ID: 926262551

View in Genome Browser
Species Human (GRCh38)
Location 2:11279855-11279877
Sequence ATCTTTCTGTTACCAGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 707
Summary {0: 1, 1: 2, 2: 9, 3: 147, 4: 548}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926262551_926262552 2 Left 926262551 2:11279855-11279877 CCAGAAACTGGTAACAGAAAGAT 0: 1
1: 2
2: 9
3: 147
4: 548
Right 926262552 2:11279880-11279902 CTAGAAAATCCCAAAATATGTGG 0: 3
1: 7
2: 44
3: 183
4: 730

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926262551 Original CRISPR ATCTTTCTGTTACCAGTTTC TGG (reversed) Intronic
900358726 1:2277579-2277601 CTCTTTTTGTTCCCAGTTTCGGG + Intronic
902273396 1:15322869-15322891 CTCTTTTTCTTCCCAGTTTCGGG - Intronic
903054910 1:20629195-20629217 CTCTTTTTCTTACCAGTCTCAGG - Intergenic
903402653 1:23067574-23067596 ATTTTTGTGTTACCAGTTTTAGG + Intronic
904572197 1:31474669-31474691 CTCTTTTTGTTCCCGGTTTCAGG - Intergenic
904883234 1:33716211-33716233 CTCCTTCTGCTACCAGTCTCTGG - Intronic
905484874 1:38288389-38288411 CTCTCTCTGCTATCAGTTTCAGG + Intergenic
905959002 1:42027670-42027692 CTCTTTTTGTTCCCAGTTTCGGG - Intronic
906020677 1:42626864-42626886 CTCTTTTTATTCCCAGTTTCAGG + Intronic
906822765 1:48946665-48946687 ATCTTTGTGTCCCCAGTGTCTGG - Intronic
906840616 1:49134559-49134581 ATATTTCTCTTACCTGTTTTTGG + Intronic
907007561 1:50931386-50931408 CTCTTTTTGTTTCCAGTTTTGGG - Intronic
907625254 1:56023201-56023223 TTCTTTTTGTTCCCAGTTTCGGG - Intergenic
908101490 1:60796019-60796041 CTCTTTTTCTTCCCAGTTTCAGG - Intergenic
908760738 1:67509486-67509508 CTCTTTTTGTTCCCAGTTTCGGG + Intergenic
909160780 1:72147218-72147240 CTCATTTTGTTCCCAGTTTCGGG - Intronic
909161037 1:72149067-72149089 ATCTTTTTGTTCCCAGTTATTGG - Intronic
909204496 1:72738251-72738273 CTCTTTTTGTTCCCAGTTTTGGG - Intergenic
909547599 1:76865205-76865227 ATCTTTCTGTTACAATCTTTAGG - Intergenic
909905842 1:81193524-81193546 ATGTTCCTGTTCCAAGTTTCTGG - Intergenic
910734431 1:90436889-90436911 ATTTTTCTGTTTCTAATTTCAGG - Intergenic
910750551 1:90625414-90625436 TTCTATTTGTTACCAGTATCTGG + Intergenic
910792259 1:91063680-91063702 CTCTTTTTGTTTCCAGTTTCAGG + Intergenic
911738643 1:101363613-101363635 CTCTTTTTGTTCCCAGTTTTGGG + Intergenic
911857598 1:102900519-102900541 ATCATTATGTTACTAGTTTAAGG - Intronic
912260319 1:108105112-108105134 ATCTTTATGTTTCCTGTCTCAGG - Intergenic
912389844 1:109295352-109295374 GTCTTTCTGTGCTCAGTTTCTGG + Intronic
912577011 1:110681487-110681509 ATCTTTGTATTTCCAGTCTCTGG + Intergenic
913080611 1:115382263-115382285 AACTTTCTGTTATTAATTTCTGG + Intergenic
913708495 1:121453939-121453961 ATCATTCTGATACCAGAATCTGG - Intergenic
915044775 1:153003156-153003178 ATCTTTGTGTTTCCAGGTTGTGG - Exonic
915336018 1:155142059-155142081 CTCTTTTTGTTTGCAGTTTCGGG + Intergenic
915691938 1:157698628-157698650 ATCTTTCTATTTCCTGTTTAGGG - Exonic
915711054 1:157898161-157898183 CTCTTTTTGTTCCCAGTTTTGGG - Intronic
915766773 1:158371250-158371272 CTCTTTCTGTTACCAGAGACTGG + Intergenic
916533509 1:165680864-165680886 CTCTTTCTGTTCCCAGTTTCGGG - Intronic
916758831 1:167798703-167798725 TTATTTCTGTAACCAGTTACAGG + Intergenic
917735992 1:177920945-177920967 ATGTTTCTGTTCCCTGTCTCAGG - Intergenic
917811918 1:178667252-178667274 CTCTTTTTGTTCCCAGTTTTTGG + Intergenic
918119756 1:181528363-181528385 CTCTTTTTGTTCCCAGTTTCAGG + Intronic
918120061 1:181530294-181530316 CTCTTTTTGTTTCCAGTTTCAGG + Intronic
918429549 1:184444543-184444565 CTCTTTTTCTTCCCAGTTTCGGG + Intronic
918460306 1:184769725-184769747 CTCTTTCTCTTTCCACTTTCAGG - Intergenic
918678292 1:187318266-187318288 ATCTTTCTGTTAATAATTTTTGG + Intergenic
919664737 1:200281254-200281276 CTCTTTTTATTCCCAGTTTCAGG - Intergenic
920937965 1:210453892-210453914 CTCTTTTTATTGCCAGTTTCGGG - Intronic
921500387 1:215895284-215895306 ATCTTTCTATCACCAGTGTCTGG - Intronic
921729864 1:218565868-218565890 TTCTTTCAGTTACCAGATTGAGG + Intergenic
923253956 1:232203056-232203078 ATCTTTCTCTTACTGATTTCTGG - Intergenic
923312691 1:232751075-232751097 GTCTTTCTGTAAACTGTTTCAGG - Intergenic
1063328832 10:5134717-5134739 ATCTTTGTGGTAACAGTGTCTGG - Intronic
1063910048 10:10820208-10820230 CTCTTTTTGTTCTCAGTTTCGGG + Intergenic
1064726442 10:18284595-18284617 ACCCTTCTGTGACTAGTTTCTGG - Intronic
1065220288 10:23489406-23489428 CTCTTTTTGTTCCCAATTTCGGG + Intergenic
1065496337 10:26332608-26332630 TTATTTCTGTAACCAGTTACAGG - Intergenic
1065512502 10:26493099-26493121 ATATTTCTCTTACCCGTTTTCGG + Intronic
1065542944 10:26788280-26788302 CTCTTTTTCTTCCCAGTTTCAGG + Intronic
1066331375 10:34427238-34427260 ATATTTCTCTTACCCGTTTTCGG - Intronic
1066473062 10:35718127-35718149 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1066712543 10:38251301-38251323 ACTTTTTTGTTCCCAGTTTCAGG + Intergenic
1067308457 10:45089887-45089909 ATTTTTCTGTTTCCATTTTTCGG + Intergenic
1068071735 10:52204910-52204932 ATATTTCTCTTACCCGTTTTCGG - Intronic
1068194002 10:53692367-53692389 ATGTCTCTGTTAGCATTTTCTGG + Intergenic
1068261632 10:54590891-54590913 ATCTTTCTGTTACCTCATTTGGG + Intronic
1068400153 10:56518144-56518166 CTCTTTTTGTTCCCAGTTTTTGG - Intergenic
1068400421 10:56520072-56520094 CTGTTTTTGTTCCCAGTTTCAGG - Intergenic
