ID: 926258196

View in Genome Browser
Species Human (GRCh38)
Location 2:11229415-11229437
Sequence TTGGTTTACCAACAGTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926258189_926258196 24 Left 926258189 2:11229368-11229390 CCCTGTTTAAATGAACTGTGAGA 0: 1
1: 0
2: 2
3: 16
4: 206
Right 926258196 2:11229415-11229437 TTGGTTTACCAACAGTGGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 80
926258190_926258196 23 Left 926258190 2:11229369-11229391 CCTGTTTAAATGAACTGTGAGAA 0: 1
1: 0
2: 0
3: 22
4: 185
Right 926258196 2:11229415-11229437 TTGGTTTACCAACAGTGGGTGGG 0: 1
1: 0
2: 0
3: 7
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926258196 Original CRISPR TTGGTTTACCAACAGTGGGT GGG Intronic
902177887 1:14664998-14665020 TTGGTTCTCAAACACTGGGTTGG - Intronic
904839704 1:33364462-33364484 TTGGTTCATTGACAGTGGGTTGG + Intronic
907442120 1:54485483-54485505 TTAGTCTCCCAACCGTGGGTGGG - Intergenic
912439088 1:109684964-109684986 GTGGTGTACGAACAGAGGGTAGG - Intronic
913149318 1:116024902-116024924 TCGGTTCTCCAACAGTGGGTGGG + Intronic
916776391 1:167969330-167969352 TCAGTTTACAAACAGTGGCTAGG + Intronic
920942824 1:210500104-210500126 TTGGGTTACCAACAGGGGCAAGG + Intronic
921711215 1:218375234-218375256 TTGGCTTATCAACAGCAGGTTGG - Intronic
1062999004 10:1896460-1896482 CTGCTTTACCAACCTTGGGTGGG + Intergenic
1070323332 10:75371382-75371404 ATGGTTTGGCAAGAGTGGGTTGG + Intergenic
1072744915 10:97933187-97933209 TTGGTTAATCGACAGTGGGCGGG - Intronic
1073282555 10:102365298-102365320 TTAGCTGACCAACTGTGGGTGGG + Intronic
1079306348 11:19326982-19327004 TTGGTTTGCCAACACTGCTTTGG + Intergenic
1086201394 11:84206978-84207000 TTAATTTTCCAACAGTTGGTTGG - Intronic
1087115803 11:94522928-94522950 TTGTATTAACAACAGTGGCTGGG + Intergenic
1095205254 12:39432173-39432195 TTGATTTACCATCACTGGCTTGG + Intronic
1096761359 12:53844500-53844522 TTGGTTGCCCAGTAGTGGGTGGG + Intergenic
1105354292 13:19644690-19644712 TTTGTTTCCTAACAGTGTGTTGG + Intronic
1109292333 13:60491728-60491750 TGCATTTACCAACAGTGTGTGGG + Intronic
1112294421 13:98174132-98174154 TTGGTTTACTAACATAGAGTGGG - Intronic
1115149564 14:30268895-30268917 TTGCTTCACCAACAGTGGAAAGG - Intergenic
1117518352 14:56525205-56525227 TTGATCTACAAACAGTGGGAGGG - Intronic
1125129656 15:36268618-36268640 TTAGTTTGCCAACAGTGAATTGG - Intergenic
1127174851 15:56342817-56342839 GTTGTTTCCCAACAGTCGGTAGG + Intronic
1128182892 15:65620613-65620635 TGGGTTTACCCCCAGCGGGTAGG + Intronic
1131947954 15:97648568-97648590 TTGGTTTAATAACAGGAGGTTGG - Intergenic
1137602763 16:49767905-49767927 TTGGTTCACAGACAGTGGGGAGG - Intronic
1140401291 16:74674036-74674058 TTGTTTTATCCAAAGTGGGTTGG - Intronic
1140785492 16:78337214-78337236 TGTGTTGACCAAGAGTGGGTAGG + Intronic
1141205957 16:81933331-81933353 CTGGTTTCCCAAGAGTGGGATGG - Intronic
1144139828 17:12337452-12337474 TTGGTTTCCCAGCGGTGAGTTGG + Intergenic
1145252377 17:21303646-21303668 CTGGTTTTCCCACAGTGGGTTGG + Intronic
1145862122 17:28219866-28219888 TCGGTTTACCAAGAGTTGATTGG - Intergenic
1146534151 17:33635119-33635141 TTGATTTAGAAACAGTGAGTTGG - Intronic
1146680314 17:34802558-34802580 CTGGTTTTCCATCAGTGGATGGG + Intergenic
1153561219 18:6373608-6373630 TTGCTTTGCCAACACTGGGTTGG - Intronic
1153978754 18:10291622-10291644 TCCCTTTCCCAACAGTGGGTGGG - Intergenic
1159153904 18:64556939-64556961 TCTGTTTGCCAACAGTGGATAGG + Intergenic
1162312268 19:9914236-9914258 TGGGTGTCCCAACAGTGGGTGGG - Intronic
