ID: 926258905

View in Genome Browser
Species Human (GRCh38)
Location 2:11238311-11238333
Sequence TCTTCCAATCCGTGTACATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 2, 2: 18, 3: 67, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926258905_926258906 -4 Left 926258905 2:11238311-11238333 CCTCATGTACACGGATTGGAAGA 0: 1
1: 2
2: 18
3: 67
4: 226
Right 926258906 2:11238330-11238352 AAGAATCAATACTATCAAAATGG 0: 1
1: 15
2: 500
3: 8201
4: 12335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926258905 Original CRISPR TCTTCCAATCCGTGTACATG AGG (reversed) Intronic
905944036 1:41886796-41886818 TCTTCCAGTCTTTGGACATGTGG + Intronic
908839009 1:68259488-68259510 CCTTCTAATCCATGAACATGCGG + Intergenic
909690841 1:78406214-78406236 TCTTCCAATCCATGAACAAGGGG - Intronic
910017409 1:82544143-82544165 TATTCCAATCCATGAACATGGGG - Intergenic
910045748 1:82913039-82913061 TCTTCCAATCCATAAACATTGGG + Intergenic
911266240 1:95747337-95747359 TCTTCCTATCCATGAACATGGGG + Intergenic
911389781 1:97226748-97226770 TCTTCCAGTCCTTGAACATAGGG - Intronic
911984678 1:104607004-104607026 TTCTCCAATCCATGAACATGGGG - Intergenic
911993367 1:104731522-104731544 TCTTCCATTCCGTTTATATTAGG + Intergenic
912636036 1:111294183-111294205 TCTTCCAACTCATGAACATGGGG + Intronic
912902020 1:113661387-113661409 TTTTCCAATTCTTGTAGATGAGG + Intronic
915728861 1:158038454-158038476 TCTTCCAGTCCTTTTACAGGTGG + Intronic
916005610 1:160656975-160656997 TCTTCCAATCCCTCCACACGTGG - Intergenic
917769083 1:178257149-178257171 TCTTCTAATCAATGAACATGGGG - Intronic
919279794 1:195474886-195474908 TCTTTCAATCCATGAACCTGGGG - Intergenic
920061028 1:203227078-203227100 TCGTCCCATCCCTGTCCATGTGG - Intronic
921042256 1:211444528-211444550 TCTTCCAATCCATGAACATGGGG - Intergenic
921369896 1:214411061-214411083 TCTTCCAATCCACGAAGATGGGG + Intronic
923396040 1:233565156-233565178 TCCTCCAATCCATGAACATGGGG - Intergenic
924263878 1:242260415-242260437 TCTTCAAATCCGTATTCCTGAGG - Intronic
924446049 1:244132471-244132493 TCTTCCAATCCATGAACATGAGG + Intergenic
924537383 1:244947954-244947976 TCTTCCAATCCGTGAGCATAGGG - Intergenic
924909394 1:248494266-248494288 TCTTCTAATCCACGAACATGGGG - Intergenic
924914709 1:248553795-248553817 TCTTCTAATCCACGAACATGGGG + Intergenic
1062766195 10:67322-67344 TCTTCCAGTTCGTGAATATGAGG + Intergenic
1064943711 10:20764106-20764128 TCTTCCAGTCCATGAACATAGGG - Intergenic
1066720920 10:38338049-38338071 TCTTCAAATCCGTATTCCTGTGG + Intergenic
1068271953 10:54739447-54739469 TCTTCCAATCCCAAAACATGAGG - Intronic
1068563002 10:58537994-58538016 TCTTCCAATCCATGAGCATAAGG - Intronic
1070377425 10:75846881-75846903 TTTTCCAATCTATGTACATAGGG - Intronic
1071126616 10:82343418-82343440 TCTTCAAATCCATGAGCATGGGG - Intronic
1071956261 10:90763250-90763272 TCTTCTACTCCATGAACATGGGG + Intronic