1068494360 10:57766966-57766988 ATCTTTCTGTTACTTATTTCTGG - Intergenic
1068526373 10:58134768-58134790 TTATTTCTGTAACCAGTTACAGG + Intergenic
1068676958 10:59778559-59778581 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1068906552 10:62331688-62331710 CTCTTTCTGTTACTATTTGCAGG + Intergenic
1069058960 10:63873460-63873482 CTCTTTTTGTTCCCAGTTTTGGG - Intergenic
1069169962 10:65214513-65214535 ACCCTTCTGTGTCCAGTTTCTGG - Intergenic
1069900878 10:71706002-71706024 GGGTTTCTGTTGCCAGTTTCAGG + Intronic
1070144611 10:73764717-73764739 ATCCTTCTGTCACCTGTTTTGGG + Intronic
1070273597 10:74982572-74982594 ATGTATCTGTTGTCAGTTTCAGG + Intronic
1070668958 10:78364745-78364767 TTCTGTCTCTTTCCAGTTTCTGG + Intergenic
1071324909 10:84503909-84503931 TTCTTTCTCTTACAAATTTCAGG + Intronic
1071395299 10:85217744-85217766 ATCTTTTTCTTCCCAGTCTCAGG + Intergenic
1071442679 10:85717306-85717328 TTTTTTTTGTTCCCAGTTTCAGG - Intronic
1072488140 10:95875660-95875682 CTCTTTTTGTTCCCAGTCTCAGG - Exonic
1072709752 10:97708339-97708361 TTCTTCTTGTTACAAGTTTCTGG + Intergenic
1072840244 10:98765329-98765351 ACCTTTCTGTTACTAATTTCTGG - Intronic
1072992370 10:100209260-100209282 TTATTTCTGTAACCAGTTACAGG - Intronic
1073514489 10:104064590-104064612 ATGTGTCTGTTTCCAGTGTCAGG - Exonic
1073807483 10:107113963-107113985 ATTTTTGTATTACCAGTTTTGGG - Intronic
1074271339 10:111956908-111956930 ATGTTTCTGTTACCGGTTTTCGG - Intergenic
1074741645 10:116490633-116490655 ATGTTTCTGTCACATGTTTCAGG + Intergenic
1074836973 10:117304851-117304873 CTCTTTTTGTTCCCAGTTTCAGG + Intronic
1075543790 10:123338211-123338233 CTCTTTTTGTTCCCAGTCTCAGG - Intergenic
1076272966 10:129171643-129171665 ATCTTTCTGGTACCTATTTTTGG + Intergenic
1076430385 10:130397977-130397999 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1076464669 10:130670865-130670887 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1076464944 10:130672796-130672818 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1077277889 11:1725040-1725062 ATCCTTCTGTTCTCAGTATCTGG - Intergenic
1078269551 11:9782273-9782295 ATCTTTTTCTTATCAATTTCTGG - Intronic
1078328581 11:10400449-10400471 ATCTTTCTATTACCCTTTCCTGG - Intronic
1078804480 11:14683978-14684000 ATCTTTTTGTTACCTATTTCTGG + Intronic
1079341175 11:19612921-19612943 CTCTTTTTCTTCCCAGTTTCAGG - Intronic
1079552306 11:21715087-21715109 TTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1079676653 11:23236075-23236097 TTCTTTCTGTTACCAGATTTGGG + Intergenic
1079948083 11:26768165-26768187 TTATTTCTGTAACCAGTTACAGG + Intergenic
1080259568 11:30332932-30332954 TTTTCTCTTTTACCAGTTTCTGG - Exonic
1080339385 11:31242189-31242211 ACCTTTCTTTTTTCAGTTTCTGG + Intronic
1080739203 11:35048219-35048241 ATCTTTTTCTTCCCAGTCTCAGG + Intergenic
1080778520 11:35408589-35408611 CTCTTTTTATTCCCAGTTTCAGG + Intronic
1081077525 11:38695509-38695531 CTCTTTTTGTTCCTAGTTTCGGG - Intergenic
1081387398 11:42487723-42487745 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1081479900 11:43476465-43476487 CTCTTTTTGCTCCCAGTTTCAGG - Intronic
1081939605 11:46929340-46929362 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1082230196 11:49755123-49755145 TTCATTCTGTTACTAGTTTGGGG + Intergenic
1082766342 11:57170905-57170927 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1083386350 11:62313105-62313127 CTCTTTCTGTCCCCAGGTTCTGG + Intergenic
1083790022 11:64978561-64978583 CTCTTTTTCTTCCCAGTTTCAGG - Intergenic
1084204096 11:67581426-67581448 ATATTTCTCTTACCTGTTTGCGG - Intergenic
1084722030 11:70912757-70912779 CTCTTTTTGTTTCCAGTTTTGGG + Intronic
1084909671 11:72378309-72378331 CTCTTTTTGTTCCCAGTTTCAGG - Intronic
1085194168 11:74658086-74658108 CTCTTTTTGTTCCCAGTTTCAGG - Intronic
1085369459 11:75986328-75986350 ATCTTATTTTTACTAGTTTCTGG + Intronic
1085755188 11:79196157-79196179 TTCTTTTTGTTCCCAGTTTCGGG + Intronic
1085756575 11:79206784-79206806 CTCTTCTTGTTTCCAGTTTCAGG + Intronic
1086190220 11:84070158-84070180 ATCTTTGTATTACCAGTGTCAGG + Intronic
1086231597 11:84577188-84577210 CTCTTTTTGTTCCCAGTTTGGGG + Intronic
1086604887 11:88684907-88684929 CTCTTTTTCTTCCCAGTTTCGGG + Intronic
1086759096 11:90604145-90604167 CTCTTTTTGTTTCCAGTTTTGGG + Intergenic
1087054991 11:93925772-93925794 ATCTTTCTGTTATTGATTTCTGG - Intergenic
1087189407 11:95236547-95236569 ACCTTTTTATTCCCAGTTTCGGG + Intergenic
1089284630 11:117397558-117397580 TTCTTTTTCTTCCCAGTTTCAGG - Intronic
1089649405 11:119902763-119902785 CTCTTTCTCTTCCCAGTTTCGGG - Intergenic
1091506914 12:1080855-1080877 CTCTTTTTGTTTCCAGTTTTGGG + Intronic
1091832094 12:3557222-3557244 ATCTTTCTCTTACCACTCTCAGG + Intronic
1093063246 12:14629562-14629584 TTATTTCTGTAACCAGTTACAGG - Intronic
1093962777 12:25293252-25293274 CTCTTTTTCTTCCCAGTTTCGGG + Intergenic
1094677646 12:32636692-32636714 TGGTTTATGTTACCAGTTTCTGG - Intronic
1095462804 12:42460225-42460247 TTCTTTCTGTAACAAGATTCAGG + Exonic
1095623986 12:44292773-44292795 ATCTTCCTGTTACTGATTTCTGG + Intronic
1095968899 12:47888015-47888037 CTCTTTCTCTTCCCAGTCTCAGG - Intronic
1096658571 12:53106650-53106672 TTATTTCTGTAACCAGTTACAGG + Intronic
