ID: 926258905

View in Genome Browser
Species Human (GRCh38)
Location 2:11238311-11238333
Sequence TCTTCCAATCCGTGTACATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 2, 2: 18, 3: 67, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926258905_926258906 -4 Left 926258905 2:11238311-11238333 CCTCATGTACACGGATTGGAAGA 0: 1
1: 2
2: 18
3: 67
4: 226
Right 926258906 2:11238330-11238352 AAGAATCAATACTATCAAAATGG 0: 1
1: 15
2: 500
3: 8201
4: 12335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926258905 Original CRISPR TCTTCCAATCCGTGTACATG AGG (reversed) Intronic