1074668432 10:115758580-115758602 TCTCCCAATCTGTATACACGGGG + Intronic
1074789364 10:116870834-116870856 GCTGCCATTCCTTGTACATGGGG - Intronic
1075309381 10:121399908-121399930 TCTTCCAATCCATGAACACGTGG - Intergenic
1076039414 10:127230927-127230949 TCTTCTAATCCATGAACATAAGG + Intronic
1077656242 11:4021799-4021821 TCTTCCAACCCATGTACATAGGG + Intronic
1077821400 11:5745570-5745592 TCTTCCAATTCATGAGCATGAGG - Intronic
1078467788 11:11562932-11562954 TCTTCCGATCTGTGAACTTGAGG - Intronic
1078814048 11:14801587-14801609 TCTTCCAGTCAGGATACATGGGG + Intronic
1078981212 11:16537016-16537038 TCTCCCAATCAGGCTACATGGGG - Intronic
1079546386 11:21637768-21637790 TCTTCTAATCCATGTACAGAGGG - Intergenic
1079680607 11:23292357-23292379 TCTTCTGATCCATGAACATGGGG + Intergenic
1081359759 11:42161308-42161330 TTTTCTAATCCATGAACATGGGG - Intergenic
1082206250 11:49437918-49437940 TCTTCCAATCTGTGAACAAGGGG + Intergenic
1082648573 11:55758747-55758769 TCTTCCAATCTGTGAGCATATGG + Intergenic
1082737535 11:56873428-56873450 TCTTCCAGTCACTGTACAGGTGG + Intergenic
1083305525 11:61760329-61760351 TCTCCCAACCAGTTTACATGGGG - Intronic
1083503402 11:63132734-63132756 TCTTCCAGTCAGGCTACATGGGG + Intronic
1085729057 11:78981044-78981066 TCTGCAAAGCCGTATACATGGGG - Intronic
1086649017 11:89263866-89263888 TCTTCCAATCTGTGAACAAGGGG - Intronic
1087465915 11:98505221-98505243 TCTTCCACTTCATGAACATGTGG + Intergenic
1087628300 11:100621707-100621729 TCTTGCATTCCGTGTGCCTGCGG + Intergenic
1088130119 11:106478077-106478099 TCTTCCAATCCATGAATATGGGG + Intergenic
1089766586 11:120771938-120771960 TCTACCAATCTGTGATCATGAGG - Intronic
1090813863 11:130273161-130273183 TCTTCTGATCCATGAACATGGGG + Intronic
1091480160 12:820178-820200 TCTTCTAATCCGTGAACACAGGG + Intronic
1091707637 12:2709380-2709402 TCTTCTAATCCACATACATGGGG - Intergenic
1093260800 12:16935298-16935320 TCTTCCTGTCCATGAACATGGGG + Intergenic
1093738545 12:22653471-22653493 TTTTCCAATCCATGAACATGGGG + Intronic
1094457035 12:30646842-30646864 TCTTTCAATCCCTGAACGTGGGG - Intronic
1094755473 12:33463404-33463426 TCTACCAGTCAGTATACATGGGG - Intergenic
1097435496 12:59548838-59548860 TCTCCCAGTCAGTATACATGGGG + Intergenic
1098916517 12:76262357-76262379 TCTTCCAATCTGTAAACATAGGG + Intergenic
1100061197 12:90577816-90577838 TCTTCCAATCAATGCACATAGGG - Intergenic
1100342600 12:93694836-93694858 TCTTTCAATCCATGAACATGAGG - Intronic
1100968612 12:100042133-100042155 TCTTCCAATCCATGAACAGTGGG - Intronic
1101183343 12:102244545-102244567 TCTTCTAATCCATGGGCATGGGG + Intergenic
1101766294 12:107702712-107702734 TCTTCTAATACATGAACATGGGG + Intronic
1102711439 12:114931471-114931493 TCTTCCAATCTATGAACATAGGG + Intergenic
1103925286 12:124420531-124420553 TCTTCCAAGCCTTGTGCATCGGG + Intronic
1108135728 13:47356126-47356148 TCTTTCAATACATGAACATGGGG + Intergenic
