ID: 926257594

View in Genome Browser
Species Human (GRCh38)
Location 2:11220607-11220629
Sequence GCTCTATGTTTGAGTGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 366}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926257591_926257594 7 Left 926257591 2:11220577-11220599 CCTCCAAACTGTAATGACATAGT 0: 1
1: 0
2: 0
3: 5
4: 113
Right 926257594 2:11220607-11220629 GCTCTATGTTTGAGTGCTACTGG 0: 1
1: 0
2: 0
3: 12
4: 366
926257590_926257594 26 Left 926257590 2:11220558-11220580 CCACATAGTCTCATCGAGTCCTC 0: 1
1: 0
2: 0
3: 3
4: 77
Right 926257594 2:11220607-11220629 GCTCTATGTTTGAGTGCTACTGG 0: 1
1: 0
2: 0
3: 12
4: 366
926257592_926257594 4 Left 926257592 2:11220580-11220602 CCAAACTGTAATGACATAGTAGC 0: 1
1: 0
2: 0
3: 8
4: 77
Right 926257594 2:11220607-11220629 GCTCTATGTTTGAGTGCTACTGG 0: 1
1: 0
2: 0
3: 12
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926257594 Original CRISPR GCTCTATGTTTGAGTGCTAC TGG Intronic
904447102 1:30583044-30583066 GCTCTCTGTTTGACTACTATTGG + Intergenic
905832480 1:41083325-41083347 GCTCTCTGTTTGTCTGATACTGG - Intronic
905981563 1:42233585-42233607 GCTCTATGTTTGTCTGTTATTGG + Intronic
909239269 1:73191591-73191613 GCTCTATTTTCTAGGGCTACTGG - Intergenic
909414524 1:75390189-75390211 GCTCTGAGTTTGTCTGCTACAGG - Intronic
909648168 1:77940161-77940183 GGTACATGTTTAAGTGCTACAGG - Intronic
909739949 1:79015653-79015675 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
910282115 1:85512700-85512722 GCTCTCTGTTTGTCTGCTAATGG - Intronic
910358739 1:86394003-86394025 GCTTTATGTTTGTCTGGTACAGG - Intronic
910929862 1:92432551-92432573 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
911342461 1:96655616-96655638 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
911677755 1:100678717-100678739 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
911801200 1:102140754-102140776 GCTCTCTGTTTGTGTACTACTGG - Intergenic
911813087 1:102308955-102308977 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
912009055 1:104936935-104936957 GCTCTCTGTTTGTGTGTTATTGG + Intergenic
914208320 1:145555106-145555128 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
914966317 1:152261038-152261060 GCTCTCTGTTTGTGTGTTACTGG + Intergenic
916154382 1:161830148-161830170 GCTCTCTGTTTGTCTGCTATTGG - Intronic
916453085 1:164939976-164939998 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
916855641 1:168746439-168746461 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
916978210 1:170104674-170104696 GCTCTCTGTTTGTGTGTTATTGG + Intergenic
917832698 1:178910052-178910074 GCTCTCAGTTTGAGTGTTATTGG + Intronic
918733790 1:188032928-188032950 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
919060221 1:192622624-192622646 GCTCTCTGTTTGTGTGTTATTGG + Intergenic
921406306 1:214783505-214783527 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
922091081 1:222395705-222395727 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
922397169 1:225213698-225213720 GCTCTCTGTTTGTCTGTTACTGG + Intronic
922826290 1:228522484-228522506 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
923431322 1:233923438-233923460 GCTCTCTGTTTGTCTGCTATTGG + Intronic
1063471439 10:6289995-6290017 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
1063763955 10:9115855-9115877 GCTTTACCTTTGAGTGCTTCAGG + Intergenic
1066001493 10:31108175-31108197 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1066035106 10:31473409-31473431 GCTCTCTGTTTGTCTGTTACTGG - Intronic
1066047172 10:31603909-31603931 GCTCTTTGATTGAGTTCTCCTGG + Intergenic
1068652709 10:59540227-59540249 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1069066405 10:63946432-63946454 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
1069337041 10:67364576-67364598 GCTCTCTGTTTGTCTGCTATTGG - Intronic
