ID: 926259894

View in Genome Browser
Species Human (GRCh38)
Location 2:11249670-11249692
Sequence TGGCCTTTGCCAATAGCCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926259894_926259896 4 Left 926259894 2:11249670-11249692 CCAGGGGCTATTGGCAAAGGCCA 0: 1
1: 0
2: 2
3: 16
4: 203
Right 926259896 2:11249697-11249719 ATCTCTTTCTTCCCAAAAAAAGG 0: 1
1: 0
2: 1
3: 39
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926259894 Original CRISPR TGGCCTTTGCCAATAGCCCC TGG (reversed) Exonic
900131710 1:1090004-1090026 TGGGCTTTGCCAGAGGCCCCTGG + Intronic
900335369 1:2160552-2160574 TGGACTTGGCCAAGAGGCCCTGG + Intronic
900782421 1:4626743-4626765 TCGCCTTTGCCAGCGGCCCCAGG + Intergenic
903570210 1:24298574-24298596 TGGCCTGTGCCTGTAGTCCCAGG + Intergenic
906293537 1:44635357-44635379 TGGGCTTTGCCAAGAGCACCTGG - Intronic
906961892 1:50423831-50423853 TCGGCTTTGCCAAGCGCCCCAGG - Intergenic
908779918 1:67681007-67681029 TGGCATGTGCCTATAGTCCCAGG + Intergenic
910048193 1:82943236-82943258 TGGCACTTGCCAGTAGTCCCAGG + Intergenic
911755156 1:101545681-101545703 TGGCCTTTGCCCTCAGCTCCTGG + Intergenic
911825904 1:102484871-102484893 TGGCCTTTGCCATCAGCTTCTGG - Intergenic
912759939 1:112357846-112357868 TGCCATTTGCCAAGAGCCTCAGG - Intergenic
913328592 1:117649271-117649293 AGGCTTTTGCCCATCGCCCCAGG - Intergenic
915431663 1:155871611-155871633 TGGCTCTTGCCAAGAGCCCCTGG - Intronic
917722280 1:177797117-177797139 TGGCCTTAGCCAAGATCACCCGG - Intergenic
918334365 1:183493712-183493734 TGGCGTGTGCCTATAGTCCCAGG - Intronic
922189015 1:223300704-223300726 TGCCCTTTTTCACTAGCCCCAGG - Intronic
922498298 1:226077946-226077968 TGGCATGTGCCTATAGTCCCAGG - Intergenic
923888095 1:238180467-238180489 TTTCATTAGCCAATAGCCCCAGG + Intergenic
924485497 1:244479441-244479463 TGGGCATTGCCAAAAGTCCCTGG + Intronic
1063132353 10:3189124-3189146 TGGCCTTTGCCCTCAGCTCCTGG - Intergenic
1063971104 10:11381730-11381752 TGGCCCTTGCCATTGGCTCCTGG - Intergenic
1064788036 10:18920459-18920481 TGGCGTTTGCCTATAGTCCCAGG - Intergenic
1065127514 10:22587837-22587859 TGGCCTTTGCTAATTGCTGCGGG + Intronic
1066495619 10:35939120-35939142 GTGCCTTAGCCAACAGCCCCAGG + Intergenic
1066646701 10:37617822-37617844 GTGCCTTAGCCAACAGCCCCAGG - Intergenic
1069951828 10:72024377-72024399 TGGCCTCTGCCCATATCCTCTGG + Intergenic
1071024260 10:81093304-81093326 TGGCCTTTGCCAAGTGCGTCTGG + Intergenic
1072341862 10:94459759-94459781 TGGCCGGTGCCACTGGCCCCGGG - Intronic
1078239194 11:9514787-9514809 TGGCCTTTACCAACTTCCCCAGG - Intronic
1081398357 11:42613822-42613844 TGGCCTTTGCCCTAAGCCACTGG - Intergenic
1081683750 11:45027063-45027085 TGGCCTTTGTGATGAGCCCCAGG + Intergenic