1108153844 13:47564606-47564628 TCTCCCAATCCGGATACATGGGG - Intergenic
1108480253 13:50862494-50862516 TCTTCCAGTCCATGAACATGAGG - Intergenic
1108811931 13:54237068-54237090 TCTTCTAATCCATGAACATGAGG + Intergenic
1111101103 13:83587472-83587494 TGTTTCAATACGTGTATATGTGG - Intergenic
1111302945 13:86368421-86368443 TCTTCCAATCCATAAACATGGGG + Intergenic
1111373382 13:87347454-87347476 TCTTCCAATCCATAAGCATGTGG - Intergenic
1111823207 13:93238182-93238204 TCTTCCAATCCATAAGCATGGGG + Intronic
1114624245 14:24118301-24118323 TCTCCCACTCAGTGTACCTGTGG - Intronic
1114719587 14:24866670-24866692 TCCTCCAATCCTTGAATATGAGG - Intronic
1115047315 14:29012082-29012104 TCTTGCAATTCCTGAACATGGGG - Intergenic
1116417211 14:44693605-44693627 TCTCCCAGTCAGTATACATGGGG - Intergenic
1116605101 14:46982244-46982266 TCTTCCAAACTGTGTAAAGGAGG + Intronic
1117100815 14:52344943-52344965 TCTTCCAGTCCATGAGCATGGGG - Intergenic
1117838469 14:59832180-59832202 TCTTCAGATCCTTGTACCTGTGG + Intronic
1120687293 14:87552779-87552801 TCTTCCAATCCATGAACAAATGG - Intergenic
1120927917 14:89816003-89816025 CCTTCCAATCCATGAGCATGGGG + Intronic
1123969415 15:25492485-25492507 TCTTTCAATCTGTGAACATGGGG - Intergenic
1124178571 15:27451055-27451077 GCTTCCAATCCATGAACATGGGG - Intronic
1125600789 15:40914897-40914919 TCTCCCTATCCTTGGACATGTGG + Intergenic
1127156287 15:56129041-56129063 TCTTCTGATCCATGAACATGGGG - Intronic
1127337604 15:58004904-58004926 TCTTCTAATCCATGAACATGGGG - Intronic
1127944977 15:63742102-63742124 TCTTGCAATCCATAAACATGAGG + Intronic
1129564874 15:76610797-76610819 TATTCCAATCCATTAACATGGGG - Intronic
1134288652 16:12884760-12884782 TATTCCAATCCATGCACATAGGG + Intergenic
1137577321 16:49608910-49608932 TCTTCCCATCCCTGTTAATGTGG + Intronic
1138631831 16:58302011-58302033 TCTTTCAATCCATGAATATGGGG - Intronic
1141258764 16:82431212-82431234 TCTTCCAATCCATGAACATGGGG - Intergenic
1142376392 16:89709041-89709063 TCTTCCCAGCCGTGCACATCAGG - Intronic
1147772999 17:42880320-42880342 TCTTTGCATCCGTGTAGATGGGG - Intergenic
1150547788 17:66179310-66179332 TATTCCAATCCATGAACATAGGG + Intronic
1155763333 18:29593645-29593667 TCATCCAGTCCATGAACATGTGG - Intergenic
1155766702 18:29643218-29643240 ACTTCCAAGCTGTTTACATGTGG + Intergenic
1155933798 18:31733899-31733921 TCTTCCAATTCATGTACATGGGG - Intergenic
1160556834 18:79730989-79731011 TCTTCCACTCCATGTGCTTGGGG + Intronic
1161647221 19:5460873-5460895 TCTTCCATTCTGAGTACACGTGG + Intergenic
1162243171 19:9374497-9374519 TCTTCCAATCCATGAACACTGGG + Intronic
1163200447 19:15763763-15763785 TCTTCCTATCCATGTATATTTGG - Intergenic
1165597052 19:37018173-37018195 TTTCCCAATCCATGAACATGGGG - Intronic
1166405236 19:42516521-42516543 TCTTCTAATCCATGAAAATGGGG - Intronic
1166577853 19:43860840-43860862 TCTTCCAATCCATGAGCATAAGG - Intergenic