1071001138 10:80831784-80831806 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1071152191 10:82648797-82648819 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1072364097 10:94691373-94691395 GCTCTCTGTTTGTCTGCTATTGG - Intronic
1072480262 10:95804477-95804499 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1074622000 10:115135385-115135407 GCTCTCTGTTTGAATGTTATTGG - Intronic
1077691952 11:4351243-4351265 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1078682039 11:13486341-13486363 GCTCTATCTTTGGGTTCTGCAGG + Intergenic
1078806941 11:14715551-14715573 GCTCTCTGTTTGTGTGTTATTGG + Intronic
1078894806 11:15588652-15588674 GCTCAATATTTGAATGATACAGG + Intergenic
1081165279 11:39800799-39800821 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1081459096 11:43254596-43254618 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1083513337 11:63232424-63232446 GCTCTCTGTTTGTCTGCTATTGG + Intronic
1085135275 11:74081773-74081795 GCTCTCTGTTTGTCTGCTATTGG + Intronic
1085908388 11:80792119-80792141 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1086024839 11:82278270-82278292 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
1086271150 11:85068501-85068523 GCTCTCTGTTTGTCTGCTATTGG - Intronic
1087003053 11:93440857-93440879 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1087451204 11:98326691-98326713 GCTCTCTGTTTGTGTGTTATTGG + Intergenic
1087597703 11:100273745-100273767 TTTCTATTTTTGAGTGCTAGCGG - Intronic
1087722262 11:101680205-101680227 GCTCTCTGTTTGTGTGTTATTGG + Intronic
1088403720 11:109448958-109448980 GCTCTCTGTTTGTGTGCTATTGG - Intergenic
1088948288 11:114537631-114537653 GCTCTCTGTTTGTCTGTTACTGG - Intronic
1092661650 12:10745055-10745077 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1093008955 12:14083756-14083778 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1097148910 12:56962594-56962616 GCTCTCTGTTTGCCTGCTATTGG - Intergenic
1097898446 12:64850063-64850085 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1098287971 12:68927719-68927741 GCTCTCTGTTTGTCTGTTACTGG - Intronic
1098780545 12:74680727-74680749 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
1099060566 12:77902843-77902865 GCTCTCTGTTTGTCTGCTATTGG - Intronic
1099108297 12:78523294-78523316 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1099512082 12:83550904-83550926 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
1099731526 12:86509852-86509874 GCTCTCTGTTTGTCTGCTATTGG + Intronic
1099750651 12:86768217-86768239 GCTCTCTGTTTGTCTGCTATTGG - Intronic
1099871006 12:88349115-88349137 GCTCTTTGTTTGTCTGCTATTGG - Intergenic
1100110309 12:91233848-91233870 GCTCTCTGTTTGTCTGTTACAGG - Intergenic
1101702629 12:107189407-107189429 GCTCTCTGTTTGTGTGTTATTGG - Intergenic
1102309172 12:111830953-111830975 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1105734962 13:23258338-23258360 GCTCTCTGTTTGTGTGTTATTGG + Intronic
1106640579 13:31580455-31580477 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
1107296908 13:38918827-38918849 GCTCTGAGTTTGAATGTTACTGG + Intergenic
1107567384 13:41619260-41619282 GCTCTCTGTTTGTCTGCTATTGG + Intronic
1111122370 13:83870407-83870429 TCTCTATGTTTGTCTGCTATGGG + Intergenic
1111628356 13:90817525-90817547 GCTCTCTGTTTGACTGTTATTGG - Intergenic
1112145767 13:96698458-96698480 GCTCTCTGTTTGTGTGTTATTGG - Intronic
1113590697 13:111497895-111497917 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
1113974677 13:114218226-114218248 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
1114534326 14:23413273-23413295 GCTCTAAGTTTCAGTGGTTCTGG - Intronic
1115335006 14:32236387-32236409 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1116545680 14:46162928-46162950 GCTCTCTGTTTGTGTGTTATTGG + Intergenic