1096659268 12:53113626-53113648 TTATTTCTGTAACCAGTTACAGG + Intronic
1098068330 12:66643948-66643970 ATCTTTTTCTTCCCAGTCTCTGG - Intronic
1098078376 12:66758153-66758175 CTCTTTTTGTTCCCAGTTTCAGG - Intronic
1098560563 12:71866853-71866875 ATCTTGCTGACACCAGTCTCTGG + Intronic
1099407781 12:82284477-82284499 CTCTTTTTGTTCCCTGTTTCAGG + Intronic
1099503536 12:83445407-83445429 CTCTTTTTGTTCCCAGTTTCGGG + Intergenic
1099503842 12:83447545-83447567 CTCTTTTTGTTCCCAGTTTTGGG + Intergenic
1099507645 12:83499369-83499391 CTCTTTTTGTTCCCAGTTTCTGG + Intergenic
1099507934 12:83501293-83501315 CTCCTTTTGTTCCCAGTTTCAGG + Intergenic
1099700509 12:86076533-86076555 CTCTTTTTCTTCCCAGTTTCCGG - Intronic
1100678625 12:96894508-96894530 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1100691881 12:97047057-97047079 ATCTTTCTGTTTCCACCATCTGG + Intergenic
1100904210 12:99279019-99279041 TTCTTTGTGTTTCCATTTTCAGG + Intronic
1101274646 12:103185867-103185889 CTCTTTTTCTTTCCAGTTTCGGG + Intergenic
1101293679 12:103398369-103398391 ATCTTTCTCTTACAAATTTGTGG + Intronic
1101729635 12:107416338-107416360 TTATTTCTGTTAGCAGTTTCTGG + Intronic
1102211893 12:111133335-111133357 CTCTTTTTGTTCCCAGTTTTGGG - Intronic
1102248714 12:111371298-111371320 CTCTTTTTGTTCTCAGTTTCGGG - Intergenic
1102249037 12:111373492-111373514 CTCTTTTTGTTCCCAGTTTTGGG - Intergenic
1102436349 12:112926961-112926983 ATATTTCTCTTACCTGTTTTTGG + Intronic
1102794880 12:115679958-115679980 CTCTTTTTGCTCCCAGTTTCAGG + Intergenic
1103302029 12:119935075-119935097 CTCTTTTTCTTCCCAGTTTCGGG + Intergenic
1105055674 12:133096684-133096706 ATCTTTCTGTTACTGATTTCTGG + Intronic
1108155731 13:47583290-47583312 TTCTTTTTGTTTCCAGTTTCAGG - Intergenic
1108156014 13:47585202-47585224 CTGTTTTTGTTCCCAGTTTCGGG - Intergenic
1108401539 13:50050056-50050078 ATCTTCCTATTCCCTGTTTCTGG + Intergenic
1108419690 13:50235252-50235274 CTCTTTTTGTTCCCAGTTTCAGG + Intronic
1108724168 13:53162726-53162748 TTCTTTTTGTTCCCAGTTTTGGG - Intergenic
1108724443 13:53164523-53164545 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1108793151 13:53997078-53997100 TTCTTGCTTTTTCCAGTTTCTGG - Intergenic
1109356904 13:61242464-61242486 CTCTTTTTGCTCCCAGTTTCAGG - Intergenic
1109901070 13:68770704-68770726 CTCTTTTTGTTCCCAGTTTTGGG + Intergenic
1110234976 13:73207544-73207566 ATCTCTCTGTTATCAAGTTCAGG + Intergenic
1110532073 13:76609549-76609571 ATCTTTTTCTTTCCAGTCTCGGG - Intergenic
1110564600 13:76945677-76945699 TTATTTCTGTAACCAGTTACAGG + Intergenic
1110917780 13:81045105-81045127 AGCCTTCAGTTACCAGTTTCAGG + Intergenic
1111154809 13:84308879-84308901 CTCTTTTTCTTCCCAGTTTCGGG + Intergenic
1111356504 13:87112070-87112092 ATGTTTCTGAAACCACTTTCTGG - Intergenic
1111617814 13:90683384-90683406 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1111799500 13:92964502-92964524 CTCTTTTTCTTCCCAGTTTCAGG + Intergenic
1111812358 13:93107174-93107196 TGCTTTCTGTCCCCAGTTTCTGG + Intergenic
1111972307 13:94929660-94929682 CTTTTTTTGTTCCCAGTTTCGGG - Intergenic
1112093527 13:96108093-96108115 ATATTTCTCTTACCCGTTTTCGG - Intronic
1113280398 13:108781957-108781979 CTCCTTTTGTTCCCAGTTTCAGG + Intronic
1113570106 13:111347490-111347512 TTCCTTATGTTACCAGTCTCAGG + Intergenic
1113968870 13:114173025-114173047 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1114272875 14:21114382-21114404 TTATTTCTGTAACCAGTTACAGG + Intergenic
1114911688 14:27207135-27207157 CTCTTTTTGTTCCCAGTTTCTGG + Intergenic
1115917372 14:38331000-38331022 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1116565006 14:46433370-46433392 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1117198340 14:53363237-53363259 CTCTTTTTCTTACCAGTCTCAGG - Intergenic
1117218262 14:53574526-53574548 ATCTTTCAGTTACAAGTGCCAGG - Intergenic
1117434242 14:55700945-55700967 CTTTTTTTGTTCCCAGTTTCAGG + Intronic
1117583867 14:57180135-57180157 ATATTTCTCTTACCCGTTTTTGG + Intergenic
1117915052 14:60669590-60669612 CTCCTTTTGTTCCCAGTTTCAGG - Intergenic
1117946260 14:61025680-61025702 ATCTTTGTCTTATCATTTTCAGG - Intronic
1118739142 14:68726079-68726101 TTCTTTTTGTTCCGAGTTTCGGG - Intronic
1119896800 14:78226781-78226803 ATCTTTCTCTACCAAGTTTCAGG - Intergenic
1120091253 14:80335220-80335242 ATCTTTTTGTTCCCAGTCTTGGG - Intronic
1120104512 14:80479344-80479366 CTCTTTTTGTTCCCAGTTTCAGG - Intronic
1120166537 14:81207459-81207481 CTCTTTTTGTTCCCAGTTTTGGG + Intronic
1120166802 14:81209401-81209423 CTTTTTTTGTTTCCAGTTTCGGG + Intronic
1120295367 14:82633712-82633734 ATATTTCTCTTACCTGTTTTTGG - Intergenic
1120541186 14:85753050-85753072 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1120644595 14:87058328-87058350 CTCTTTTCGTTCCCAGTTTCGGG + Intergenic
1121483669 14:94297352-94297374 CTCTTTCTCTTCCCAGTCTCGGG - Intergenic
1121654163 14:95583177-95583199 TTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1121673475 14:95732195-95732217 CCCTTTCTGGTAACAGTTTCAGG - Intergenic
1121911632 14:97797224-97797246 CTCTTATTGTTACCAGGTTCAGG - Intergenic
1123189306 14:106553096-106553118 CTCTTTTTGTTCCCAGTTTTGGG - Intergenic
1123984630 15:25634310-25634332 AACTGTGTGTTTCCAGTTTCTGG - Intergenic