926161295 2:10491407-10491429 TCTTCCAATCCGTAAGCATGGGG - Intergenic
926235168 2:11036212-11036234 TCTTCCAATCCATGAGCATGGGG + Intergenic
926258905 2:11238311-11238333 TCTTCCAATCCGTGTACATGAGG - Intronic
926654656 2:15388129-15388151 TCTTCCAATCTATAAACATGAGG + Intronic
926919233 2:17923979-17924001 TCTTTCAATCCGTGAACATTGGG + Intronic
927315939 2:21682510-21682532 TCTTCCGATCCTTGAACATAAGG - Intergenic
929569634 2:43013696-43013718 TCTTCCAATCCATGAACACAGGG + Intergenic
931541462 2:63334135-63334157 TCTTTTAATCCATGAACATGGGG + Intronic
932101475 2:68904372-68904394 TGTTCTAATCCATGAACATGGGG - Intergenic
932270943 2:70408992-70409014 TCTTTCAATTCATGAACATGGGG - Intergenic
932930126 2:76026059-76026081 TCTTCCACTCCATGAGCATGTGG - Intergenic
933103623 2:78292377-78292399 CCTTCCAATCCATGAGCATGGGG + Intergenic
935520669 2:104100518-104100540 TCTTCAAAAACCTGTACATGAGG + Intergenic
935582568 2:104770330-104770352 TCTTCCAATCCACGGACATGAGG - Intergenic
935723678 2:106002327-106002349 TCTTCCAATCCGTGAACATGTGG + Intergenic
936071146 2:109372081-109372103 CCTTCCAATCCGTGTGCAGTGGG - Intronic
937737139 2:125305489-125305511 TCTTTGAATCCATGCACATGGGG - Intergenic
941467741 2:165849888-165849910 TCTTCCAATCCATGAGCATGAGG + Intergenic
941704850 2:168647149-168647171 TCTTCCTATCCATGAACATAGGG + Intronic
941946526 2:171104434-171104456 TCTTCCAATTCATGAACGTGGGG - Intronic
943210487 2:184958676-184958698 TCTTCCAATCCAGGAGCATGGGG - Intergenic
943272336 2:185822584-185822606 TCTTCCAATCTATAAACATGAGG - Intronic
944073307 2:195697346-195697368 TCTTCCAATCCGTGAACATGGGG + Intronic
945058380 2:205887802-205887824 TGGTTCAATCCGTGTACATTGGG + Intergenic
945477423 2:210301300-210301322 TCATCTAATCTGTCTACATGAGG + Intronic
945750223 2:213772830-213772852 TCTTCCAATCTATGAACATGAGG + Intronic
945880859 2:215323422-215323444 TCTTCCAGTCTGTGAACATGGGG + Intronic
947467429 2:230364277-230364299 TAATCCAATCCATGAACATGGGG + Intronic
947476453 2:230452553-230452575 TCCTCCAATCCATGAACATGGGG + Intronic
947911775 2:233805432-233805454 TCTTTCAATCCATGAACATGGGG - Intronic
1171176687 20:23056058-23056080 TCTTCCAATCCATGAACGTAGGG - Intergenic
1171940770 20:31327170-31327192 TCTTCCCGTCCATGAACATGAGG - Intergenic
1175982755 20:62748303-62748325 TCTTGCAATGCATGAACATGAGG - Intronic
1176211351 20:63924295-63924317 GCTTCTAATCCGTGAACATGAGG + Intronic
1176317500 21:5260804-5260826 TCTTCCTATCCATGAGCATGGGG + Intergenic
1177204137 21:17992426-17992448 TCTTCCAATCCATGAGCATGGGG + Intronic
1177261545 21:18735440-18735462 TCTTCTAATCCATGAACGTGGGG + Intergenic
1178094654 21:29200580-29200602 TCTTCTGATCCATGAACATGAGG + Intronic
1178720205 21:35002014-35002036 TCTTCCAATCCATGAACATGAGG - Intronic
1180395171 22:12325218-12325240 TCTTCCTATCCATGAGCATGAGG + Intergenic