1083236021 11:61351084-61351106 CGGTCTTTGCCAACAGCACCGGG - Exonic
1083261772 11:61526983-61527005 AACCCTTTGCCAATGGCCCCCGG - Intronic
1083589504 11:63885068-63885090 TGGCCCATGCCTGTAGCCCCAGG + Intronic
1083990428 11:66243093-66243115 TGGCCTTTCCCAAGGGGCCCTGG + Intronic
1084322503 11:68381488-68381510 TGGCCCTTGCCCCAAGCCCCTGG + Intronic
1089337207 11:117733515-117733537 TGGCTTTGGGCAATAGCCACAGG - Intronic
1090333780 11:125949839-125949861 TGGACTGTGCCCATGGCCCCTGG + Intergenic
1091774267 12:3174198-3174220 TGGCATGTGCCTGTAGCCCCAGG - Intronic
1096340832 12:50797599-50797621 TGGCATATGCCTATAGTCCCAGG - Intronic
1097701001 12:62820090-62820112 TGGCCTTAGCAAATGGCACCTGG + Intronic
1101659765 12:106755227-106755249 TGGCATGTGCCTATAGTCCCAGG - Intronic
1102238100 12:111307305-111307327 TGAACTTTGCCAAGAGCTCCTGG - Intronic
1104627763 12:130373700-130373722 TAGCATTTGCCAAAAGTCCCTGG - Intergenic
1104638843 12:130454512-130454534 TGGCCCATGCCCATATCCCCTGG - Intronic
1106158357 13:27178230-27178252 TGGCCTTTCCCAATTCCCTCTGG + Intergenic
1107956640 13:45520154-45520176 TGGCGTGTGCCTATAGTCCCAGG + Intronic
1108531629 13:51332094-51332116 TGCCCTGTGCCTACAGCCCCTGG + Intergenic
1111405304 13:87796448-87796470 TGGCATCTGCCAATAGTCCTTGG + Intergenic
1111496556 13:89058096-89058118 TGGACTCTGCCAAAAGCTCCTGG - Intergenic
1111588685 13:90315165-90315187 TGGCCTTTGCCCTCAGCTCCTGG + Intergenic
1112367392 13:98767009-98767031 TAGCCTATACCGATAGCCCCTGG - Intergenic
1112541941 13:100322701-100322723 TGGCATGTGCCTATAGTCCCAGG - Intronic
1112719341 13:102225222-102225244 TGGCCTTTCCCCTTAGCCCATGG + Intronic
1112859059 13:103808122-103808144 TGGCATGTGCCCATAACCCCAGG - Intergenic
1113073736 13:106448050-106448072 CGACCTTTTCTAATAGCCCCTGG - Intergenic
1113318728 13:109211776-109211798 TTGCCTTTCCCTGTAGCCCCAGG + Intergenic
1115867010 14:37759128-37759150 TGGCATATGCCTATAGTCCCAGG + Intronic
1117937844 14:60927054-60927076 TGGTCTTTGCCCACAGTCCCTGG - Intronic
1118469064 14:66057638-66057660 TGGCCTTTACCAAGTGCTCCTGG - Intergenic
1119251201 14:73156221-73156243 TGGCATGTGCCTATAGTCCCAGG + Intronic
1121260166 14:92560039-92560061 TGGCCTTTGCCTCTTGCCACAGG - Intronic
1123474167 15:20577052-20577074 TGGCTTATGCCTATAACCCCAGG - Intergenic
1123643844 15:22423301-22423323 TGGCTTATGCCTATAACCCCAGG + Intergenic
1123734468 15:23172064-23172086 TGGCTTATGCCTATAACCCCAGG - Intergenic
1124284974 15:28393372-28393394 TGGCTTATGCCTATAACCCCAGG - Intergenic
1124297723 15:28518242-28518264 TGGCTTATGCCTATAACCCCAGG + Intergenic
1124558416 15:30748461-30748483 TGGCCTTGGCCAATTGCCTGAGG - Intronic
1124672836 15:31657170-31657192 TGGCCTTGGCCAATTGCCTGAGG + Intronic
