ID: 926261762

View in Genome Browser
Species Human (GRCh38)
Location 2:11270492-11270514
Sequence CACCTTTTCTAGTGGTTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926261759_926261762 -5 Left 926261759 2:11270474-11270496 CCCATTACACATATTTTACACCT 0: 1
1: 6
2: 30
3: 111
4: 479
Right 926261762 2:11270492-11270514 CACCTTTTCTAGTGGTTCCATGG 0: 1
1: 0
2: 0
3: 12
4: 136
926261760_926261762 -6 Left 926261760 2:11270475-11270497 CCATTACACATATTTTACACCTT 0: 1
1: 4
2: 20
3: 76
4: 463
Right 926261762 2:11270492-11270514 CACCTTTTCTAGTGGTTCCATGG 0: 1
1: 0
2: 0
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926261762 Original CRISPR CACCTTTTCTAGTGGTTCCA TGG Intronic
900940354 1:5794707-5794729 CTCTTTTTCAAGTGGTTACAGGG + Intergenic
904577207 1:31512674-31512696 CACCTCTGCTGGTGGTTCCCAGG + Intergenic
906577405 1:46903241-46903263 CACCTTTGTTATTTGTTCCATGG - Intergenic
908435175 1:64098631-64098653 CCCTGTTTATAGTGGTTCCAGGG + Intronic
909211115 1:72825322-72825344 CTCTCTTTCTAGTGGCTCCAGGG - Intergenic
911797969 1:102097958-102097980 CCCCTTTTCTACTTGTTCCTTGG + Intergenic
914441763 1:147713732-147713754 CAACTTTTGAAGTGGTTCAAAGG - Intergenic
918086365 1:181248600-181248622 CACCTTTGTTACTTGTTCCATGG - Intergenic
919551879 1:199000797-199000819 CACCTTTTTTTGTGGATCAAAGG + Intergenic
922028193 1:221772929-221772951 CACCTGTTCTATCTGTTCCATGG + Intergenic
1066789248 10:39044788-39044810 CACCTTTGTTACTTGTTCCATGG - Intergenic
1069189733 10:65471249-65471271 CACCTTGAATAGGGGTTCCATGG - Intergenic
1069863897 10:71488426-71488448 AACCTTTTCTAGTGCTGCCCTGG + Intronic
1070288864 10:75102033-75102055 CAACTTGTCCACTGGTTCCATGG + Intronic
1073354411 10:102842524-102842546 CACCTTTGTTACTTGTTCCACGG + Intergenic
1074456822 10:113602769-113602791 TACTTATTCTAGTGTTTCCATGG + Intronic
1075323685 10:121512691-121512713 CACATTCACCAGTGGTTCCAAGG - Intronic
1076560821 10:131362203-131362225 CACCTGTTGTGGAGGTTCCACGG + Intergenic
1078637640 11:13066612-13066634 AAGCTTTTCAAGAGGTTCCACGG - Intergenic
1079599484 11:22293590-22293612 CAGTTTTTCTAGTGGTTCTTGGG - Intergenic
1082299915 11:50493077-50493099 CACCTTTGTTACTTGTTCCATGG + Intergenic
1085250480 11:75140452-75140474 CACCGTTCCCAGTGTTTCCAGGG - Intronic
1085667317 11:78426272-78426294 CAACTTTTCCATGGGTTCCACGG - Intergenic
1087681040 11:101218764-101218786 CACCTTTGTTACTTGTTCCATGG + Intergenic
1091593196 12:1857587-1857609 CACCTCTTCCAGGGGTTCCTGGG + Intronic
1093436275 12:19138649-19138671 CACCTCTTCAAGTCGTTCCAGGG - Intronic
1097462247 12:59876330-59876352 TACCTGTTCTAGTAGTTTCAGGG - Intergenic
1097734805 12:63170161-63170183 CCTCTCTCCTAGTGGTTCCAGGG + Intergenic
1098444914 12:70556518-70556540 CACCTTTTGTGGTTGTTCCATGG - Intronic
1100306479 12:93354506-93354528 TACCTCTTCTAGTAGTTTCAAGG + Intergenic