1180404569 22:12539533-12539555 TCTTCCTATCCATGAGCATGAGG - Intergenic
1182986869 22:34727651-34727673 TCTTCCAATCCATGGACACAGGG - Intergenic
1184321593 22:43746105-43746127 ACTTCCAATCCGGGGACAAGCGG + Intronic
1185379990 22:50503850-50503872 TCTTCCCATCCGTGTCCCTGGGG - Exonic
949622762 3:5833864-5833886 ACTTCCAATCTGTTTATATGAGG - Intergenic
950245470 3:11412794-11412816 TCTTCCAATTCATGAATATGGGG + Intronic
950910177 3:16581190-16581212 TCTTCCAATCCATGAACATGGGG - Intergenic
951237648 3:20254139-20254161 TCTCCCAATCAGGATACATGGGG + Intergenic
952493367 3:33893581-33893603 TCTTCTAATCCGTGAGCATGGGG + Intergenic
953522910 3:43659791-43659813 TCTTCCAGTCAGGCTACATGGGG - Intronic
955305321 3:57824870-57824892 ACTTCCAGTCCATGAACATGGGG + Intronic
957501129 3:81057517-81057539 TTTTCCAATCCATGAACATGGGG + Intergenic
960787645 3:121391835-121391857 TCTTCCAGTTAGTCTACATGGGG + Intronic
961925886 3:130479637-130479659 TCTTCCAATTAGGCTACATGGGG + Intronic
962062757 3:131948001-131948023 TCTTTCACTCTGTGAACATGGGG + Intronic
962427779 3:135287900-135287922 TCTTCTAATCTGTGAACATGTGG - Intergenic
962666111 3:137654883-137654905 TCTTCCAGTCAGGATACATGGGG - Intergenic
964332657 3:155620948-155620970 TCTTCCAGTCAGGATACATGGGG - Intronic
966027812 3:175306988-175307010 ATTTCCAATTCTTGTACATGAGG - Intronic
969570314 4:8004427-8004449 TCCTCCAATCCCAGCACATGAGG - Intronic
970003258 4:11385739-11385761 TCTTCTAATCAGTGCACATTCGG - Intergenic
972027005 4:34393597-34393619 TATTTCAATCCGTGATCATGAGG - Intergenic
972844190 4:42968189-42968211 TTTTCCAAGCTGTGTACAGGAGG - Intronic
973195979 4:47442337-47442359 TCTTCTAATCCATGAGCATGGGG - Intergenic
973647897 4:52968446-52968468 TCTTCCAATCTGTGGCCGTGGGG + Intronic
974111127 4:57526990-57527012 TCTTCTAATCCATGAACACGGGG - Intergenic
974616977 4:64301075-64301097 ACTTCCAATTCATGTACATATGG - Intronic
976861562 4:89672046-89672068 TCTCCCAATTGGTATACATGGGG - Intergenic
977116400 4:93034203-93034225 TCTTCCCATCTGTCTAAATGTGG - Intronic
977629565 4:99226930-99226952 TCTTCCAATTCATGAACATGGGG + Intergenic
978148776 4:105409604-105409626 TCTGCCAGTCCGGCTACATGGGG - Intronic
978890297 4:113818060-113818082 TCTTCCAATCCATGAATGTGAGG + Intergenic
979507174 4:121511793-121511815 TCTTTCAATCCATGAGCATGGGG - Intergenic
980759916 4:137218811-137218833 TCTTTCAATCCATGAACATGAGG - Intergenic
982326228 4:154131095-154131117 TCTTCTAATCCATGAACATGAGG - Intergenic
983006203 4:162488662-162488684 TCTTCCAATCTGTAAACTTGAGG + Intergenic
983740530 4:171126098-171126120 TCTTCCAGTCCATAAACATGGGG + Intergenic
984000787 4:174240867-174240889 GCTTCCATTTTGTGTACATGTGG + Intronic
984138165 4:175967790-175967812 TCTTTCTATCCATGTACATGGGG - Intronic
984535466 4:180969488-180969510 TCTTCCTATCGATGTTCATGTGG - Intergenic
985596251 5:790357-790379 TCTTCCAATCCATGAGCATGGGG - Intergenic