1125623358 15:41084424-41084446 TGGCATCTGCCTGTAGCCCCAGG + Intronic
1126734698 15:51719072-51719094 TGCCACTTCCCAATAGCCCCAGG + Intronic
1128148146 15:65344205-65344227 TGGCATTTACAAATAGCCTCAGG + Intronic
1129242015 15:74257471-74257493 TGGCCTTAGCCAAGCTCCCCTGG - Intronic
1129361958 15:75029816-75029838 TTCCCTTTTCCCATAGCCCCAGG + Intronic
1129442516 15:75592104-75592126 TGGCCTTTGCCCTTCGCTCCTGG + Intergenic
1130394973 15:83493877-83493899 TGGCCTTGGCCAAACACCCCAGG + Intronic
1131740648 15:95387093-95387115 TAGCCTTTGCCACTTGCTCCTGG - Intergenic
1131985157 15:98035602-98035624 TGTCCTTTAGCAATAGCCCAGGG - Intergenic
1135548386 16:23380545-23380567 TGGCCTTGGCCAAGAGCCTACGG + Exonic
1138180366 16:54936990-54937012 TGGCGTTTGCCACCTGCCCCTGG + Intergenic
1140917848 16:79509621-79509643 AGGCCTTGGCCAATATCCCCAGG - Intergenic
1142680791 17:1547231-1547253 TGGCATATGCCTATAGTCCCAGG + Intronic
1142962114 17:3557564-3557586 TGCCCTTGGCCAATAGGCCTTGG - Intronic
1143668963 17:8383434-8383456 CAGCCTTAGCCAATAGCCCCGGG - Intergenic
1143736651 17:8916113-8916135 TTGCCTGAGCCACTAGCCCCTGG + Intronic
1143913793 17:10274194-10274216 TGGCCTTTCCCAGTTCCCCCAGG + Intergenic
1145258778 17:21342514-21342536 TGGCCTGTGCCCAGAGCCCAAGG - Intergenic
1145317846 17:21745490-21745512 TGGCCTGTGCCCAGAGCCCAAGG + Intergenic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1152495301 17:80667047-80667069 TGGATTTTCCCAATAACCCCGGG + Intronic
1154935321 18:21049101-21049123 TGGCTTTTGCCAACAGTCCTTGG - Exonic
1154996143 18:21642019-21642041 TGGCCTGTGCCGGTAGTCCCAGG + Intergenic
1156375655 18:36512952-36512974 TGCACTTTGACAAAAGCCCCAGG - Intronic
1157220657 18:45826547-45826569 TTGCCTTTGCCATTAATCCCAGG - Intronic
1157293004 18:46423282-46423304 TTGCCTTGGCCAATAGCCCCAGG - Intronic
1158437153 18:57441645-57441667 TGGCCGTTGCCACTGGGCCCTGG + Intronic
1160094525 18:75859699-75859721 TGATCTCTGCCACTAGCCCCTGG + Intergenic
1161043388 19:2121850-2121872 TGGACATTGCCAGCAGCCCCAGG + Exonic
1161671732 19:5615768-5615790 TGGCCTGTGCCAATAAGCCCAGG + Intronic
1162294671 19:9805060-9805082 TGGCATGTGCCTATAGTCCCAGG + Intergenic
1162695811 19:12473911-12473933 TGGCATTTGCCTGTAGTCCCAGG + Intronic
1162964826 19:14150836-14150858 TGGCCTGGGCCACCAGCCCCTGG + Exonic
1165493341 19:36138272-36138294 TGGCTCATGCCAATAACCCCAGG - Intergenic
1165655447 19:37528533-37528555 TGGCCTTTGCCCTCAGCTCCTGG - Intronic
1168288487 19:55346026-55346048 TGTCCTTTGCCTGTAGCCCCTGG - Intronic
1168501026 19:56893438-56893460 TCTCCTTTACCCATAGCCCCTGG - Intergenic
1168705532 19:58468326-58468348 AGGCTCTTCCCAATAGCCCCAGG - Intronic
