ID: 926258906

View in Genome Browser
Species Human (GRCh38)
Location 2:11238330-11238352
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21052
Summary {0: 1, 1: 15, 2: 500, 3: 8201, 4: 12335}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926258904_926258906 -1 Left 926258904 2:11238308-11238330 CCACCTCATGTACACGGATTGGA 0: 1
1: 0
2: 0
3: 5
4: 53
Right 926258906 2:11238330-11238352 AAGAATCAATACTATCAAAATGG 0: 1
1: 15
2: 500
3: 8201
4: 12335
926258905_926258906 -4 Left 926258905 2:11238311-11238333 CCTCATGTACACGGATTGGAAGA 0: 1
1: 2
2: 18
3: 67
4: 226
Right 926258906 2:11238330-11238352 AAGAATCAATACTATCAAAATGG 0: 1
1: 15
2: 500
3: 8201
4: 12335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
Too many off-targets to display for this crispr