986435449 5:7725897-7725919 TCTGCAAATATGTGTACATGGGG - Intronic
987751442 5:22043961-22043983 TCTTCCAATCCATGAACATGGGG - Intronic
988862101 5:35292640-35292662 TCTTCTAATCCATGAACATAGGG + Intergenic
988890822 5:35615427-35615449 TCTTCCAATTCATGAACATGGGG - Intergenic
990200893 5:53372580-53372602 CCTTCCAATCCATGTGCATGAGG - Intergenic
991394822 5:66193272-66193294 TCTTCCAATCCATGAACATGAGG + Intergenic
991904892 5:71499532-71499554 TCTTCCCTTCCGGGTACAAGTGG - Intronic
992264332 5:75003335-75003357 ACTTCCAAGCTCTGTACATGTGG + Intergenic
995535753 5:113134844-113134866 TCTTCCAATCCATAAGCATGGGG + Intronic
997032248 5:130144528-130144550 TCTTCCAACCTATGAACATGGGG - Intronic
999856801 5:155603819-155603841 TCTTCCAAACCTTGTTAATGTGG + Intergenic
999918754 5:156293949-156293971 TCTTCCAATCCATGAACATGAGG + Intronic
1000617844 5:163449488-163449510 TCTTCCAATCCATGAACATGAGG - Exonic
1002403242 5:179005853-179005875 TCTTCCAATCCATGAACACAGGG - Intergenic
1003434356 6:6072152-6072174 TCTCCCAATCAGGGTACACGGGG + Intergenic
1004096920 6:12565135-12565157 TCTACCCATCCATGAACATGGGG - Intergenic
1004438118 6:15617247-15617269 TCTTCTAATGCATGAACATGGGG - Intronic
1004574306 6:16879242-16879264 TCTTCCTATCCATGAACACGTGG + Intergenic
1004844092 6:19619793-19619815 TCTCTCAATCCTTGAACATGGGG - Intergenic
1005116589 6:22345186-22345208 TCTTCCAGGCAGTTTACATGTGG - Intergenic
1005768078 6:29035080-29035102 TTTCCCAATCCATGAACATGAGG + Intergenic
1006198327 6:32262813-32262835 TCTCCCAGTCAGTATACATGGGG + Intergenic
1008782408 6:55123545-55123567 TTTTCCCATCCATGTTCATGAGG + Intronic
1009526648 6:64755318-64755340 TCTTCCAATCCATGAGCATGAGG - Intronic
1009540090 6:64943731-64943753 TCTTCCAAGCCATGAACACGGGG - Intronic
1010224914 6:73479969-73479991 TTTTCCAAACCGTCTACATCAGG + Exonic
1010491523 6:76482102-76482124 TCTTCCAGTCCATGAACATGGGG - Intergenic
1010817834 6:80379959-80379981 TCTTCTAATCCATGAGCATGGGG - Intergenic
1011744340 6:90395115-90395137 TCTTCCAATCTTTATCCATGTGG + Intergenic
1011937140 6:92794101-92794123 TCTTCCAATCCATGAGCATGGGG + Intergenic
1014315650 6:119861569-119861591 TGTTTCTATCCGTGTCCATGAGG + Intergenic
1014808010 6:125853044-125853066 TCTTCCAGTCCATGAGCATGGGG + Intronic
1015301947 6:131662804-131662826 TCTTCCAGTCCATGAACATGAGG + Intronic
1018369876 6:163157741-163157763 TCTTCCAAGCCGAGTGCTTGTGG - Intronic
1020776868 7:12465114-12465136 TCTTCCAATCCATGAACTTGGGG + Intergenic
1020980713 7:15064758-15064780 TCTTCCTATCCATGAGCATGGGG + Intergenic
1021224503 7:18012358-18012380 TCTCCCAGTCAGTATACATGGGG + Intergenic
1021873268 7:25024955-25024977 TCCTCCAATCCATGAGCATGGGG + Intergenic
1023234866 7:38074454-38074476 TCTTTCTATCCATGAACATGGGG + Intergenic
1023468073 7:40480631-40480653 TCTTCTAATCCATGAACATAGGG + Intronic
1024749112 7:52443363-52443385 TGTTCCTATCCATGTACATGGGG + Intergenic