1124001732 15:25765988-25766010 CTCTTTTTGTTCCCAGTTTTGGG - Intronic
1124695668 15:31862434-31862456 CTCCTTTTGTTCCCAGTTTCGGG - Intronic
1125225775 15:37394513-37394535 ATCTTTCTGTGACCTGTCTCAGG - Intergenic
1126127213 15:45306295-45306317 ATGTTTATTTTAACAGTTTCTGG - Intergenic
1127578771 15:60317663-60317685 CTCTTTTTGTTACCAGTTTTGGG - Intergenic
1127618338 15:60709107-60709129 ATCTTTCTGATATAAGTTTTGGG - Intronic
1129616959 15:77106220-77106242 TTATTTCTGTAACCAGTTACAGG + Exonic
1130786392 15:87101232-87101254 TTCTTTCTGGTAGAAGTTTCTGG - Intergenic
1130841313 15:87703734-87703756 ATTTTTTTGTTCCCAGATTCGGG - Intergenic
1131084253 15:89562645-89562667 ATCTTTCTGTTAATGATTTCTGG - Intergenic
1131451048 15:92540383-92540405 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1131618155 15:94038312-94038334 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1133378898 16:5313541-5313563 CTCTTTCTCTTCCCAGTCTCGGG - Intergenic
1133483645 16:6196596-6196618 ATTTCTCTATTTCCAGTTTCAGG - Intronic
1133545421 16:6801733-6801755 TTATTTCTGTAACCAGTTACAGG + Intronic
1134331815 16:13258586-13258608 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1134332144 16:13260848-13260870 CTTTTTTTGTTCCCAGTTTCAGG - Intergenic
1134533727 16:15007006-15007028 TGCTTTCTGTGACCATTTTCAGG + Intronic
1134602781 16:15546523-15546545 CTATTTCTGTTACCAGTTACAGG + Intronic
1135288252 16:21212547-21212569 AGCTCTCTGTTACCATTTTAGGG + Intronic
1138018899 16:53458639-53458661 CTCTTTTTGTTCCCAGTTTTGGG - Intronic
1138024871 16:53514481-53514503 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1138859816 16:60743274-60743296 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1139363337 16:66417233-66417255 AGCTTTCTGTTTCTAGTTCCTGG - Intergenic
1139724807 16:68888587-68888609 ATCTCTCTGTTTCCAGATTCAGG + Intronic
1140410732 16:74739019-74739041 ATCTCTGTGTTCCCAGTGTCAGG + Intronic
1141164771 16:81653073-81653095 TTCTTTCTGTTTTCTGTTTCAGG + Intronic
1141227888 16:82136528-82136550 TTATTTCTGTAACCAGTTACAGG - Intergenic
1142799325 17:2335724-2335746 ATCTTTCTATTTTCAGGTTCTGG - Exonic
1143163043 17:4883935-4883957 ATCATTTTGTTTACAGTTTCAGG + Intronic
1143549039 17:7617716-7617738 TTATTTCTGTTATCACTTTCTGG - Intronic
1143973444 17:10812735-10812757 ATATTTCTGTCACCATTTTCTGG + Intergenic
1144028823 17:11301879-11301901 CTCTTTCTCTTCCCAGTCTCTGG - Intronic
1148356046 17:46976701-46976723 TTCTTTCTGAAACCATTTTCTGG + Intronic
1148384471 17:47224177-47224199 CTCTTTTTCTTCCCAGTTTCAGG - Intergenic
1149157639 17:53651447-53651469 TACTTTCTGTTTCAAGTTTCAGG + Intergenic
1149205552 17:54241537-54241559 TTCTCTCTTTTACTAGTTTCAGG + Intergenic
1149477217 17:56973047-56973069 TTATTTCTGTAACCAGTTACAGG - Intergenic
1149709275 17:58725008-58725030 ATCATTCTGTTATGAGCTTCAGG - Intronic
1150793068 17:68215154-68215176 TTGTTTCTCTTAGCAGTTTCTGG - Intergenic
1152650601 17:81490818-81490840 ATCTGTCTGGGACCTGTTTCAGG + Intergenic
1153012106 18:548562-548584 CTCTTTTTGTTCCCAGTCTCAGG - Intergenic
1153775006 18:8445079-8445101 CTCTTTTTCTTCCCAGTTTCTGG - Intergenic
1153886262 18:9469889-9469911 ATTTTTCTTTTGCCACTTTCAGG + Intergenic
1153897157 18:9575244-9575266 ATCTTTCCATTTACAGTTTCTGG + Intronic
1154284057 18:13035307-13035329 CTCTTTTTGTTCCCAGTTTCGGG - Intronic
1155143189 18:23062054-23062076 TTTTTTTTGTTCCCAGTTTCGGG - Intergenic
1155795944 18:30036227-30036249 ATTTTTTTCTTCCCAGTTTCAGG + Intergenic
1156197884 18:34796507-34796529 ATCTTTCTTTTAGTAGTATCAGG - Intronic
1156211891 18:34953218-34953240 ATAATTCTGTTCTCAGTTTCCGG + Intergenic
1156969143 18:43133847-43133869 CTCTTTTTGTTTCCAGTTTCGGG + Intergenic
1157378064 18:47184214-47184236 AACTTTATTTTTCCAGTTTCAGG + Intergenic
1157932252 18:51835913-51835935 TTATTTCTGTAACCAGTTACAGG + Intergenic
1158116099 18:53997524-53997546 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1159306039 18:66643654-66643676 CTCTTTCTCTTCCCAGTCTCAGG - Intergenic
1159359752 18:67384374-67384396 TTCTTTTTCTTCCCAGTTTCAGG + Intergenic
1159722785 18:71913926-71913948 TTCTCTCTGTAGCCAGTTTCAGG + Intergenic
1159748811 18:72274050-72274072 CTCTTTTTCTTTCCAGTTTCAGG + Intergenic
1159996743 18:74971860-74971882 CTCTTTTTCTTCCCAGTTTCAGG - Intronic
1163171552 19:15535045-15535067 ATCTTTCTGACACCAGGATCTGG - Intronic
1164214327 19:23130381-23130403 CTCTTTCTCTTCCCAGTCTCAGG + Intronic
1164274495 19:23704668-23704690 CTCTTTTTATTGCCAGTTTCAGG + Intergenic
1165300520 19:34965481-34965503 ATATTTCTCTTACCCGTTTTTGG - Intergenic
1165946088 19:39443346-39443368 ATTTTTGTGTTTCCAGTTTAGGG + Intronic
1165964932 19:39568960-39568982 ATCGTTCTGTTAGCAGGCTCTGG + Intergenic
1165968772 19:39607400-39607422 ATTATTCTGTTAGCAGGTTCTGG - Exonic
1165976924 19:39684207-39684229 ATCGTTCTGTTAGCAGGCTCTGG - Intergenic
1167403357 19:49287710-49287732 ACCTTTTTGTTCCCAGTTTCAGG + Intergenic
1167403642 19:49289629-49289651 CTCTTTTTGTTCCCAGTTTCAGG + Exonic
1168183727 19:54682839-54682861 TTATTTCTGTTACCGGTTACAGG + Intronic
925257227 2:2500482-2500504 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
925537506 2:4933268-4933290 CTCTTTTTGTTCCCAGTCTCAGG + Intergenic
926262551 2:11279855-11279877 ATCTTTCTGTTACCAGTTTCTGG - Intronic