1117822732 14:59667810-59667832 GCTCTCTGTTTGTCTGCTAATGG - Intronic
1118418385 14:65570782-65570804 ACTCTATATTTGAGTCCTAGTGG + Intronic
1118569220 14:67175869-67175891 GCTCTCTGTTTGTGTGTTATTGG + Intronic
1120971153 14:90208567-90208589 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1122442971 14:101746013-101746035 GCTCTCTGTTTGTGTGTTAATGG + Intergenic
1122856327 14:104561934-104561956 GCTCTTTGTTGGAGGGCTGCAGG - Intronic
1202946824 14_KI270726v1_random:35471-35493 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
1123444449 15:20315236-20315258 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1124948037 15:34288775-34288797 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1126951757 15:53889343-53889365 GCTCTCTGTTTGACTGTTATTGG + Intergenic
1127150329 15:56067927-56067949 GCTCTCTGTTTGTGTGTTATTGG + Intergenic
1127317455 15:57810926-57810948 GCTCTCTGTTTGTTTGTTACTGG + Intergenic
1128803120 15:70509759-70509781 GCTCTAGGTGTGGGTGCTCCTGG - Intergenic
1129548415 15:76422410-76422432 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1130368073 15:83258433-83258455 GCTCACTGTTTCAGAGCTACTGG + Intronic
1131600184 15:93839361-93839383 TTTCTATCTTTGAGTGTTACTGG - Intergenic
1131626437 15:94125502-94125524 GCTTTCTGCTTGAGGGCTACTGG - Intergenic
1131924318 15:97365202-97365224 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1133432125 16:5746730-5746752 GCTCTCTGTTTGTCTGCTACTGG + Intergenic
1133692014 16:8224920-8224942 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1133875528 16:9730637-9730659 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
1136602821 16:31307438-31307460 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1136668132 16:31832181-31832203 CCTCTTTGTTTCAGTGCTCCAGG - Intergenic
1136936545 16:34472531-34472553 GCTCTTTGTTTGACTGCAATAGG + Intergenic
1136963274 16:34876039-34876061 GCTCTTTGTTTGACTGCAATAGG - Intergenic
1137304666 16:47186961-47186983 GCTCTCTGTTTGTCTGTTACTGG - Intronic
1137824641 16:51481043-51481065 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1137972340 16:52998508-52998530 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1138875155 16:60940257-60940279 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
1138968827 16:62119720-62119742 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1141954819 16:87363662-87363684 GCTACATGGTTAAGTGCTACGGG + Intronic
1144535140 17:16081499-16081521 GCACTATGATTGAGTGCTTTTGG - Intronic
1148044899 17:44737527-44737549 GCTTTTTGCTTGGGTGCTACTGG + Intronic
1151757423 17:76082758-76082780 GCTCTGTGCTTGTGTGCTAGCGG - Exonic
1153353945 18:4114400-4114422 GCTCTCTGCTTGAATGCTACTGG + Intronic
1153472587 18:5463553-5463575 GTTCTATGTTGCTGTGCTACAGG + Intronic
1157162874 18:45330516-45330538 GCCCTATCTTTGAGTGATAGAGG + Intronic
1158114091 18:53975551-53975573 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1163941111 19:20494800-20494822 GCTCTCTGTTTGACTGTTATTGG - Intergenic
1164265980 19:23617850-23617872 GCTCTCTGTTTGTCTGTTACTGG - Intronic
1165637787 19:37357630-37357652 GCTCTAAGCTTGAATGTTACTGG + Intronic
925630878 2:5891913-5891935 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
926257594 2:11220607-11220629 GCTCTATGTTTGAGTGCTACTGG + Intronic
927479267 2:23438101-23438123 GCTCTCTGTTTGACTGTTATTGG + Intronic
928495305 2:31825492-31825514 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
928565070 2:32537052-32537074 GCTCTCTGTTTGTCTGTTACTGG + Intronic
928811692 2:35235225-35235247 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
929369115 2:41200300-41200322 GCTGTATGTTTGAGGGCTCTAGG - Intergenic
929405067 2:41632094-41632116 GCTCTGTTTTTGAGGGCTCCAGG - Intergenic