1100730681 12:97464576-97464598 CACCTTTTGTAATGGGTGCAGGG + Intergenic
1101350306 12:103924226-103924248 CAGCTTCTCTAGTGGTTCTGCGG - Intergenic
1101604679 12:106239315-106239337 CACCTTCTGGAGTGATTCCACGG + Exonic
1102347751 12:112170337-112170359 CACAATTTCCAGTGGGTCCAAGG + Exonic
1102605942 12:114067251-114067273 CACCTTTTCAAGTTGATTCAGGG + Intergenic
1104876227 12:132036654-132036676 CACTTTTTTTAGTGGTTCTCAGG + Intronic
1105727782 13:23182841-23182863 CTCCTTTTCTAGAGGTTCAAAGG - Intronic
1107744704 13:43491955-43491977 GACCATTTCTACTGGATCCAAGG - Intronic
1109385129 13:61619083-61619105 CACCTTTGCTAGCGTTACCATGG - Intergenic
1110598953 13:77349875-77349897 CACCTTTTCTGGTCTTTTCAAGG + Intergenic
1113667410 13:112150490-112150512 AACGTTTGCAAGTGGTTCCAAGG - Intergenic
1114205284 14:20565117-20565139 CAGCTTTTCTAGTTGTTCTTTGG - Intergenic
1116469570 14:45271345-45271367 CACCTTTTTTAGTGGCTTCAAGG + Intergenic
1117329112 14:54695088-54695110 TGCCTTTTCTAGTGAATCCAAGG + Intronic
1117916957 14:60687872-60687894 CACATTTTCTAGTTTTGCCAAGG - Intergenic
1117987971 14:61407341-61407363 CATCTTATCTAATGGTTCCTTGG + Intronic
1122146826 14:99695357-99695379 TACTTGTTCTAGTGGTTGCAGGG + Intronic
1122994219 14:105253826-105253848 CACAGTTTCTGGGGGTTCCAGGG + Intronic
1126328279 15:47505187-47505209 CACCTCTTCTAGTTGGTCCCAGG + Intronic
1128060563 15:64732944-64732966 CACATATTCAAGTGGTTGCAGGG + Intergenic
1128590632 15:68893645-68893667 CACCCTTTGTAGTTGTCCCACGG + Intronic
1133169875 16:3975946-3975968 CACATTTGCTACTGGTTTCAGGG - Intronic
1136372054 16:29842674-29842696 CTCCTTTTCTTGGGGTTCCTAGG - Intronic
1137760093 16:50933701-50933723 AGCCTTTCCTAGTGTTTCCAGGG + Intergenic
1139425868 16:66879783-66879805 CACCTTTTCTCGTGGTTGGTGGG - Intronic
1139992836 16:70953658-70953680 CACCTACCCTAGTGGTTTCATGG + Intronic
1140328508 16:74029549-74029571 CACTTTTTATAGCGGTTGCATGG + Intergenic
1142422077 16:89977703-89977725 CTCCTGTTCCAGTGCTTCCAGGG + Intergenic
1143749388 17:9017346-9017368 GACCTTGACTAGTGGTTGCAGGG - Intergenic
1147626984 17:41906727-41906749 CACCTTTTCATGTGCTTCCAGGG - Intronic
1148381976 17:47206513-47206535 ATCATTTTCTAATGGTTCCATGG - Intronic
1149661889 17:58338363-58338385 CACCTCTTCGAGGGGTCCCAGGG + Intergenic
1153751648 18:8238237-8238259 CACCTTTTGTAGTTGCCCCATGG + Intronic
1155822493 18:30396387-30396409 GAACTTTTCTAGTATTTCCAAGG + Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1156849905 18:41714094-41714116 AAACTTATCTGGTGGTTCCAAGG + Intergenic
1157746265 18:50138779-50138801 CCCATTTCCTGGTGGTTCCAAGG + Intronic
1166406273 19:42524307-42524329 CACATCCTCTAGTGGTTCCTGGG - Intronic
926261762 2:11270492-11270514 CACCTTTTCTAGTGGTTCCATGG + Intronic