926269175 2:11352227-11352249 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
926414644 2:12637297-12637319 CTGTGTCTGTTATCAGTTTCAGG + Intergenic
927288106 2:21378157-21378179 CTCTTTTTGTTCCCAGTTTTGGG - Intergenic
927825933 2:26310345-26310367 ATTTTTCTGTTACCACTATTTGG + Intronic
928327283 2:30329496-30329518 CTCTTTTTCTTTCCAGTTTCAGG - Intergenic
928465460 2:31518798-31518820 CTCTTTTTGTTCCCACTTTCAGG + Intergenic
928465742 2:31520687-31520709 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
928897172 2:36279514-36279536 ATATTTCTCTTACCCGTTTTTGG - Intergenic
928982331 2:37149017-37149039 TTTTCTCTTTTACCAGTTTCTGG - Exonic
929340083 2:40804600-40804622 ATCTTTTAGTTATCAGTTTAAGG - Intergenic
929657199 2:43745580-43745602 ATCTTCTTGTTTCCAGTTTCAGG + Intronic
929823481 2:45291811-45291833 CTCTTTTTCTTCCCAGTTTCAGG + Intergenic
930155416 2:48102668-48102690 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
930309803 2:49726319-49726341 CTCTTTTCGTTACCAGTTTCAGG - Intergenic
930504410 2:52264276-52264298 TTATTTCTGTAACCAGTTACAGG - Intergenic
930506429 2:52287431-52287453 TTATTTCTGTAACCAGTTACAGG + Intergenic
931406273 2:61981578-61981600 CTCTTTCTCTTTCCAGTCTCGGG - Intronic
931578473 2:63746508-63746530 ATATTTCTCTTACCTGTTTTCGG - Intronic
932073246 2:68642232-68642254 CTCCTTTTGTTCCCAGTTTCCGG - Intergenic
932695365 2:73951781-73951803 ATCTTTGTGTTGAGAGTTTCTGG + Intronic
932978608 2:76634995-76635017 TTATTTCTGTAACCAGTTACAGG - Intergenic
932995549 2:76846834-76846856 ATCTTTCTCTTACCAGATAATGG - Intronic
933022171 2:77207827-77207849 AACTTTCATTTACCAGTATCTGG - Intronic
933397694 2:81753576-81753598 CTCTTTTTGTTCCCAGTTTTGGG - Intergenic
933981677 2:87555777-87555799 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
934869203 2:97845411-97845433 ATCTTTCTGTTGCTAATTTCTGG - Intronic
936138918 2:109921962-109921984 CTGTTTCTGTGTCCAGTTTCAGG + Intergenic
936205778 2:110449523-110449545 CTGTTTCTGTGTCCAGTTTCAGG - Intronic
936312159 2:111395040-111395062 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
936406020 2:112203691-112203713 ATCTTTTTCTTCCCAGTCTCAGG - Intergenic
936431135 2:112464627-112464649 GTCTTTGTGTTTCCAGTTTTTGG - Intergenic
937422939 2:121773470-121773492 CTCTTTCTGTTTTCAGTTTAAGG - Intergenic
937898603 2:126998048-126998070 ATATTTCTGCAACCAGTTACAGG - Intergenic
938825789 2:135004303-135004325 TTCTTTCTGTTAGCTCTTTCAGG + Intronic
938868972 2:135453944-135453966 CTCTTTTTGTTCCCAGTTTCGGG - Intronic
941477460 2:165967202-165967224 CTCTTTTTGTTCCCAGTTTTGGG + Intergenic
941477742 2:165969120-165969142 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
941536102 2:166723763-166723785 ATCTTTTTGTTCCCAGGTTCGGG - Intergenic
941545927 2:166851484-166851506 CTCTTTCTCTTCCCAGTCTCAGG - Intergenic
942157686 2:173148326-173148348 ACCTTCTTGTTACCACTTTCTGG + Intronic
942281484 2:174368397-174368419 ATCTTTCTGTTACTGATTTCTGG - Intronic
942805593 2:179928646-179928668 CTCTTTTTGTTCCCAGTTTTTGG - Intergenic
943163702 2:184288248-184288270 GTCTTTTTCTTTCCAGTTTCTGG - Intergenic
943181793 2:184553663-184553685 ATCTTTCTGATACCCATTTCTGG + Intergenic
943251422 2:185524859-185524881 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
943665998 2:190609112-190609134 GTATTTCTGTAACCAGTTACAGG + Intergenic
944043937 2:195387604-195387626 ACCTTTTTGTTCCCAGTTTTGGG + Intergenic
944044212 2:195389532-195389554 TTTTTTTTGTTCCCAGTTTCAGG + Intergenic
944151249 2:196561094-196561116 ATATTTCTCTTACCCGTTTTTGG - Intronic
946875355 2:224124291-224124313 ATCTTTATGTTGACAGTGTCTGG - Intergenic
947011918 2:225575338-225575360 ATACTTCTGATACCAGTTTTAGG + Intronic
947093824 2:226543707-226543729 CTCTCTTTGTTCCCAGTTTCAGG + Intergenic
947133832 2:226956665-226956687 ATCTTTCTGTTAGCATTTCTGGG - Intronic
947912432 2:233810236-233810258 CTCTTTTTGTTCCCAGTTTCAGG - Intronic
1170061269 20:12261941-12261963 CTCTATATGTTACCATTTTCTGG + Intergenic
1170395719 20:15923193-15923215 CTTTTTTTGTTCCCAGTTTCGGG - Intronic
1170551081 20:17476908-17476930 GTCTTTCTGTTCCCAGGATCTGG - Intronic
1173465195 20:43275360-43275382 TCCTTGCTGTTTCCAGTTTCTGG + Intergenic
1173545684 20:43896058-43896080 CTCTTTTTCTTCCCAGTTTCGGG + Intergenic
1173680603 20:44877754-44877776 ATCTTTCTATTCCTAGTTTGCGG - Intergenic
1173703958 20:45096557-45096579 ATCTTTCTTTTAGCATTGTCTGG + Intronic
1174144173 20:48439374-48439396 ATGTTTATTTTATCAGTTTCAGG + Intergenic
1174212123 20:48888061-48888083 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1174865888 20:54135373-54135395 CTCTTTCTCTTCCCAGTCTCAGG - Intergenic
1176699635 21:10029003-10029025 ATTTTTCTGTTACCATTTTTTGG + Intergenic
1177027082 21:15933378-15933400 TTATTTCTGTAACCAGTTACAGG - Intergenic
1177117401 21:17102863-17102885 CTCTTTTTGTTCCCAGTCTCGGG + Intergenic
1177224646 21:18238269-18238291 CTCTTTCTCTTCCCAGTCTCGGG - Intronic
1177334552 21:19706883-19706905 CTCTTTTTCTTACCAGTCTCAGG + Intergenic
1177477536 21:21643903-21643925 CTCTTTTTGTTTCCAGTTTCAGG + Intergenic
1177477802 21:21645832-21645854 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1177608426 21:23413101-23413123 ATATTTCTGTAACCATTCTCTGG - Intergenic