931194582 2:60039193-60039215 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
934250326 2:90347667-90347689 GCTCTTTCTTTGACTGCAACAGG + Intergenic
934259239 2:91455749-91455771 GCTCTTTCTTTGACTGCAACAGG - Intergenic
936545927 2:113393294-113393316 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
937780377 2:125829868-125829890 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
939417186 2:141914703-141914725 GCTCTCGGTTTGAATGTTACTGG - Intronic
939992640 2:148889655-148889677 GCACTATGTTTGACTGCTTCTGG + Intronic
941041071 2:160624382-160624404 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
941236928 2:162986620-162986642 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
941259830 2:163283862-163283884 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
941896448 2:170633816-170633838 GCTCTCTGTTTGTCTGTTACTGG - Intronic
943425922 2:187733639-187733661 GCTCTCTGTTTGTGTGTTATTGG + Intergenic
943929591 2:193832662-193832684 GCTCTCTGTTTGTTTGCTATTGG + Intergenic
944178944 2:196865824-196865846 GCTCTCTGTTTGTCTGTTACTGG - Intronic
944820627 2:203427062-203427084 TCACCATGTTTGAGTGCTACAGG + Intronic
944978149 2:205081808-205081830 TCTCTATTTATGAGTGTTACTGG + Intronic
945496186 2:210509728-210509750 GCTCTCTGTTTGTCTGCTAATGG - Intronic
946139380 2:217675912-217675934 GCTCTCTGTTTGTCTGCTATTGG + Intronic
1169658546 20:7953327-7953349 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
1171155707 20:22871381-22871403 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1171164689 20:22959391-22959413 GCTCTAAGTTTGAGAACCACTGG - Intergenic
1173294344 20:41742667-41742689 GCTCTCAGCTTGAGTGTTACTGG + Intergenic
1174672614 20:52322164-52322186 GCTCTGTGTTGGAGGGCTTCTGG + Intergenic
1174925552 20:54755478-54755500 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
1176451518 21:6866246-6866268 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1176829686 21:13731297-13731319 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1177721764 21:24916390-24916412 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1178967993 21:37142451-37142473 GCTCTCTGTTTGTCTGTTACTGG - Intronic
949232099 3:1762260-1762282 GCTCTTTAGTTAAGTGCTACTGG - Intergenic
949583785 3:5417097-5417119 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
949620305 3:5803367-5803389 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
951199263 3:19859265-19859287 GCTCTCTGTTTGTGTGTTATTGG - Intergenic
951498182 3:23353586-23353608 GCTCTCTGTTTGTCTGCTATTGG - Intronic
954500405 3:51008419-51008441 GCTCTCTGTTTGTCTGCTATTGG + Intronic
954536715 3:51365277-51365299 GCTCTATGTTTGTCTGTTATTGG + Intronic
956222367 3:66918098-66918120 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
957583513 3:82106677-82106699 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
957811234 3:85225392-85225414 GCTCTCTGTTAGTGTGTTACTGG + Intronic
957908268 3:86585327-86585349 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
957917485 3:86705086-86705108 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
958861871 3:99454376-99454398 GCTCTCTGTTTGACTGCTATTGG - Intergenic
958863353 3:99470786-99470808 ACTCTCTGTTTGCATGCTACTGG - Intergenic
958874969 3:99605585-99605607 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
959953189 3:112205252-112205274 GCTCTCTGTTTGACTGTTATTGG - Intronic
960401801 3:117209292-117209314 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
962524856 3:136228630-136228652 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
962548983 3:136469334-136469356 GCTCTCTGTTTGTCTGTTACTGG - Intronic
962553692 3:136524386-136524408 GCTCTCTGTTTGTCTGTTACTGG + Intronic
962831435 3:139145373-139145395 GCTCTCTGTTTGTCTGTTACTGG + Intronic
