ID: 926261874

View in Genome Browser
Species Human (GRCh38)
Location 2:11271668-11271690
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 2, 1: 0, 2: 0, 3: 10, 4: 93}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926261864_926261874 14 Left 926261864 2:11271631-11271653 CCAGAAACCTGTTGCCCTGTTTT 0: 1
1: 1
2: 0
3: 8
4: 188
Right 926261874 2:11271668-11271690 TAGGATATACTCAAGGGGTATGG 0: 2
1: 0
2: 0
3: 10
4: 93
926261867_926261874 7 Left 926261867 2:11271638-11271660 CCTGTTGCCCTGTTTTAAAGGGC 0: 1
1: 0
2: 2
3: 8
4: 104
Right 926261874 2:11271668-11271690 TAGGATATACTCAAGGGGTATGG 0: 2
1: 0
2: 0
3: 10
4: 93
926261868_926261874 0 Left 926261868 2:11271645-11271667 CCCTGTTTTAAAGGGCATATTGA 0: 1
1: 0
2: 1
3: 19
4: 224
Right 926261874 2:11271668-11271690 TAGGATATACTCAAGGGGTATGG 0: 2
1: 0
2: 0
3: 10
4: 93
926261869_926261874 -1 Left 926261869 2:11271646-11271668 CCTGTTTTAAAGGGCATATTGAT 0: 1
1: 0
2: 1
3: 9
4: 172
Right 926261874 2:11271668-11271690 TAGGATATACTCAAGGGGTATGG 0: 2
1: 0
2: 0
3: 10
4: 93
926261863_926261874 28 Left 926261863 2:11271617-11271639 CCTTACTTGTGCAACCAGAAACC 0: 1
1: 0
2: 3
3: 11
4: 116
Right 926261874 2:11271668-11271690 TAGGATATACTCAAGGGGTATGG 0: 2
1: 0
2: 0
3: 10
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904940571 1:34163093-34163115 CAGGATATGCCCAAGGGGCAGGG + Intronic
905939498 1:41851972-41851994 TAGAAAATACCCAAGGGATAGGG + Intronic
908105551 1:60838140-60838162 GAGGATATACTCAGGAGGGAGGG + Intergenic
912132349 1:106619071-106619093 TTGGATATAGTCATGCGGTAAGG + Intergenic
921388075 1:214590680-214590702 TAGGATATACGAAAGGAGTAGGG + Intergenic
1068597033 10:58913366-58913388 TAGGAAATATTCATGGGGTTTGG + Intergenic
1068611238 10:59062629-59062651 TAGTATATACCCAAGAGGAATGG + Intergenic
1070142991 10:73752630-73752652 GAGGATATAGTGAGGGGGTAGGG + Intronic
1077835824 11:5927342-5927364 TATAAAATACTCAAGTGGTAAGG + Intronic
1079491815 11:20996987-20997009 GACGATATGCTCATGGGGTAGGG - Intronic
1081397341 11:42602225-42602247 TATGAGATTCTCCAGGGGTAAGG + Intergenic
1082558254 11:54588075-54588097 GAGGATTTTCTCCAGGGGTAGGG + Intergenic
1085706072 11:78787631-78787653 TAGAGTATACTCATGGGGTTGGG - Intronic
1090914633 11:131152405-131152427 TGGGATATCTTGAAGGGGTAGGG + Intergenic
1092519994 12:9260766-9260788 TAGGCTAAACTCAAGGTGTCAGG - Intergenic
1101421376 12:104554181-104554203 TAGCTTATGCTCAAGGGGGAAGG + Intronic
1105406761 13:20138637-20138659 TAGGATATCCTCAATTTGTAGGG + Exonic
1108726789 13:53191775-53191797 CAGGATATTCTCATGGGCTATGG - Intergenic
1111252676 13:85623513-85623535 TATGATATCCTCAAGGCTTAAGG - Intergenic
1116757757 14:48969034-48969056 TAGGACAAACTCCAGGGGTAGGG + Intergenic
1124611219 15:31210316-31210338 TAGGATATACTATAGGGTTCGGG - Intergenic
1125099322 15:35891891-35891913 TAAGATAAACTAGAGGGGTATGG - Intergenic
1125360272 15:38857488-38857510 TAGGATATTCTAAAAGGTTAGGG + Intergenic