1178291628 21:31373347-31373369 CTCTCTTTGTTCCCAGTTTCGGG - Intronic
1179131744 21:38643693-38643715 ACCTGTCTGTTGCCATTTTCAGG + Intronic
1179235426 21:39541305-39541327 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1181731898 22:24853520-24853542 GTCTTTTTGTTCCCAGTTTTGGG - Intronic
1182330006 22:29545022-29545044 CTCTTTTTGTTCCCAGTTTCAGG - Intronic
1182330451 22:29547887-29547909 CTCTTTTTGTTCCCAATTTCAGG - Intronic
1183261209 22:36797108-36797130 ATCTTTTTGGTGCCAGGTTCTGG + Intergenic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
1183863797 22:40688411-40688433 TTATTTCTGTAACCAGTTTTAGG + Intergenic
949939623 3:9144744-9144766 ATCTTTTTCTTCCCAGTCTCAGG + Intronic
950245771 3:11416995-11417017 ATCTTTCTGTTGTGAATTTCTGG + Intronic
950507580 3:13404836-13404858 ATGTTTCTGTTTCCAGGATCTGG + Intronic
950700522 3:14742689-14742711 CTTTTTTTGTTCCCAGTTTCGGG - Intronic
951974189 3:28485214-28485236 ATCTCTCTGTTACCAGTTTCTGG + Intronic
952105372 3:30064526-30064548 TTCTTTTTCTTCCCAGTTTCAGG - Intergenic
952563004 3:34617843-34617865 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
952714914 3:36471069-36471091 CTCTTTTTCTTCCCAGTTTCGGG - Intronic
952715212 3:36472998-36473020 CTCTTTTTGTTTCCAGTTTCAGG - Intronic
952717718 3:36497335-36497357 TTCTTTCTCTTAACAGTTTTAGG - Intronic
954591444 3:51787019-51787041 CTCTTTTTCTTCCCAGTTTCAGG + Intergenic
954591732 3:51788954-51788976 CTCTTTTTGTTCCTAGTTTCGGG + Intergenic
955514880 3:59716552-59716574 ATATTTCTCTTACCCGTTTTTGG + Intergenic
956524762 3:70145524-70145546 ATCTTTCTCTTATTGGTTTCTGG - Intergenic
956910195 3:73808685-73808707 CTCTTTTTCTTCCCAGTTTCAGG + Intergenic
957003231 3:74910904-74910926 CTCTTTTTGTTCCCAGTTTCGGG + Intergenic
957006429 3:74953198-74953220 ATCTTTCTCTTATCAATTTCTGG - Intergenic
957486102 3:80865359-80865381 ATCTCTCTGTTGCTAGTTTAGGG - Intergenic
957651541 3:83012793-83012815 ATCTTTCTGTCACCGTGTTCTGG - Intergenic
958020546 3:87989834-87989856 TTATTTCTGTAACCAGTTACAGG + Intergenic
958848762 3:99296616-99296638 ATATTCCTGTTACTAGTTACTGG - Intergenic
958957949 3:100481517-100481539 ATCTTTGTATTTCCAGTGTCTGG + Intergenic
959367278 3:105477112-105477134 CTCTTTTTCTTTCCAGTTTCAGG + Intronic
959727250 3:109558328-109558350 CTTTTTCTGTTCCCAGTTTCGGG + Intergenic
962162010 3:133010646-133010668 CTCTTTTTATTCCCAGTTTCAGG - Intergenic
962162302 3:133012605-133012627 CTCTTTTTATTCCCAGTTTCGGG - Intergenic
962170627 3:133098111-133098133 CTCTTTTTGTTCCCAGTTTTGGG - Intronic
962351199 3:134657069-134657091 CTCTTTTTCTTCCCAGTTTCAGG - Intronic
962769837 3:138602011-138602033 CTCTTTTTGTTCCCAGTTTTGGG + Intergenic
962912142 3:139862831-139862853 ATATTTCTCTTACCCGTTTTCGG - Intergenic
963229080 3:142891650-142891672 ATCTCTGTGAGACCAGTTTCTGG + Intergenic
963716565 3:148810770-148810792 CTCTTTTTGTTCCTAGTTTCAGG + Intronic
963716861 3:148812697-148812719 CTCTTTCTGTTCCCAGTTTCTGG + Intronic
964426611 3:156560897-156560919 ACCTTTTTGTTCCCAGTTTCAGG + Intergenic
964426876 3:156562805-156562827 CTCTTTTTGTTCCCAGTTTCGGG + Intergenic
964586409 3:158309777-158309799 ATCTTTCTCCTACCAGTTTCTGG + Intronic
964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG + Intronic
964589354 3:158342544-158342566 CTCTTTCTGTTCCCAGTTTCAGG + Intronic
964654711 3:159053108-159053130 CTCTTTTTGTTCCCAGTTTCAGG + Intronic
964734402 3:159901383-159901405 ATCTTTTTTTTTCCAGTTTGAGG - Intergenic
965299986 3:166997022-166997044 ATCTTTTTCTTCCCAGTCTCGGG - Intergenic
966105865 3:176333083-176333105 GTCTTTCTGATACCACCTTCAGG - Intergenic
966299307 3:178461095-178461117 CTCTTTTTCTTACCAGTCTCTGG + Intronic
966639849 3:182177482-182177504 ATCTCTGTTTTACAAGTTTCTGG - Intergenic
966838798 3:184071219-184071241 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
966899716 3:184471863-184471885 ATGTTTCTGTTCCTAGTTTCTGG + Intronic
967245988 3:187487093-187487115 CTCTTTTTGTTCCAAGTTTCAGG + Intergenic
967246119 3:187488237-187488259 CTCTTTTTGTTCACAGTTTCAGG + Intergenic
968318603 3:197745723-197745745 AGTTTTCTGTTAACACTTTCTGG - Intronic
968396929 4:247523-247545 ATATTTCTTTTGCCCGTTTCTGG + Intergenic
968738116 4:2309793-2309815 ATCTATCTGTGACCAGGTTAAGG + Intronic
970322434 4:14888058-14888080 CTCTTTTCGTTCCCAGTTTCAGG - Intergenic
970336507 4:15051005-15051027 TCCTTTCTTATACCAGTTTCTGG + Intronic
970398908 4:15699536-15699558 CTCTTTCTGTTCCCAGTTTCAGG - Intronic
970979136 4:22076030-22076052 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
971793463 4:31198389-31198411 CTCTTTTTCTTCCCAGTTTCAGG - Intergenic
971793765 4:31200532-31200554 ATCTTTTTCTTCCCAGTCTCTGG - Intergenic
971996164 4:33967336-33967358 CTCTTTTTGTTCCCAGTTTTGGG + Intergenic
972035051 4:34509400-34509422 TTATTTCTGTAACCAGTTACAGG + Intergenic
972082159 4:35166350-35166372 CTTATGCTGTTACCAGTTTCTGG - Intergenic
972187666 4:36551224-36551246 TTATTTCTGTAACCAGTTACAGG + Intergenic
973156683 4:46963591-46963613 CTCTTTTTGTTCCCAGTTTCAGG + Intronic
974753399 4:66171231-66171253 CTCTTTTTGTTCCTAGTTTCGGG - Intergenic
974986536 4:69034286-69034308 ATATTTCTCTTACCCGTTTTTGG - Intronic
975091195 4:70406099-70406121 ATCATTCTATCTCCAGTTTCTGG - Intronic