963679132 3:148351604-148351626 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
964150745 3:153521116-153521138 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
964161949 3:153656214-153656236 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
964245549 3:154648577-154648599 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
964596472 3:158438018-158438040 GCTCTCTGTTTGTCTGTTACTGG - Intronic
965527310 3:169734691-169734713 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
966492165 3:180540159-180540181 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
970021918 4:11579166-11579188 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
970489872 4:16561418-16561440 GCTCTCTGTTTGTGTGTTATGGG - Intronic
970780518 4:19732457-19732479 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
970910947 4:21274990-21275012 GCTTTAGGTTTGAGTGCCATGGG - Intronic
970983374 4:22127501-22127523 GCTCTCTGTTTGTGTGTTACTGG - Intergenic
971466773 4:26972031-26972053 GCTCTCTGTTTGTCTGTTACTGG + Intronic
972196557 4:36660381-36660403 GCTCTCTGTTTGTGTGTTAATGG - Intergenic
973596911 4:52501154-52501176 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
974491235 4:62567731-62567753 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
974584088 4:63846856-63846878 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
975750730 4:77520506-77520528 GCTCTCTGTTTGTCTGCTATTGG + Intronic
976392859 4:84523690-84523712 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
976432791 4:84982469-84982491 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
976433596 4:84991594-84991616 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
976466857 4:85380092-85380114 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
976761125 4:88550484-88550506 GCTCTCTGTTTGTCTGTTACTGG - Intronic
976795142 4:88923903-88923925 GCTCTCTGTTTGTCTGTTACTGG - Intronic
977137499 4:93323838-93323860 GCTCTCTGTTTGTCTGTTACTGG + Intronic
979298802 4:119063694-119063716 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
979300176 4:119077974-119077996 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
979869863 4:125805558-125805580 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
979886545 4:126034299-126034321 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
979981582 4:127262875-127262897 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
981161624 4:141505679-141505701 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
981814702 4:148817241-148817263 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
981885714 4:149670268-149670290 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
982308341 4:153957513-153957535 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
982681366 4:158434968-158434990 GCTCTCTGTTTGTCTGCTATTGG - Intronic
983960033 4:173741226-173741248 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
984359280 4:178708404-178708426 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
986126722 5:4889360-4889382 GCTCTCTGTTTGACTGTTATTGG + Intergenic
986928164 5:12784015-12784037 ACTCATTGTTTGAGGGCTACTGG + Intergenic
988328252 5:29799308-29799330 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
989670617 5:43912266-43912288 GCTCTCTGTTTGACTGTTATGGG + Intergenic
989844940 5:46129874-46129896 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
990600454 5:57353289-57353311 GCTCTCTGTTTGTCTGCTGCTGG + Intergenic
991011887 5:61891648-61891670 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
991160200 5:63490435-63490457 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
991165306 5:63560453-63560475 GCTCTATGTTTGTCTGTTATTGG - Intergenic
991729483 5:69570195-69570217 GATCTAGGTTTGGGTGCTGCTGG + Intronic