927365342 2:22288986-22289008 CACTTTTTCTAGTGGGCTCAAGG - Intergenic
930639606 2:53840963-53840985 CAACTTTTCTTGAGGTTCCCTGG - Intergenic
933629838 2:84643512-84643534 CTCCTTTTGTAGTTGTACCATGG + Intronic
938060443 2:128250556-128250578 GACCTCTTCTAGTGACTCCAGGG - Intronic
938840991 2:135163331-135163353 CTCCTTTTCTAGGGATTCCTTGG + Intronic
940793529 2:158053061-158053083 CAGCTTATCTACCGGTTCCAGGG - Intronic
940998511 2:160176391-160176413 CACCTAGTCTACTGGGTCCAGGG + Intronic
944805492 2:203277038-203277060 CACTTTTTCATGTGGTTCCCAGG - Intronic
945677434 2:212872502-212872524 CAGCTTATTTAGTGTTTCCAAGG + Intergenic
946425397 2:219592621-219592643 CCCCTTCTCAAATGGTTCCATGG + Intergenic
946978463 2:225179628-225179650 CAGTTTTTCTAGTGGTTTTATGG + Intergenic
947149644 2:227101983-227102005 CACCTTATCAAATTGTTCCATGG + Intronic
1174361579 20:50032107-50032129 CACCTTTTCTAGGCATTTCAGGG + Intergenic
1174362061 20:50035091-50035113 CACCTTTTCTAGGCCTTTCAGGG + Intergenic
1174575409 20:51533574-51533596 GACTTTTTCCAGTGGTTCCATGG - Intronic
952213432 3:31252258-31252280 CACCTGTGCCAGTGCTTCCAGGG - Intergenic
952802673 3:37311075-37311097 CACCATTTCTAGGGGTTACAAGG + Intronic
952963310 3:38606215-38606237 CACCTAGTCTAGTTGTGCCAGGG + Intronic
954247545 3:49343470-49343492 CCCCTTTTCTAGTGGTGCTGAGG - Intergenic
954878759 3:53820131-53820153 CACCTTTTCTCCTGGCTCCTTGG + Intronic
958820242 3:98965253-98965275 CACATTTTCTAATAGTTCCCTGG + Intergenic
961937859 3:130604516-130604538 CACCTTTGTTAATGGTTACATGG - Intronic
968208337 3:196824690-196824712 CACCGTGCCTAGTTGTTCCATGG - Intronic
974998602 4:69193860-69193882 CACCTTTGTTACTTGTTCCATGG - Intronic
976479951 4:85530414-85530436 CACCTCTTCCACTGGTTCAAAGG + Intronic
980870306 4:138603621-138603643 AACCTTGTCTAGTTGTGCCATGG + Intergenic
984104006 4:175521678-175521700 CATGTTTTCTCTTGGTTCCATGG - Intergenic
984619638 4:181937660-181937682 CAGCTTTTGTAGTAGTGCCAGGG - Intergenic
985750623 5:1672111-1672133 CAACTTTTCTTTTGGTTACAGGG + Intergenic
985765674 5:1778204-1778226 CACCTTTGCCAGTGTTCCCAGGG - Intergenic
986084315 5:4428448-4428470 CACCATTTCCAGTGTTGCCATGG - Intergenic
986171279 5:5316806-5316828 CACCCTTTCTGGTGGTCCGACGG - Intronic
987597351 5:20019163-20019185 CTCCTTTTGTAGTGATTTCATGG - Intronic
989353170 5:40511340-40511362 CACCTTTCCCAGTGGTCCCCAGG + Intergenic
990935855 5:61148342-61148364 CCAGTTTTCTAGTGGTGCCATGG + Intronic
992845551 5:80743384-80743406 CACCTTTTCTAGTTGATTCCTGG + Intronic
995416648 5:111920700-111920722 CACCCTTTCTAGTGCTTATATGG + Intronic
996345803 5:122487109-122487131 AACCTTTCCTAGAGGTTCCTGGG - Intergenic
996368349 5:122726456-122726478 CTCCTTTTCTCGTGGTTCAGTGG + Intergenic
996778801 5:127160821-127160843 CACCCTTGCTAGTGATCCCAGGG + Intergenic