1126892108 15:53217738-53217760 TAGTAGATACCCAAGGGTTATGG + Intergenic
1127458993 15:59180775-59180797 TAGGATATACTCATGGGAACAGG + Intronic
1127845639 15:62868226-62868248 AAGGATGGACTCCAGGGGTAGGG - Intergenic
1130265452 15:82397898-82397920 AGGGATATACTCGAGGGGCAGGG - Intergenic
1131363209 15:91813695-91813717 TAGTATATACTCTAGGGATCTGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1134210375 16:12271527-12271549 CAGCCTATGCTCAAGGGGTAGGG + Intronic
1135755839 16:25097359-25097381 TGGGATATAGGCAGGGGGTATGG - Intergenic
1141254425 16:82387337-82387359 GAGGACAGACTTAAGGGGTAGGG - Intergenic
1144110818 17:12030091-12030113 TAGCTCATACTCAAAGGGTAAGG - Intronic
1155339516 18:24799621-24799643 TAGGATTTAATGGAGGGGTAGGG - Intergenic
1156307552 18:35892623-35892645 GAAGATCTACTCAAGGTGTATGG + Intergenic
1162081438 19:8220222-8220244 TAGGGTATCTTCAAGGGGTGGGG - Intronic
1162433290 19:10642293-10642315 TAGGATGGACTCAGGGGGTGGGG + Intronic
1166421216 19:42638750-42638772 TAGGAACTACTAAAGGGGGAGGG - Intronic
1168552246 19:57306212-57306234 TATTATATAATCAAGGGGCAGGG - Intergenic
1168622586 19:57891222-57891244 TAGGATATAATCAAGAAATAGGG + Intronic
926261470 2:11267669-11267691 TAGGATATACTCAAGGGGTATGG - Intronic
926261874 2:11271668-11271690 TAGGATATACTCAAGGGGTATGG + Intronic
932820948 2:74900065-74900087 TAGTATATAATCAAGGAATAGGG - Intergenic
933571036 2:84012578-84012600 TATGATAAACTCTATGGGTATGG + Intergenic
935208103 2:100914142-100914164 TGGGAGAAACCCAAGGGGTATGG + Intronic
937446766 2:121965073-121965095 TAGGATCTACTTAAGGGGGAGGG + Intergenic
939432141 2:142124193-142124215 TGGGGTCTACTCAAGGGGGAGGG - Intronic
939702479 2:145410924-145410946 TGGGATAAAGTCAAGAGGTAGGG + Intergenic
939918432 2:148077951-148077973 TAGGATCTACTTAAGGTGTAAGG + Intronic
943341064 2:186682905-186682927 TAGGATATAATAAAAAGGTATGG - Intergenic
945257529 2:207814594-207814616 AAGGATCTACTCAAGAAGTAGGG - Intergenic
947501487 2:230674460-230674482 TAGGATATAAACAAGGTGGAGGG + Intergenic
1173229413 20:41182533-41182555 TAGGAGGTACTCAAGGGTTTGGG - Exonic
1177552110 21:22636869-22636891 TAGGATATGCTAATGGGGCATGG - Intergenic
1178369186 21:32012877-32012899 TTGGATAGAGTCAAGGGGTCTGG + Intronic
1184298080 22:43538752-43538774 TGGCATTCACTCAAGGGGTATGG - Intronic
949174944 3:1049809-1049831 TAAGATATACACAAGTGGGAAGG + Intergenic
949658457 3:6249235-6249257 TAGAATAAACTCAAGAGATAAGG - Intergenic
951623249 3:24629812-24629834 TAGGTTATCCTTAAGGAGTAAGG + Intergenic
951754440 3:26074574-26074596 TAGGATATACTTAGGGGTCAAGG + Intergenic
959348395 3:105228954-105228976 TAGCACATATTCAAGGGGAAAGG - Intergenic
960090070 3:113629992-113630014 TAGGATTTACACAAGGGCTGGGG + Intergenic
960788887 3:121404433-121404455 TAGGATACACCCAGGAGGTAGGG + Intronic
960927593 3:122810913-122810935 TGGGATTTACTTAAGTGGTAAGG - Intronic