991805918 5:70425334-70425356 GATCTAGGTTTGGGTGCTGCTGG + Intergenic
991865469 5:71057685-71057707 GATCTAGGTTTGGGTGCTGCTGG - Intronic
992299634 5:75364966-75364988 GTTCAAGGTTTGAGTTCTACTGG - Intergenic
992926784 5:81596188-81596210 GCTCTCTGTTTGTCTGTTACTGG - Intronic
993796468 5:92273756-92273778 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
994015445 5:94959619-94959641 GCTCTCTGTTTGTCTGTTACTGG - Intronic
994037005 5:95213213-95213235 GCTCTCTGTTTGTCTGTTACTGG - Intronic
994307463 5:98224092-98224114 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
995567205 5:113443288-113443310 GCTCTCTGTTTGTCTGTTACTGG + Intronic
997215610 5:132107693-132107715 GCTCTCTGTTTGTGTGTTATTGG - Intergenic
997578253 5:134999699-134999721 GCTCTCTGTTTGTGTGTTATTGG + Intronic
998694656 5:144625605-144625627 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
999918009 5:156285023-156285045 GCTCTCTGTTTGTGTGTTATTGG - Intronic
1004799521 6:19131048-19131070 GCTCTCTGTTTGTGTGTTATTGG - Intergenic
1006205563 6:32338672-32338694 CCTCTTTCTTTGAGTGTTACTGG + Intronic
1006999900 6:38300650-38300672 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1007644161 6:43368172-43368194 CCTCTATGTTTCACTGCTAGAGG - Intronic
1008080561 6:47190329-47190351 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1008575101 6:52852825-52852847 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1008817779 6:55589752-55589774 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
1009000253 6:57704751-57704773 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
1009341287 6:62557924-62557946 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
1009381852 6:63041311-63041333 GCTCTCTGTTTCTCTGCTACTGG + Intergenic
1009517166 6:64635114-64635136 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1009643400 6:66366761-66366783 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1009741113 6:67747328-67747350 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1009795644 6:68463342-68463364 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1010348015 6:74836105-74836127 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1010461033 6:76114564-76114586 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
1010681401 6:78803384-78803406 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
1010718069 6:79253089-79253111 GCTCTATGTTTGTCTGTTATTGG + Intergenic
1010721616 6:79289002-79289024 GCTCTATGTTTGTCTGTTATTGG - Intergenic
1010724824 6:79321437-79321459 GCTCTCTGTTTGTGTGTTATTGG + Intergenic
1010856962 6:80851958-80851980 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1011302441 6:85890700-85890722 GCTCTCTGTTTGTGTGTTATTGG + Intergenic
1011432755 6:87305376-87305398 GCTCTATGTTTGTCTGTTATTGG - Intronic
1011578614 6:88831789-88831811 GCTCTCTGTTTGTCTGTTACTGG - Intronic
1012088084 6:94855343-94855365 GCTCTCTGTTTGTGTGTTATTGG - Intergenic
1012332464 6:98009926-98009948 GCTCTCTGTTTGTGTGTTATTGG + Intergenic
1013871392 6:114765855-114765877 GCTCTCAGCTTGAGTGCTATTGG + Intergenic
1014146228 6:118000799-118000821 GCTCTCTGTTTGTCTGTTACTGG - Intronic
1018213677 6:161506317-161506339 GCTCTCTGTTTGTCTGCTATTGG + Intronic
1018525367 6:164704542-164704564 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
1018760347 6:166889160-166889182 GCTCTCTGTTTGTCTGCTATTGG - Intronic
1020562067 7:9740583-9740605 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
1020844916 7:13270479-13270501 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1021321447 7:19217797-19217819 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1021733647 7:23621370-23621392 GCTCTCTGTTTGTGTGTTATTGG + Intronic
1022616066 7:31931438-31931460 GCTCTCTGTTTGTCTGCTATTGG - Intronic