975253815 4:72212027-72212049 CTCTTTTTGTTTCCAGTTCCAGG - Intergenic
975254082 4:72213846-72213868 CTCTTTTTATTCCCAGTTTCAGG - Intergenic
975919791 4:79371449-79371471 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
976051674 4:81017497-81017519 ATCTTTTTCTTCCCAGTCTCAGG - Intergenic
976266275 4:83188373-83188395 CTTTTTATTTTACCAGTTTCTGG + Intergenic
976286268 4:83374475-83374497 TTCTTTTTGTTCCCAGTTTTGGG - Intergenic
976286558 4:83376408-83376430 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
976288181 4:83390282-83390304 ATCTGTCTATTACCAGGTTTGGG - Intergenic
976288721 4:83395886-83395908 CTTTTTCTGTTACCAGATTGTGG + Intergenic
976310335 4:83605421-83605443 AGCTCTTTGTTACCAGTTGCTGG - Exonic
976542020 4:86288950-86288972 ATCTTTCTGTTGCCTATTTAGGG - Intronic
976569126 4:86588406-86588428 ATTTTTCTGTTAACTGTTTGAGG - Intronic
976900930 4:90175085-90175107 CTCGGTTTGTTACCAGTTTCTGG - Intronic
977111363 4:92960079-92960101 ATCTTTCTGTTATGGATTTCTGG + Intronic
977571550 4:98634351-98634373 ATCTCTCTGTGACCAATGTCTGG + Intronic
977769080 4:100835671-100835693 CTCTTTATCTTACCAGTCTCAGG + Intronic
978567864 4:110103162-110103184 CTCTTTTTCTTCCCAGTTTCGGG + Intronic
980287768 4:130803282-130803304 ATCTTTCTGTTACCATCATTGGG + Intergenic
980364692 4:131787064-131787086 ATCTGTCAGCTACCACTTTCAGG + Intergenic
980372045 4:131887628-131887650 ATTTTTCTGTTACCATTTTTTGG + Intergenic
980727733 4:136787025-136787047 CTCTTTTTCTTCCCAGTTTCAGG + Intergenic
981918204 4:150057647-150057669 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
982121363 4:152146510-152146532 CTCTTTTTGTTCTCAGTTTCAGG - Intergenic
982296930 4:153838515-153838537 ATATTTCTGATATCAGTTTGTGG + Intergenic
982482868 4:155933381-155933403 ACCTTTCTCTTCCCAGTCTCGGG + Intronic
982679275 4:158409404-158409426 CTTTTTTTGTTCCCAGTTTCGGG + Intronic
982829674 4:160044128-160044150 CTCTTTTTCTTCCCAGTTTCAGG - Intergenic
982867244 4:160529471-160529493 ATTTTTCTGTTAGCCTTTTCTGG + Intergenic
983229363 4:165113580-165113602 AATTTTCTGTTACCAGCTCCCGG + Intronic
984467482 4:180119073-180119095 TTCTTTTTGTTCCCAGTTTCAGG + Intergenic
984922675 4:184779421-184779443 CTCTTTTTGTTCCCAGTCTCAGG + Intronic
986134459 5:4961236-4961258 ATCTTTCTGTCATCAATTTATGG - Intergenic
987073031 5:14355858-14355880 TTCTTTCTGATACCAGCTTTTGG + Intronic
988294607 5:29339721-29339743 CTATTTATGTTACCAGTTTTGGG + Intergenic
988720226 5:33870023-33870045 ATATTTCTCTTACCAGTTTTTGG + Intronic
988765327 5:34367440-34367462 CTCTTTTTCTTCCCAGTTTCAGG - Intergenic
989472341 5:41834952-41834974 ATATTTCTTTTACTAGTTTTGGG - Intronic
989513939 5:42319916-42319938 ATATTTCTCTTACCTGTTTTTGG + Intergenic
989532441 5:42524010-42524032 CTATTTTTGTTCCCAGTTTCTGG + Intronic
989778219 5:45234061-45234083 CTCTTTTTGTTGCCAGTTTCAGG - Intergenic
989828688 5:45889778-45889800 ATATTTCTCTTACCCGTTTTCGG + Intergenic
989830809 5:45915877-45915899 ACATTTCTCTTACCAGTTTTTGG + Intergenic
989969598 5:50506609-50506631 ATCATTCTGATACCAGAATCTGG + Intergenic
990524468 5:56611131-56611153 CTGTTTTTGTTCCCAGTTTCAGG - Intergenic
990704479 5:58513055-58513077 CTCTTTTTGTTCCCAGTTTGGGG + Intergenic
990792724 5:59499930-59499952 ATCTTTCTGATACCAAAATCTGG + Intronic
991007932 5:61849079-61849101 ATCTTTCAGTTATTGGTTTCTGG - Intergenic
991208342 5:64075772-64075794 ATTTTTCTGAAATCAGTTTCTGG + Intergenic
991340446 5:65602639-65602661 CTCTTTTTGTTCCCAGTTTCGGG - Intronic
991520359 5:67490541-67490563 CTCTTTTTCTTACCAGTCTCAGG - Intergenic
993256029 5:85591310-85591332 CTCTTTTTGTTCCCAGTTCCAGG - Intergenic
993304431 5:86257491-86257513 ATCTTTTTCTTCCCAGTATCAGG - Intergenic
994138407 5:96315510-96315532 CTCTTTCTGATCTCAGTTTCTGG - Intergenic
995312806 5:110732417-110732439 CTCTTTTTGTTCCCAGTTTTGGG - Intronic
995969731 5:117953515-117953537 CTCTTTCTGTTCTCAGTTTCGGG + Intergenic
996519633 5:124412807-124412829 CTCTTTTTCTTGCCAGTTTCAGG - Intergenic
996643439 5:125786635-125786657 GTCTGTCTCTTTCCAGTTTCAGG + Intergenic
997091971 5:130869012-130869034 CTCTTTTTGTTCCCAGTTTTGGG - Intergenic
997469093 5:134106865-134106887 ATCTTTCTCCTTCCAGTTCCTGG + Intergenic
997788381 5:136734549-136734571 ATAGTTCTGATACCAGTTCCTGG + Intergenic
998320294 5:141224052-141224074 ATCTTTCTGTCACTACTGTCGGG - Exonic
998576772 5:143325173-143325195 CTCTTTTTGTTCCCAGTTTTGGG - Intronic
998604591 5:143620981-143621003 ATCTTTCTGTTCCCAGGACCTGG + Intergenic
998788611 5:145742427-145742449 GTCTTTCTGTTATCGATTTCTGG - Intronic
999423169 5:151462750-151462772 ATCTTTCTGTTACAGGGTTTGGG + Intronic
999804724 5:155071105-155071127 CACTTTTTGTTCCCAGTTTCAGG - Intergenic
1000357093 5:160409057-160409079 ATCTTTCTGTTACCATTTTGTGG - Intronic
1000364912 5:160481605-160481627 TTATTTCTGTAACCAGTTACAGG + Intergenic
1000774907 5:165407381-165407403 TTCTTTTTGTTCCCAGTTTTGGG + Intergenic
1000900414 5:166905390-166905412 ATGTTTCTGTCACCTTTTTCTGG - Intergenic
1001945862 5:175777484-175777506 AACTTTTTGTTACCAGTATGAGG - Intergenic
1002008924 5:176260900-176260922 TTCTTCCTGTCACCAGCTTCTGG - Intronic
1002051043 5:176571458-176571480 ATATTGCTGTAACCAGTTTGTGG - Intronic
1002217800 5:177651372-177651394 TTCTTCCTGTCACCAGCTTCTGG + Intergenic
