGAATGTGGG + Intergenic
994059566 5:95459351-95459373 GTGGAAAGAAGGAGGAGTTTAGG - Intergenic
994926636 5:106124340-106124362 GTGGAAAATAGAAACAGTATAGG - Intergenic
994934670 5:106238983-106239005 GTAGAAAATAAGCTTAGTATAGG - Intergenic
996219432 5:120911676-120911698 GCAGAAAATAGAAAGAGAATGGG + Intergenic
996867418 5:128141437-128141459 GTATAAAATATTTGGAGTATAGG + Intronic
997779826 5:136645240-136645262 GCAGAAAAGAGGAGGAGGCTGGG + Intergenic
998923585 5:147098161-147098183 GTAGATAAGAGCAGGAGCATTGG + Intergenic
999863351 5:155673387-155673409 CTAGAAAATAGGAAGGGTAGGGG - Intergenic
1000110772 5:158106206-158106228 GTATAAAATAGGGGGTTTATAGG + Intergenic
1004431745 6:15551329-15551351 GTAGAAAACAGGAAGAGTGAGGG - Intronic
1004830172 6:19468279-19468301 GAAGACAATTAGAGGAGTATCGG - Intergenic
1005261692 6:24068017-24068039 GGAGAAAATAGAAGGAATAAAGG - Intergenic
1008366035 6:50681737-50681759 GAAGAAAATAGGAGGTGTTGAGG - Intergenic
1008515162 6:52311971-52311993 GCAGAAAAGAGTAGGAGCATTGG - Intergenic
1009831448 6:68941642-68941664 GGAGAAAATAGGAGGAGAAAAGG + Intronic
1010802745 6:80196726-80196748 GGAGAAAAAAGGAGGAGGATGGG + Intronic
1011665184 6:89626498-89626520 CTAGAAAACAGGAGGAGCACAGG + Intronic
1015319895 6:131860765-131860787 GTAGCATATAGCAGTAGTATGGG + Intronic
1016382731 6:143501354-143501376 ATATAAAATAAGATGAGTATTGG - Intronic
1016919575 6:149278718-149278740 GAAGAAAAAAGGAGAAGTAGAGG + Intronic
1017967607 6:159280110-159280132 GCAGAAAATAGGAGGGGGAGGGG - Intergenic
1020726318 7:11819893-11819915 GAAGAAAATAGTGGGAGAATGGG + Intronic
1020821657 7:12975981-12976003 TTAGAAAATAGTAGTATTATTGG - Intergenic
1021147874 7:17111412-17111434 AGAGAAAATAGGAGGAGAAAAGG - Intergenic
1021294135 7:18882868-18882890 GAAGAAAATGGAAGGAGGATGGG + Intronic
1028613820 7:92741558-92741580 GTTGAAAATGGTAGGATTATGGG + Intronic
1028624149 7:92858959-92858981 TTAGAAAATAGCAAGAGTTTGGG + Intergenic
1030014842 7:105208642-105208664 GGAGAAAAAAGGAGGAAAATGGG + Intronic
1032026724 7:128448542-128448564 GGAGAAAATAGGAGGAAAAAAGG + Intergenic
1032986363 7:137342418-137342440 TCAGAAAATAGGAGGGGTAGGGG - Intronic
1033780120 7:144658873-144658895 GTAGAAAATAAGAAGATAATAGG + Intronic
1036108978 8:5876845-5876867 GCTCAAAAAAGGAGGAGTATGGG - Intergenic
1037288051 8:17321963-17321985 GGAGAAAATAAGAGTGGTATAGG - Intronic
1039785348 8:40829886-40829908 GAAGATAATAGGAGGGGCATAGG + Intronic
1041159894 8:55029128-55029150 TTAAAAAGTAGGAGTAGTATGGG - Intergenic
1042857146 8:73278861-73278883 ATAGAAAATAGGGGGAGTTATGG - Intergenic
1045124022 8:99069756-99069778 GAAGGAAATTGGAAGAGTATTGG + Intronic
1046186469 8:110727739-110727761 GTAGAAAAAAGAAGTCGTATTGG - Intergenic
1046245288 8:111551868-111551890 GTAAAAAATAGGAGGGAAATTGG - Intergenic
1046392457 8:113593295-113593317 GTAGAAGAAAGGAAGAGAATGGG + Intergenic
1046693140 8:117308479-117308501 GGAGTAAACAGGAAGAGTATTGG + Intergenic
1047362632 8:124183252-124183274 GTAGTTAACAGGATGAGTATTGG - Intergenic
1048472282 8:134713826-134713848 GTAGAAAATATGAAGTGTCTTGG - Intergenic
1051076399 9:13242711-13242733 GTAGATTATATGAGGGGTATTGG - Intronic
1051528762 9:18076840-18076862 GCAGAAAATAGGAGGAAAAATGG + Intergenic
1052317841 9:27134828-27134850 CCAGAACATAGGAGGAATATAGG + Intronic
1055715938 9:79117983-79118005 GTGGAAAACAGAAGGAGAATTGG + Intergenic
1055905034 9:81283664-81283686 TTGGAAAATAGGAAGAATATAGG + Intergenic
1055919118 9:81438843-81438865 GTGGAAAACAGGAGGAGAGTAGG - Intergenic
1056154406 9:83819734-83819756 GCAGAAAATGGGAGGAGAATAGG + Intronic
1056356100 9:85803384-85803406 GCAGAAAATGGGAGGAGAATAGG - Intergenic
1056493306 9:87129597-87129619 GTAGAAAATAGGAGGAGAATGGG - Intergenic
1058720398 9:107758996-107759018 GCAGAAAACAGGAGGACTCTTGG - Intergenic
1059391482 9:114002187-114002209 GATGAAAGTAGGAGGAGAATGGG - Intronic
1185619620 X:1445557-1445579 GTAGAAGATAGCCTGAGTATAGG - Intronic
1187895565 X:23976852-23976874 GGAGAAAATAGCAAGAGTATGGG - Intergenic
1188081360 X:25845283-25845305 TTAGAAAACAGGCTGAGTATAGG + Intergenic
1190363323 X:49668995-49669017 GTAGACAATATGATGAGTTTTGG + Intergenic
1191587591 X:62845688-62845710 ATACAAAATAGAAGGGGTATCGG + Intergenic
1194317136 X:92392893-92392915 ATAGAAAAAAGGAGTAGTATTGG + Intronic
1194411644 X:93565373-93565395 AGAGAAAATAGGGGGAGTAAGGG + Intergenic
1195677668 X:107519722-107519744 GCAGAAAGAAGGAGGAGTAATGG + Intergenic
1196051121 X:111305469-111305491 ATATAAAATATGAGGACTATAGG - Intronic
1196866999 X:120078985-120079007 GTAGAAAAGGGCAGGAGTAGAGG - Intergenic
1196876100 X:120157297-120157319 GTAGAAAAGGGCAGGAGTAGAGG + Intergenic
1200008534 X:153104199-153104221 GTGGAAAATAGGATTAGTGTGGG + Intergenic
1200306441 X:155030661-155030683 GTAGAAAATAGGAATAGAAAGGG - Intronic
1200625140 Y:5502949-5502971 GTTGATAATAGTAGGAGAATTGG + Intronic
1200625310 Y:5506210-5506232 ATAGAAAAAAGGAGTAGTATTGG + Intronic