1023018255 7:35986952-35986974 GGTCTTTGTTTAAGTGCTTCTGG + Intergenic
1023692206 7:42801543-42801565 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1024852203 7:53732239-53732261 GCTCAATGTTTGAATTTTACTGG + Intergenic
1026587043 7:71664285-71664307 GCTCTACTTTGGAGTCCTACAGG - Intronic
1027496334 7:78892079-78892101 GCTCTCTGTTTGTCTGCTATTGG - Intronic
1027839504 7:83291118-83291140 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
1028071695 7:86458826-86458848 GCTCTCTGTTTGTCTGCTGCTGG + Intergenic
1028287230 7:89017127-89017149 GCTCTCTGTTTGTCTGCTATTGG + Intronic
1028664420 7:93324643-93324665 GCTCTCTGTTTGACTGTTATTGG - Intronic
1028668023 7:93369688-93369710 GCTCTCTGTTTGACTGTTATTGG - Intergenic
1029965088 7:104731514-104731536 GCTCTATGTTTGTCTGTTATTGG + Intronic
1031575258 7:123408275-123408297 ATTCTGTGTTTGAGTGCTAGCGG + Intergenic
1031575263 7:123408363-123408385 ATTCTGTGTTTGAGTGCTAGCGG + Intergenic
1031705509 7:124976245-124976267 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1031905420 7:127455290-127455312 GCTCTCTGTTTGACTGTTAATGG - Intergenic
1032912801 7:136453000-136453022 GCTCTCTGTTTGAATGTTATTGG + Intergenic
1033893644 7:146044919-146044941 GCTCTCTGTTTGTGTGTTATTGG + Intergenic
1033965264 7:146967600-146967622 GCTCTCTGTTTGTCTGCTATTGG + Intronic
1034843172 7:154418588-154418610 GCTCTATCTGTGAGTCCTAGAGG + Intronic
1035357355 7:158284411-158284433 GCTCTATGAGTAAGTGCTGCTGG + Intronic
1035558411 8:585560-585582 GCTCTCTGTTTGCCTGTTACTGG + Intergenic
1036753271 8:11456457-11456479 GCTGTATGTGTGAGTGCTTGGGG + Intronic
1036974796 8:13398553-13398575 GCTCTATGTTCTAGGGCTCCTGG - Intronic
1037728778 8:21506091-21506113 CATCTAAGTCTGAGTGCTACGGG + Intergenic
1041035205 8:53782332-53782354 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1041580910 8:59458618-59458640 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
1041884202 8:62789324-62789346 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1041885690 8:62805001-62805023 GCTCTATGTTTGTCTGTTATTGG - Intronic
1042887958 8:73573102-73573124 GCTCTCTGTTTGTCTGTTACTGG - Intronic
1043757040 8:84016662-84016684 GCTCTCTGTTTGTGTGTTATTGG + Intergenic
1043785175 8:84389634-84389656 GCTCTCTGTTTGTGTGTTACTGG + Intronic
1044077309 8:87838500-87838522 TCTATATATTTGGGTGCTACAGG - Intergenic
1044292387 8:90487795-90487817 GCTCTTTGTTTGTCTGTTACTGG + Intergenic
1045450644 8:102321288-102321310 GCTCTCTGTTTGTGTGTTATTGG - Intronic
1045570816 8:103367588-103367610 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1045572686 8:103385832-103385854 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1045874599 8:106964347-106964369 GCTCTTTGTTTGTCTGCTATTGG + Intergenic
1045978593 8:108157816-108157838 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1046098540 8:109588337-109588359 GTTCTATATTTTATTGCTACTGG + Intronic
1046122430 8:109862966-109862988 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1046285326 8:112086165-112086187 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1046415491 8:113908097-113908119 GCTCTCTGTTTGTCTGCTGCTGG + Intergenic
1047386127 8:124411142-124411164 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1050059602 9:1692747-1692769 GCTCTCTGTTTGACTGTTATTGG - Intergenic
1050373757 9:4949499-4949521 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1050976548 9:11945781-11945803 GCTCTCTGTTTGACTGTTACTGG - Intergenic
1051116489 9:13699985-13700007 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1051309200 9:15751125-15751147 GCTCTCTGTTGGACTGTTACTGG - Intronic
1051738849 9:20231525-20231547 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1052052317 9:23862395-23862417 GCTCTCTGTTTGTGTGTTATTGG + Intergenic