961424463 3:126834309-126834331 TAGGATATATTTAAGTGCTATGG + Intronic
967587713 3:191235152-191235174 TTGGGTTTACTCAAGGGGTAGGG - Intronic
973918211 4:55657764-55657786 TAGAATATGCTGAAGGGGCAGGG + Intergenic
974481006 4:62442815-62442837 TGGGATATAATCAAGCTGTAAGG - Intergenic
974601193 4:64082350-64082372 TATTATATACTCAAATGGTACGG - Intergenic
977319498 4:95494475-95494497 TTGGCTATACTTAAGGGGTGGGG - Intronic
978166304 4:105612172-105612194 TGGGGTCTATTCAAGGGGTAAGG - Intronic
978711682 4:111790074-111790096 CAGGATATACTCATGGGGAAAGG - Intergenic
979514771 4:121595111-121595133 TAGGAAATAGTCAAGAGCTAAGG - Intergenic
985303524 4:188514410-188514432 GAGGATTTAGTCAATGGGTAAGG + Intergenic
991095106 5:62731566-62731588 TTGAATATATTCAAGGTGTATGG + Intergenic
993876644 5:93315147-93315169 TAGGAAATAATCATGTGGTAAGG - Intergenic
994240362 5:97412257-97412279 TAGGGTATACCCAAGAGTTAAGG - Intergenic
995207443 5:109497422-109497444 TAGGGTATAGTCAAGAGGGATGG + Intergenic
999479354 5:151932340-151932362 TAGGCTATGCCCAAGGGATAAGG - Intergenic
1001618113 5:173058150-173058172 TAGGATATACACCAGAGGCAGGG + Intronic
1004315119 6:14580057-14580079 TAGGATATGCTCAAGGAATGAGG + Intergenic
1012070857 6:94613935-94613957 TAGGGGCTACTAAAGGGGTAAGG + Intergenic
1014930038 6:127324957-127324979 TAGTCTACACTCAAGGGGGAAGG - Intronic
1030426930 7:109389800-109389822 CAGGAGAGACTCAAGGGGAATGG + Intergenic
1031848384 7:126833200-126833222 AAAGAGATACTCAAAGGGTAAGG + Intronic
1032198280 7:129801901-129801923 TAGCAGAAACTCAAGTGGTATGG - Intergenic
1041653333 8:60322781-60322803 TAGCCTACACTCAAGGGGCAAGG + Intergenic
1042748053 8:72128816-72128838 TGGGATATCTTCAAGGGGGATGG - Intergenic
1053613587 9:39741009-39741031 TAAGATATACACAAGGGGGAGGG + Intergenic
1053871628 9:42498966-42498988 TAAGATATACACAAGGGGGAGGG + Intergenic
1054239927 9:62601388-62601410 TAAGATATACACAAGGGGGAGGG - Intergenic
1054554060 9:66635914-66635936 TAAGATATACACAAGGGGGAGGG - Intergenic
1059392994 9:114010931-114010953 TGGGATACTCACAAGGGGTAGGG - Intronic
1059525936 9:114991026-114991048 AAGGATATACTCTAGGGTTGGGG - Intergenic
1060321638 9:122567255-122567277 TAGGAAATATTCATGGGGAAAGG + Intergenic
1188776357 X:34224427-34224449 TTGGATATGCTCAAGCGGAATGG + Intergenic
1192676865 X:73206081-73206103 TAGTCTACACTTAAGGGGTAAGG - Intergenic
1192823689 X:74671700-74671722 TTGTATATATTCAAGGTGTATGG - Intergenic
1195726471 X:107922576-107922598 TTGGTTATCCACAAGGGGTAGGG - Intronic
1196105387 X:111889658-111889680 TATGAAATCCTCAAGGGGAAAGG + Intronic
1197873076 X:131078475-131078497 CATGGTATACTGAAGGGGTAAGG + Intronic
1202274180 Y:23098608-23098630 TAGGGAATACTCAACCGGTAAGG + Intergenic
1202291846 Y:23322069-23322091 TAGGGAATACTCAACCGGTAAGG - Intergenic
1202427176 Y:24732353-24732375 TAGGGAATACTCAACCGGTAAGG + Intergenic
1202443615 Y:24937741-24937763 TAGGGAATACTCAACCGGTAAGG - Intergenic