998147043 5:139734850-139734872 CCGCTGGTCTAGTGGTTCCAGGG - Intergenic
998227723 5:140339817-140339839 CACCCTGGCTAGTGGTTCCTGGG + Intronic
1000504719 5:162101613-162101635 CACCTTTTCTATTGAGTCCAGGG - Intronic
1000894158 5:166834913-166834935 TGCATTTTCAAGTGGTTCCAGGG + Intergenic
1001010343 5:168092077-168092099 GAACTTTTCTATTGGTCCCATGG + Intronic
1001889118 5:175324418-175324440 CACCTTTACTTGGGTTTCCAGGG - Intergenic
1006695725 6:35929045-35929067 CCTCTTTTCTTGTGCTTCCAGGG - Intergenic
1007998639 6:46335528-46335550 CACGTTTTCAAATGATTCCATGG + Intronic
1009061419 6:58401554-58401576 CACCTTTGTTACTTGTTCCATGG - Intergenic
1016110513 6:140218381-140218403 CACCATTTTTAGTGGTTTCAGGG + Intergenic
1019127512 6:169850815-169850837 CACATTCTCCAGTGGTTGCAGGG - Intergenic
1020331192 7:7018588-7018610 AAGCTTTTCTTGTGGTTCCTAGG + Intergenic
1022791293 7:33691858-33691880 CACTTTTTCTGGAGGTTCTAAGG - Intergenic
1023551622 7:41376167-41376189 CACCATTTGGATTGGTTCCAAGG + Intergenic
1023993802 7:45146462-45146484 CTCCTTTCCTAGAGGTTCCTAGG - Intergenic
1024612449 7:51079181-51079203 CACCTTCTCGAGTGGTTTCTTGG - Intronic
1026646286 7:72172148-72172170 CAACTTTTCCACAGGTTCCATGG - Intronic
1027980950 7:85221111-85221133 TTCCTTTCCTAGTGGTTCAATGG - Intergenic
1029854601 7:103502714-103502736 CACCTTTTCATCTGGCTCCAAGG + Intronic
1031631971 7:124054071-124054093 CTCCTTTTCTAGTGGGTTCTAGG + Intergenic
1032518912 7:132527891-132527913 CACCTTATCTCCTTGTTCCAGGG - Intronic
1034719708 7:153279835-153279857 TACCTTTGCTATTGGCTCCAAGG - Intergenic
1035725228 8:1820486-1820508 CGCCTTGTATAGTGGTTCCAGGG + Intergenic
1037890953 8:22623440-22623462 CCCCTTCCTTAGTGGTTCCAAGG + Intronic
1039768614 8:40659537-40659559 AACCTTTTTTTGTGGTCCCAGGG + Intronic
1046502175 8:115092864-115092886 CACCTTTTGTAGTTGGCCCACGG + Intergenic
1047754433 8:127907807-127907829 CACGTTTTATAGTGGTTGTAAGG + Intergenic
1048846244 8:138605923-138605945 CACCTTTACTATTATTTCCAGGG + Intronic
1054750166 9:68897654-68897676 GACCCTTTCTGGTGGTGCCAGGG + Intronic
1057828500 9:98389455-98389477 CACCTTGCCTGTTGGTTCCATGG + Intronic
1059199039 9:112397556-112397578 CACCTTTGTTACTTGTTCCATGG + Intronic
1061279726 9:129590623-129590645 AACCTTTTCCTGTGTTTCCACGG - Intergenic
1186119880 X:6349157-6349179 CACTTTTTCTAGAACTTCCATGG + Intergenic
1186855993 X:13626530-13626552 CACCTGTACTAGTGGTTTCATGG - Intronic
1192965462 X:76172682-76172704 CACTATATCTAGTTGTTCCAAGG + Intergenic
1195772098 X:108362460-108362482 CTTCTTTTCAAGTGATTCCAGGG + Intronic
1197276473 X:124485283-124485305 CACCTGTTATGGTGGTTCCAGGG - Intronic
1199453564 X:148001059-148001081 CACATTTTCTAGTGGATTGATGG - Intronic
1199917935 X:152364480-152364502 CCCCTTGACCAGTGGTTCCAGGG + Exonic
1199978532 X:152908301-152908323 CACCTTTGAAAGTGGTGCCAGGG - Intergenic