926259894 2:11249670-11249692 TGGCCTTTGCCAATAGCCCCTGG - Exonic
927098200 2:19764126-19764148 TGGCATATGCCAATAGCCTAAGG - Intergenic
931231834 2:60381637-60381659 TGGCCTTTGCCCTTGGCTCCTGG - Intergenic
932571908 2:72942638-72942660 TGGGCTATGCCACTAGGCCCTGG - Exonic
933857633 2:86431651-86431673 TGGCATGTGCCTGTAGCCCCAGG + Intergenic
935464475 2:103380335-103380357 TGGCCTTTGCCCCTGGGCCCTGG + Intergenic
936032389 2:109082680-109082702 TGGCCTATGCCTATGGTCCCAGG + Intergenic
936607596 2:113973682-113973704 AGGCCTTTTCCAACAGCTCCAGG + Intergenic
937589733 2:123598481-123598503 TGGCCTATGCCACTAGCCATAGG + Intergenic
938868511 2:135449888-135449910 TTGTCTTTGCCTATAGTCCCAGG - Intronic
941372450 2:164682546-164682568 TGGCCTTGGCCACTAGGCACTGG - Intronic
941719235 2:168795924-168795946 CGGCCTTTGCCCACAGCCTCAGG - Intronic
942870263 2:180726144-180726166 TGGCCTTTGCAGTTGGCCCCTGG + Intergenic
945027831 2:205636187-205636209 TGGCTTTTGCCATTACCTCCAGG - Intergenic
1168878407 20:1186033-1186055 TGGCCATTGGCAATGCCCCCAGG - Intronic
1169845632 20:9988319-9988341 TGGTCTTGGCCATTTGCCCCAGG + Intronic
1172728661 20:37068357-37068379 TGGCATGTGCCTGTAGCCCCAGG + Intronic
1172952350 20:38730207-38730229 TGACCTTTCCCAACAGTCCCTGG - Intergenic
1174361139 20:50029624-50029646 TGGCTTTTGCCTTGAGCCCCTGG + Intergenic
1176289341 21:5035840-5035862 GGGCATTTGCCCATAGCCCCGGG - Intronic
1178370879 21:32026769-32026791 TGGCCTTTGCCAATGGCTCCTGG + Intronic
1179867888 21:44227747-44227769 GGGCATTTGCCCATAGCCCCGGG + Intronic
1181171063 22:21010431-21010453 TGGCCTTTGAGAATTGGCCCTGG - Intronic
1182915721 22:34028140-34028162 TGGCATGTGCCTATAGTCCCAGG - Intergenic
1182944054 22:34305604-34305626 TGGCCTCTGCCTGTACCCCCTGG + Intergenic
949645819 3:6092755-6092777 TGATCTTTCCCATTAGCCCCTGG + Intergenic
949990063 3:9571348-9571370 TGGCATATGCCTATAGTCCCAGG - Intergenic
952456293 3:33475038-33475060 TGGCCTATGCCTGTAGTCCCAGG + Intergenic
952543664 3:34395750-34395772 TTGCCATTGCCACTGGCCCCAGG - Intergenic
952860794 3:37810795-37810817 TGGCCTGTGCCACCAGCCCCTGG + Intronic
952929507 3:38348109-38348131 TGGCCTGTGAGAATAGCCCATGG + Intronic
952964635 3:38613587-38613609 TGTCCACTGCCAATAGCCCCTGG + Intronic
953231782 3:41071803-41071825 TGGACTTTGCCATGAGCGCCTGG - Intergenic
954200758 3:49021902-49021924 GGGCCCTTGCCCATAGTCCCGGG - Exonic
955270601 3:57494427-57494449 TGGCCTGTGCCTGTAGTCCCAGG + Intronic
955980063 3:64515850-64515872 AAGCCTTTGCCAATGGCCCATGG - Exonic
960377304 3:116918868-116918890 TGGCCTATGCCTATAATCCCAGG - Intronic
960583602 3:119301169-119301191 AGACCTCTGCCAAGAGCCCCTGG + Intronic
961367362 3:126408594-126408616 TGCCCTTGGACATTAGCCCCAGG + Intronic