1024898399 7:54287741-54287763 TCTTCCAATCTATGAGCATGAGG - Intergenic
1026066513 7:67078603-67078625 TCTTCCAACCCATGGAGATGGGG + Intronic
1027610640 7:80356168-80356190 ACTTTCAATCCATGAACATGGGG - Intergenic
1027626808 7:80555169-80555191 TTTTCCAATCCATGAGCATGGGG + Intronic
1027967144 7:85026486-85026508 TCTTCCCATTTGTGTACCTGAGG - Intronic
1028161373 7:87489676-87489698 TCTTCCAATCCATAAACATGGGG - Intergenic
1028293894 7:89103343-89103365 TCTTCCAATCAATGAACATTGGG + Intronic
1028815956 7:95145108-95145130 TCTACCAATCCATGAACACGAGG - Intronic
1028949341 7:96617163-96617185 TATTCCAATCCATGAGCATGGGG + Intronic
1030182839 7:106728325-106728347 TTTTCCAATCCATGAACATGAGG - Intergenic
1030673169 7:112359383-112359405 ACTTCCAATCACTGGACATGGGG + Intergenic
1034712872 7:153210573-153210595 TCTTCCAATCCATGAACATGGGG + Intergenic
1034755182 7:153610536-153610558 TTTTCCAATCCATGAACATAGGG - Intergenic
1035151831 7:156880560-156880582 TCTTCCAATCCATGAACATAGGG - Intronic
1036193083 8:6689071-6689093 TCTTCTAGTACATGTACATGGGG + Intergenic
1039597263 8:38801835-38801857 TCTTCCAATTCATGAACATGGGG + Intronic
1041655245 8:60342942-60342964 TCTTCCTATCCATGAGCATGGGG - Intergenic
1043748800 8:83909345-83909367 TCTCCCAGTCAGTATACATGGGG - Intergenic
1043869587 8:85417258-85417280 TCTCCCAATCCATGAACATGAGG + Intronic
1045075361 8:98560558-98560580 TCTTCAAATTCATGAACATGGGG - Intronic
1046843726 8:118890912-118890934 TCTTCCCATCCATGAACACGGGG - Intergenic
1046985665 8:120385577-120385599 TCTTCCAATTCATGAACATAGGG - Intronic
1048245308 8:132790627-132790649 TCCTCCAATCTCTGAACATGAGG + Intronic
1048996591 8:139798118-139798140 TCTTCCAATCCATGAACACAGGG + Intronic
1050196496 9:3089653-3089675 TCTCCCAATCCATGAACATGAGG + Intergenic
1050792723 9:9494689-9494711 TTTTCCAATCCATTAACATGAGG - Intronic
1050823840 9:9918434-9918456 TCTTCTAATCCATGAGCATGGGG - Intronic
1050852124 9:10300952-10300974 TCTTCCAGTCAGGATACATGGGG - Intronic
1050878354 9:10669590-10669612 TCTTCCTATCTATGAACATGGGG + Intergenic
1052746602 9:32447997-32448019 TCTTCCAGTCAGGATACATGGGG + Intronic
1053033701 9:34806328-34806350 TCTTCCAACCCATGAAAATGGGG + Intergenic
1053522608 9:38796118-38796140 TCTTCCAATCCATGAACACAAGG + Intergenic
1053563460 9:39221412-39221434 TCTTCCAATCCATGAACATGGGG + Intronic
1053829245 9:42059334-42059356 TCTTCCAATCCATGAACATGGGG + Intronic
1054133687 9:61397654-61397676 TCTTCCAATCCATGAACATGGGG - Intergenic
1054194836 9:62020541-62020563 TCTTCCAATCCATGAACACAAGG + Intergenic
1054601314 9:67128113-67128135 TCTTCCAATCCATGAACATGGGG - Intergenic
1054643572 9:67568149-67568171 TCTTCCAATCCATGAACACAAGG - Intergenic
1054964691 9:71009607-71009629 TCATCCAGTCCATGAACATGGGG - Intronic
1057463655 9:95291605-95291627 TCTTCCAATCTGTGAACATGGGG - Intronic