1052056030 9:23908784-23908806 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1052326886 9:27224957-27224979 GCTCTCTGTTTGTCTGCTATTGG - Intronic
1052328589 9:27243711-27243733 GCTCTCTGTTTGTGTGTTATTGG - Intergenic
1052478702 9:28994218-28994240 GCTCTATGTTTGTCTGTTATTGG - Intergenic
1053042023 9:34882563-34882585 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1053568424 9:39278149-39278171 GCTCTCTGTTTGTCTGCTATTGG - Intronic
1054128721 9:61340861-61340883 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
1055386442 9:75767736-75767758 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
1058802212 9:108555575-108555597 GCTCTATATTTGAGTGAAATAGG + Intergenic
1203517663 Un_GL000213v1:18271-18293 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1187936113 X:24337629-24337651 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
1190592818 X:52022227-52022249 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
1190607929 X:52164254-52164276 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
1192021516 X:67397323-67397345 GCTCTCTGTTTGTGTGTTATTGG + Intergenic
1192636751 X:72826999-72827021 GCTCTCTGTTTGTCTGTTACGGG + Intronic
1192644963 X:72893815-72893837 GCTCTCTGTTTGTCTGTTACGGG - Intronic
1192957705 X:76091033-76091055 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1193004349 X:76598878-76598900 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
1193036231 X:76954496-76954518 GCTCTTTGTTTGTCTGTTACTGG - Intergenic
1193095331 X:77542166-77542188 GCTCTATGTTTGTCTGTTATTGG - Intronic
1193705593 X:84817488-84817510 GCTCTCTGTTTGTGTGTTATTGG - Intergenic
1194417499 X:93631669-93631691 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
1194508685 X:94765381-94765403 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1195787559 X:108543899-108543921 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1196140802 X:112261392-112261414 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
1196146558 X:112324999-112325021 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
1196167106 X:112547598-112547620 GCTCTCTGTTTGACTGTTACTGG + Intergenic
1196756763 X:119164368-119164390 GCTCTCTGTTTGTCTGCTATTGG - Intergenic
1197298771 X:124753279-124753301 GCTCTCTGTTTGTCTGTTACTGG + Intronic
1197384827 X:125789800-125789822 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1198347674 X:135774775-135774797 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1198349579 X:135792036-135792058 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1198351484 X:135809309-135809331 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1198353393 X:135826575-135826597 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1198355300 X:135843829-135843851 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1198357210 X:135861112-135861134 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1198359124 X:135878391-135878413 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1198704476 X:139434026-139434048 GCTCTCTGTTTGTCTGCTATTGG + Intergenic
1199468921 X:148171909-148171931 GCTCTCTGTTTGTGTGTTATTGG - Intergenic
1199968130 X:152837094-152837116 GCTCTCTGTTTGTCTGCTATTGG + Intronic
1201171410 Y:11269791-11269813 GCTCTCTGTTTGTGTGTTATTGG + Intergenic
1201348220 Y:13008583-13008605 GCTCTCTGTTTGTGTGTTATTGG - Intergenic
1201544751 Y:15149492-15149514 GCTCTCTGTTTGACTGTTATTGG - Intergenic
1201740669 Y:17321552-17321574 GCTCTCTGTTTGTCTGTTACTGG + Intergenic
1202022605 Y:20481396-20481418 GCTCTCTGTTTGTCTGTTACTGG - Intergenic
1202241871 Y:22779265-22779287 GCTCTCTGTTTGACTGTTATTGG - Intergenic
1202394855 Y:24413009-24413031 GCTCTCTGTTTGACTGTTATTGG - Intergenic
1202475929 Y:25257083-25257105 GCTCTCTGTTTGACTGTTATTGG + Intergenic