963160356 3:142144672-142144694 TGGCATGTGCCTATAGTCCCAGG - Intronic
963631438 3:147735780-147735802 TGGCCTTTGTTTATAGTCCCAGG - Intergenic
964979451 3:162661362-162661384 TGGCCTTTGCCCTCAGCTCCTGG + Intergenic
969525730 4:7703160-7703182 TGGCCTCTGCCAACAACCCCCGG + Intronic
970201475 4:13612648-13612670 TGGCCTTTACCATTAGCTTCTGG + Intronic
970608974 4:17708305-17708327 TGTCCCTTGCCCATAGCCCTGGG + Intronic
971299409 4:25429376-25429398 TGGCACGTGCCAATAGTCCCAGG + Intergenic
972432084 4:38992892-38992914 TGGCATTTGCCTGTAGTCCCAGG - Intronic
973573355 4:52262249-52262271 TGGATTCTGCCAATAGCCTCTGG - Intergenic
978130411 4:105189280-105189302 TGGCATTTACCAAGAACCCCGGG + Intronic
979558074 4:122073668-122073690 TGGCCTTTGCCAAACCCCCATGG + Intergenic
979558134 4:122074063-122074085 TGGCCTTTGCCAAACCCCCATGG - Intergenic
980148603 4:129020340-129020362 TAGCCTTTGCCCAGAGCCCATGG + Intronic
981138444 4:141239071-141239093 TGGACATAGCCAACAGCCCCAGG + Intergenic
982644389 4:158005095-158005117 TGGCCTTTGGCACTGGCCCATGG + Intergenic
983019738 4:162660553-162660575 TGGCATTTGCCTGTAGTCCCAGG - Intergenic
985174791 4:187189324-187189346 TGGCATGTGCCTATAGTCCCAGG - Intergenic
985757834 5:1729828-1729850 TGGCCTTTGCCGATGGACCTCGG + Intergenic
990512959 5:56505612-56505634 TGGCATGTGCCTATAGTCCCAGG + Intergenic
993907317 5:93637798-93637820 TGGCCTTTGCCCTCAGCACCTGG + Intronic
995722429 5:115150947-115150969 TGGCCTTTTCCCAGAGCCTCTGG - Intronic
996805814 5:127452784-127452806 TGGCCTTTGCCCTCAGCTCCTGG - Intronic
997372008 5:133368053-133368075 TGGCCTTTGCCCCCTGCCCCTGG + Intronic
1000672413 5:164078812-164078834 TGGCCTTTGCCCTTGGCTCCTGG + Intergenic
1002041761 5:176519992-176520014 TGGACTTTGGCACTTGCCCCTGG + Intergenic
1005219971 6:23575294-23575316 TAGTCTTTGCCTATAGCCCTGGG - Intergenic
1012644923 6:101666596-101666618 CGGCCTTTGCCATTAGCTCCTGG - Intronic
1013286560 6:108687055-108687077 TGGCCTTTGGGAAGGGCCCCAGG + Intergenic
1013944292 6:115703980-115704002 AGGCCTGTACCAATAGACCCTGG - Intergenic
1014088391 6:117373546-117373568 TGGCCAGTGCCACCAGCCCCGGG - Intronic
1016696596 6:147003371-147003393 GGGACTTTGCCAAGAGCCCAAGG - Intergenic
1017017680 6:150115107-150115129 TGTCCATTGCCAATGGCCTCAGG + Intergenic
1017994818 6:159522594-159522616 TGGCATATGCCTATAGTCCCAGG + Intergenic
1018570643 6:165206001-165206023 TGGCTCCTGCCAATAGCCCCGGG + Intergenic
1021984051 7:26081914-26081936 TGGCCCTGACCAAGAGCCCCAGG - Intergenic
1023653956 7:42401194-42401216 AGGCCTTTGCCAACAGCTCCTGG - Intergenic
1024251847 7:47511699-47511721 AGGCCTTCGCCAGAAGCCCCTGG - Intronic
1025047920 7:55708209-55708231 TGGGCTTTGCCAAAGGCCACTGG - Intergenic
