ID: 926258904

View in Genome Browser
Species Human (GRCh38)
Location 2:11238308-11238330
Sequence TCCAATCCGTGTACATGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 53}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926258904_926258906 -1 Left 926258904 2:11238308-11238330 CCACCTCATGTACACGGATTGGA 0: 1
1: 0
2: 0
3: 5
4: 53
Right 926258906 2:11238330-11238352 AAGAATCAATACTATCAAAATGG 0: 1
1: 15
2: 500
3: 8201
4: 12335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926258904 Original CRISPR TCCAATCCGTGTACATGAGG TGG (reversed) Intronic
918272690 1:182918526-182918548 TCCAATCCATGAACATGGGATGG - Intronic
920244686 1:204578759-204578781 TCAAATCCGTGTACATTTGCTGG + Intergenic
921042255 1:211444525-211444547 TCCAATCCATGAACATGGGGTGG - Intergenic
1065054196 10:21827068-21827090 TCCAATCCATGAACATAAGACGG + Intronic
1066167982 10:32808521-32808543 TCCAGACAGTGTACATGATGTGG - Intronic
1067047602 10:42993265-42993287 CCCACTCTGTGTACATGGGGTGG + Intergenic
1086649014 11:89263863-89263885 TCCAATCTGTGAACAAGGGGGGG - Intronic
1088418319 11:109614518-109614540 TCCAGTTCGTGTGCATGAAGAGG - Intergenic
1094524216 12:31220929-31220951 TCCAAGCGTTGGACATGAGGCGG + Intergenic
1094567785 12:31615994-31616016 TCAATACCATGTACATGAGGTGG + Intergenic
1095891267 12:47236382-47236404 TCCAATCCATGTTCATAAAGAGG - Exonic
1098624657 12:72648919-72648941 TCCAATCCATGAACATCAGATGG - Intronic
1098808719 12:75055741-75055763 TCCAATCAGTGACCATGAGTTGG + Intronic
1099394381 12:82120371-82120393 TCCAATCCGTGAGCATGAAATGG - Intergenic
1104956655 12:132469838-132469860 TGCAATCCATGTATATGATGAGG + Intergenic
1126623632 15:50665145-50665167 TGCAATCCGAGTACTTTAGGAGG + Intronic
1131016077 15:89058715-89058737 GCCAATCATTGGACATGAGGGGG - Intergenic
1142060563 16:88026692-88026714 TCCAAACTGTGTTTATGAGGGGG + Intronic
1142172523 16:88630434-88630456 GCCATTCCCTGTACATCAGGAGG + Intronic
1142376391 16:89709038-89709060 TCCCAGCCGTGCACATCAGGAGG - Intronic
1146251241 17:31345942-31345964 TCAATACCATGTACATGAGGTGG - Intronic
1146689975 17:34866614-34866636 TCAAATCCCTGTTCCTGAGGGGG - Intergenic
1150199348 17:63337918-63337940 TTCCATCCGTGTTCCTGAGGAGG + Intronic
1153225999 18:2900442-2900464 TGCAATCCCAGTACATTAGGAGG - Intronic
1160654947 19:261129-261151 TCCACCCCGTGTAAATGAAGAGG - Intergenic
1168515594 19:57008159-57008181 TCCAATCCCTGCACTTTAGGAGG + Intergenic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
928117048 2:28552983-28553005 TGCAAGCTGTGTACCTGAGGTGG - Exonic
930127018 2:47808194-47808216 TCTAATCCTTGTACATTAGCTGG - Exonic
932775843 2:74527936-74527958 TGCACTCCGTGTACAACAGGTGG - Exonic
935806540 2:106754259-106754281 TCCCATCTGTGTCTATGAGGAGG - Intergenic
937763077 2:125628652-125628674 TTCAGTCAGTGTACATGAGGAGG + Intergenic
941108380 2:161389384-161389406 TCATATTCGTGTACATTAGGAGG - Intronic
947911597 2:233804228-233804250 TCCAATCCGTGTATGTGCTGGGG + Intronic
1172346845 20:34208737-34208759 TCCAATCTATGAACATGAGATGG + Intronic
1175020354 20:55840880-55840902 TCCAATCCATGAACATGAGATGG - Intergenic
1179118584 21:38520450-38520472 TCTCATCTGTGTCCATGAGGTGG + Intronic
1180395172 22:12325221-12325243 TCCTATCCATGAGCATGAGGTGG + Intergenic
1180404568 22:12539530-12539552 TCCTATCCATGAGCATGAGGTGG - Intergenic
950606197 3:14083051-14083073 TCCAAACCGTTAACATCAGGAGG - Intergenic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
956592303 3:70927458-70927480 TCCAATGCATATTCATGAGGTGG - Intergenic
960203383 3:114865530-114865552 TCAAATCCATGTATAGGAGGTGG - Intronic
981556195 4:145997662-145997684 TCCAATCCATGAACATGAGATGG + Intergenic
990412149 5:55552108-55552130 TCAATCCCATGTACATGAGGTGG + Intergenic
992087867 5:73294300-73294322 TCCAGTATGTGAACATGAGGAGG - Intergenic
1000210001 5:159100099-159100121 TCCTTTGCGTGTAGATGAGGAGG + Intergenic
1009382437 6:63049180-63049202 TCCAATCTGTGCACATGGGATGG + Intergenic
1021557595 7:21937164-21937186 TCCAATCCATGAACATGGGATGG - Intronic
1022199868 7:28106035-28106057 TCCAATCCAAGCACATGTGGAGG + Intronic
1028310942 7:89334954-89334976 TCCAGTCCTTGTACAGTAGGGGG + Exonic
1028948471 7:96607620-96607642 CACAATCAATGTACATGAGGTGG - Intronic
1029169645 7:98621570-98621592 TCCAATCATAGTACATGTGGAGG - Intronic
1036498520 8:9292795-9292817 TGCAACCCCTGTACATGAAGAGG + Intergenic
1038178671 8:25205571-25205593 TCAAATCCCTGTAAAAGAGGAGG - Intronic
1041795795 8:61746608-61746630 TTCAATCATTGTACATGAGGTGG - Intergenic
1049565641 8:143337096-143337118 TCCAGTCCGTGAACATGGGATGG - Intronic
1203410225 Un_KI270581v1:1441-1463 TCCTATCCATGAGCATGAGGTGG - Intergenic
1190462533 X:50692725-50692747 TCCTATCCATGTACATGGGCAGG + Intronic