1164041357 19:21495349-21495371 TAGGTTTGCCAACATTTGGTAGG - Intergenic
1168448846 19:56447406-56447428 TTGGTTTACCCATACTGGATAGG - Intronic
926258196 2:11229415-11229437 TTGGTTTACCAACAGTGGGTGGG + Intronic
928786193 2:34888523-34888545 TTGGTGTACCTGCAGGGGGTGGG + Intergenic
929743013 2:44624045-44624067 TTGTTTTATCAACAGTTGGGTGG - Intronic
929955247 2:46453175-46453197 TTGGTTTACAAATGGAGGGTGGG - Intronic
930746025 2:54884405-54884427 TTGGTTTACCAACTGGCGATGGG + Intronic
940702051 2:157057512-157057534 TTGGTTTACAAAAAGTGGAGAGG + Intergenic
942420970 2:175807317-175807339 TTGGTTTAGCTAAAGTGGCTAGG + Intergenic
943129075 2:183835135-183835157 ATGGTTTAACAAAAGTGGGAAGG - Intergenic
948573803 2:238936907-238936929 GTGGTTTACCAATTGAGGGTGGG - Intergenic
1171408618 20:24930797-24930819 TTTGTGTACCTACTGTGGGTGGG + Intergenic
1174374968 20:50120532-50120554 TTGGTTTATCAAAGGAGGGTTGG + Intronic
1175312689 20:58023010-58023032 TTGGTTTTACATTAGTGGGTTGG - Intergenic
1178156482 21:29859670-29859692 TTGATTTATCAGCACTGGGTGGG + Intronic
949279157 3:2326129-2326151 TTGCTTTCCCAAATGTGGGTGGG + Intronic
960072894 3:113451923-113451945 GGGCTTTAACAACAGTGGGTTGG - Intronic
971076194 4:23152213-23152235 CTATTTTACCATCAGTGGGTTGG + Intergenic
971200810 4:24507821-24507843 CTGGTTTTCCAGCAGTGGGCAGG - Intergenic
986210000 5:5662733-5662755 GTGGTTTGACAGCAGTGGGTGGG - Intergenic
986808832 5:11334419-11334441 TTGGTTTACAGACAGGTGGTTGG - Intronic
986852721 5:11831771-11831793 TTGTTTTACCATCAGTTGTTAGG - Intronic
993172456 5:84436208-84436230 AAGGTTTACCAACAGGGAGTAGG - Intergenic
993937953 5:94026324-94026346 TTGGTGTACCCACATTCGGTGGG + Intronic
1000429187 5:161130495-161130517 TTGGTATAACAGCAGTAGGTTGG - Intergenic
1000744602 5:165017361-165017383 TTGGTTTAGCAACTCTGGGATGG + Intergenic
1000997375 5:167973335-167973357 TGGGATTACCAACAGGAGGTGGG - Intronic
1006359060 6:33577422-33577444 TCGGTTCACCCACTGTGGGTGGG - Intronic
1006596128 6:35193653-35193675 TTGATTTGACAACAGTGGGCAGG - Intergenic
1010392229 6:75350714-75350736 TTGGTTTAATAAAAGTGTGTAGG - Intronic
1012953533 6:105543870-105543892 TTGTTTCACCAATAGTGGGAAGG - Intergenic
1014326346 6:120000281-120000303 TTGGTTTGCAAACAGTTGGAAGG - Intergenic
1017033417 6:150244750-150244772 TATGTTTACAAACTGTGGGTGGG + Intronic
1017562653 6:155646259-155646281 TTTGTGTTCCAACAGTGGCTTGG + Intergenic
1026933319 7:74237407-74237429 CTCCTTTACCAGCAGTGGGTGGG + Exonic
1033963072 7:146937580-146937602 TTGGTTTATAAAAAGTGGCTGGG + Intronic
1037591437 8:20315498-20315520 TGGGGTTACCATGAGTGGGTGGG + Intergenic
1037895058 8:22646447-22646469 TGGGTTTAGCAACAGTGTGTTGG - Intronic
1045125960 8:99089313-99089335 TTGGTTTACAAACAGAAGGAAGG - Intronic
1048596157 8:135868647-135868669 TTGTTCTACCAACTGTGAGTAGG - Intergenic
1055868998 9:80851742-80851764 ATTGTTTACCTACAGAGGGTAGG + Intergenic
1056169603 9:83971640-83971662 TTGGTTTATTACCAGTGTGTTGG - Intronic
1056683399 9:88739740-88739762 TTGTTTTTCCAACTGTGGGGAGG - Intergenic
1186457075 X:9718132-9718154 CTGGGTCACCAGCAGTGGGTAGG + Exonic
1189223230 X:39390787-39390809 TTGGTTTCCCAACAATGGCCTGG - Intergenic
1189259249 X:39666474-39666496 TTATCTTACCAACAGTGGGTCGG + Intergenic
1190791908 X:53708267-53708289 TTGGTTTACCAAACGGGAGTAGG - Intergenic
1191732212 X:64349001-64349023 CTGATTTACCAAGACTGGGTTGG - Intronic
1194748809 X:97660932-97660954 TTGGTTCAGCAACAGTGGTTTGG + Intergenic