1058252522 9:102718118-102718140 TCTTCCCATCCATGAGCATGGGG - Intergenic
1058393258 9:104520861-104520883 TCTCCCAATCAGGATACATGGGG - Intergenic
1058668435 9:107341018-107341040 TGTTCCACTCCCTGAACATGTGG + Intergenic
1059795448 9:117690705-117690727 TCTTACAATCCATGAACATAAGG - Intergenic
1062739048 9:138156985-138157007 TCTTCCAGTTCGTGAACATGAGG - Intergenic
1203410805 Un_KI270579v1:261-283 TCTTCCTATCCATGAGCATGGGG + Intergenic
1203410226 Un_KI270581v1:1444-1466 TCTTCCTATCCATGAGCATGAGG - Intergenic
1203415762 Un_KI270582v1:5851-5873 TCTTCCTATCCATGAGCATGGGG + Intergenic
1186364933 X:8881715-8881737 TCTTCCAATGTGTGTCTATGGGG - Intergenic
1187770917 X:22695078-22695100 TCTTCCAATCCATTAACATGGGG - Intergenic
1188058299 X:25567434-25567456 TCTTCCTATCCGTGAGCATGAGG + Intergenic
1188119711 X:26289071-26289093 TCTTCTAATCCATGAGCATGGGG + Intergenic
1188728133 X:33610057-33610079 TCCTCTAAACCTTGTACATGAGG - Intergenic
1189019973 X:37325236-37325258 TCTTCCAATCCATGAACATGGGG - Intergenic
1189540816 X:41986434-41986456 TCTTCTAATCCATGAACATGAGG - Intergenic
1189619028 X:42816129-42816151 TCTCCCAATCAGGCTACATGGGG + Intergenic
1189670095 X:43399286-43399308 TCTTCTAATCCATGAACATAGGG - Intergenic
1191042745 X:56102575-56102597 TCTTCCATTTCATGAACATGGGG + Intergenic
1191629611 X:63308304-63308326 TCTTCCAATGCATGAACATAAGG - Intergenic
1192058256 X:67795626-67795648 TCTTCCAATCCATGAGCATGGGG - Intergenic
1192396605 X:70788038-70788060 TCTTTCAATCCATGAACATGGGG - Intronic
1192438391 X:71156609-71156631 TATACACATCCGTGTACATGGGG + Intronic
1192725303 X:73744664-73744686 TCTTCCAATTCATGAACATGGGG + Intergenic
1192957540 X:76089101-76089123 TCTTCCAATTCATGAACATTGGG + Intergenic
1192977232 X:76299563-76299585 TCTTCCAGTCAATATACATGGGG + Intergenic
1193562986 X:83042638-83042660 TCTTCCAATCCATAAACATGGGG - Intergenic
1194284694 X:91995800-91995822 TCTTCCAATCTAAGCACATGGGG + Intronic
1194584071 X:95711940-95711962 TCTTCCAATTCATGAACATGTGG + Intergenic
1195339005 X:103886528-103886550 TCTTCCTATCCATGAGCATGGGG + Intergenic
1195484238 X:105384725-105384747 TCCTCTAATCCATGAACATGGGG + Intronic
1199227173 X:145391078-145391100 TTTTCAAATTCGTGTGCATGGGG + Intergenic
1199229532 X:145420084-145420106 TCTTCCAACCTATGAACATGGGG + Intergenic
1199337354 X:146634461-146634483 TCTTCCAATCCATGAGCATGAGG - Intergenic
1199830353 X:151543679-151543701 TCTTCCAATCCATGAACATGGGG + Intergenic
1200390226 X:155936987-155937009 TCTTCCAATCCATAAACATAAGG - Intronic
1200602259 Y:5220364-5220386 TCTTCCAATCTAAGCACATGGGG + Intronic
1202276282 Y:23123726-23123748 TCTTCCAACCTGTGAACATGGGG - Intergenic
1202289746 Y:23296964-23296986 TCTTCCAACCTGTGAACATGGGG + Intergenic
1202429275 Y:24757451-24757473 TCTTCCAACCTGTGAACATGGGG - Intergenic
1202441516 Y:24912639-24912661 TCTTCCAACCTGTGAACATGGGG + Intergenic