1027165896 7:75834133-75834155 TGGCATGTGCCTATAGTCCCAGG + Intergenic
1030451458 7:109717926-109717948 TGGCATATGCCTATAGTCCCAGG + Intergenic
1033191059 7:139280071-139280093 TTGCTTTTGCCAGTGGCCCCGGG - Intronic
1033430331 7:141283278-141283300 TTGCCTTTGCCTCTGGCCCCAGG + Intronic
1034670244 7:152852279-152852301 AGGCCTGGGGCAATAGCCCCAGG - Intronic
1034933964 7:155186415-155186437 TGGCCTTTGCCCTCAGCCACTGG - Intergenic
1036095607 8:5721829-5721851 TGGCATGTGCCTATAGTCCCAGG + Intergenic
1036463824 8:8977997-8978019 TGGCCTTTGCCCTCAGCTCCTGG + Intergenic
1040072928 8:43202917-43202939 TGGCGTGTGCCTATAGGCCCAGG + Intergenic
1042888640 8:73581648-73581670 TGGCCTTAGCACATAGCCCAAGG - Intronic
1043640433 8:82443298-82443320 TGGCGTGTGCCTGTAGCCCCAGG + Intergenic
1047100502 8:121670286-121670308 TGGCATGTGCCTGTAGCCCCAGG + Intergenic
1050482707 9:6102884-6102906 GAGCCTGTGCCAATAGCCTCAGG + Intergenic
1050701154 9:8340423-8340445 TGGTCTCTGCCAAGGGCCCCTGG + Exonic
1051624822 9:19089108-19089130 TGGCCTGCGCCAATAATCCCAGG + Intronic
1051878216 9:21812799-21812821 TGCCCTCTCCCAATATCCCCTGG - Intronic
1052481096 9:29027468-29027490 TGGCGTGTGCCTGTAGCCCCAGG - Intergenic
1053501693 9:38601848-38601870 TGGTCTGTGCCTATAGTCCCAGG + Intergenic
1053534309 9:38910859-38910881 TGGCCTTTGTCCCTGGCCCCTGG - Intergenic
1054206532 9:62135278-62135300 TGGCCTTTGTCCCTGGCCCCTGG - Intergenic
1054631825 9:67453068-67453090 TGGCCTTTGTCCCTGGCCCCTGG + Intergenic
1056804547 9:89718448-89718470 TGGCCTCAGCCAAGTGCCCCAGG - Intergenic
1057511794 9:95686454-95686476 TGGCATGTGCCTATAGTCCCAGG + Intergenic
1058309495 9:103483812-103483834 TGGCCAGTGCCACCAGCCCCGGG + Intergenic
1061142285 9:128774783-128774805 TGGCATTTGCCTGTAGTCCCAGG + Intergenic
1061742174 9:132715316-132715338 TGGCATGTGCCTATAACCCCAGG + Intergenic
1062322228 9:135995928-135995950 TGGCCTTTGCAGGAAGCCCCAGG + Intergenic
1062353673 9:136151973-136151995 GGGCCTTTCCCAATATCCCAGGG - Intergenic
1062387135 9:136317124-136317146 TGGGCCTTGCCATGAGCCCCTGG - Intergenic
1187563393 X:20423778-20423800 TGGCCTGTGCCTATAGTCCCAGG + Intergenic
1189913223 X:45831854-45831876 TGGCCAGTGCCGAAAGCCCCAGG - Intergenic
1193497542 X:82232997-82233019 GGGCCTAAGCCAAAAGCCCCTGG + Intergenic
1195849747 X:109270341-109270363 TGGCCCTTGGCAGTAGCCCAGGG - Intergenic
1196090701 X:111738668-111738690 TGGCGTGTGCCTATAGTCCCAGG - Intronic
1196419463 X:115507457-115507479 GGGACTTAGCCAATAGCCCTGGG + Intergenic
1197419086 X:126215552-126215574 TGTCTTTTGCCAATAGCCGGAGG + Intergenic
1197767640 X:130069503-130069525 TGGCCTCTGCCAGTACCACCCGG - Exonic
1198306852 X:135391925-135391947 TGGCCTTTGCCAACACACCATGG - Intergenic