1003299521 6:4864803-4864825 CTCTTTTTGTTCTCAGTTTCAGG + Intronic
1003802055 6:9681059-9681081 ATATTTCTCTTACCTGTTTTCGG + Intronic
1003941740 6:11035125-11035147 ATATTTGTGTTACTACTTTCTGG + Intronic
1004296324 6:14415097-14415119 ATGTTTATGTTAATAGTTTCAGG + Intergenic
1006016118 6:31082240-31082262 ATCTTTCTGTAACCAGGTAAAGG - Intergenic
1007969237 6:46034070-46034092 TTCTTCCTGTTACCAGTGTCTGG + Intronic
1008499712 6:52169122-52169144 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1008697543 6:54057994-54058016 AGCTTTCTGTTTAAAGTTTCAGG - Intronic
1008835583 6:55823546-55823568 ATCTTTCGATTACAAGTTTTGGG - Intronic
1009039056 6:58155833-58155855 ATATTTCTCTTACCCGTTTTTGG - Intergenic
1009214950 6:60910672-60910694 ATATTTCTCTTACCCGTTTTCGG - Intergenic
1009824205 6:68845761-68845783 TTCTTTTTGTTCCCAGTTTCAGG + Intronic
1010636205 6:78261629-78261651 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1010902288 6:81442332-81442354 TTATTTCTGTAACCAGTTACAGG - Intergenic
1011586498 6:88932057-88932079 ATATTTCTCTTACCTGTTTTTGG - Intronic
1011762969 6:90587861-90587883 ATATTTTTGTCACCATTTTCAGG + Intergenic
1012124278 6:95407876-95407898 ATTTTTATGTTAATAGTTTCAGG - Intergenic
1012826480 6:104152536-104152558 CTCTTTTTGTTACCAGTTTCAGG - Intergenic
1012920303 6:105215691-105215713 ATCTGTCTGTTTCCAGTCTTCGG + Intergenic
1014576508 6:123081170-123081192 ATTTTTCTGTTCCCAATTTTGGG - Intergenic
1014863081 6:126495606-126495628 ATGTTTTTCTTCCCAGTTTCGGG - Intergenic
1014863363 6:126497519-126497541 CTCTTTTTCTTCCCAGTTTCAGG - Intergenic
1015044370 6:128760562-128760584 CTCTTTTTGTTCCCAGTTTTGGG + Intergenic
1015249131 6:131108241-131108263 CTCTTTCTGTTCCCAGTTTCAGG - Intergenic
1015391503 6:132687364-132687386 TTCTTGTTGTTAACAGTTTCCGG - Intronic
1016176466 6:141082430-141082452 TTCTTTTTGTTCACAGTTTCAGG + Intergenic
1016202685 6:141431183-141431205 CTCTTTTTGTTCCCAGTTTTGGG - Intergenic
1016332738 6:142970949-142970971 CTCTTTTTGTTCCCAGTTTTGGG - Intergenic
1016460224 6:144274017-144274039 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1016949157 6:149563746-149563768 TTGTATCTGTTTCCAGTTTCTGG - Intergenic
1017423999 6:154302204-154302226 ATGTTTCTGTTACTGGATTCAGG - Intronic
1018059874 6:160081764-160081786 ATATTTCTCTTACCCGTTTTCGG + Intronic
1018867030 6:167754240-167754262 CTCTTTTTCTTCCCAGTTTCAGG - Intergenic
1019002867 6:168770143-168770165 ATATTTCTCTTACCTGTTTTCGG + Intergenic
1019021408 6:168921596-168921618 ATCTTTTTGTTATTAATTTCTGG + Intergenic
1020479465 7:8639905-8639927 GTCTTTTTGTTCTCAGTTTCAGG + Intronic
1020600087 7:10263641-10263663 ATCTTTATGTTACCTGTAGCAGG + Intergenic
1020764109 7:12299648-12299670 ATCTTTTTCTTCCCAGTCTCGGG + Intergenic
1021044474 7:15905877-15905899 CCCTTTCTGTTACAAGATTCTGG - Intergenic
1021216077 7:17916823-17916845 ATCATCCTGATACCAATTTCTGG + Intronic
1021271510 7:18592665-18592687 ATCTGTCTGTTACCTGTTTTGGG - Intronic
1021558159 7:21942826-21942848 TCCTTTCTGTGACCAGCTTCTGG + Intronic
1021834625 7:24657150-24657172 ATTTTTTTGTTACCAGTATGGGG + Intronic
1021985024 7:26089805-26089827 CTCTTTTTATTCCCAGTTTCAGG + Intergenic
1022400795 7:30035309-30035331 AGCTTACTGTTAGCAGTTTCTGG + Intronic
1022404690 7:30077585-30077607 ATCTTTCACATACCAGTTTGAGG - Intronic
1022549589 7:31226464-31226486 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1022549877 7:31228395-31228417 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1023668830 7:42554991-42555013 ATATTTCTCTTACCTGTTTTCGG - Intergenic
1024097800 7:45998723-45998745 ATCCTTCTGTTACTGGTTTCTGG - Intergenic
1024289955 7:47795460-47795482 TTCTTTTTGTTCCCAGTTTTGGG + Intronic
1024363594 7:48495354-48495376 GTCTTTCTGTTACTGATTTCTGG + Intronic
1024712199 7:52028624-52028646 AGCTTTCTTTTACAACTTTCAGG - Intergenic
1024916456 7:54505118-54505140 ATCTTTCTGTTATTGGTTTCTGG + Intergenic
1024930557 7:54663726-54663748 CTCTTTCTTCTTCCAGTTTCTGG - Intergenic
1024946103 7:54808949-54808971 ATATTTCTCTTACCCGTTTTTGG - Intergenic
1026496568 7:70908677-70908699 TTATTTCTGTAACCAGTTACAGG - Intergenic
1026886845 7:73954820-73954842 ATCTTTCTGATAAAAATTTCAGG + Intergenic
1027807462 7:82847102-82847124 ATCTTTCTGTTTCCATTTTTTGG - Intronic
1028041015 7:86054657-86054679 ATCATTCTGTTACCAAAATCTGG - Intergenic
1028837681 7:95393507-95393529 ATTTTTCTGTTAGCAATGTCAGG + Intronic
1028942329 7:96536242-96536264 ATCTTTCTGTTACCGGTTTCTGG + Intronic
1030094147 7:105882815-105882837 CTCTTTTTGTTCCCAGTTTTGGG + Intronic
1030238473 7:107292971-107292993 TTATTTCTGTAACCAGTTGCAGG - Intronic
1030734771 7:113034646-113034668 ATCTTTGTGTTGCCAGTATCTGG - Intergenic
1031145610 7:117994220-117994242 TTTTTTTTGTTCCCAGTTTCAGG + Intergenic
1031145894 7:117996153-117996175 CTTTTTTTGTTCCCAGTTTCGGG + Intergenic
1031658254 7:124385663-124385685 AACTTTTTGTTCCCAGTTTCAGG + Intergenic
1032318162 7:130860313-130860335 CTCTGTTTGTTACCAGTTTTGGG + Intergenic
1032633690 7:133682520-133682542 CTCTTTTTGTTCCCAGTTTTGGG + Intronic
1032697909 7:134353596-134353618 AACTTTCTGTCACTCGTTTCAGG + Intergenic
1033456211 7:141506337-141506359 TTCTTTTTGTTACCAGTTTTGGG - Intergenic
1033456539 7:141508574-141508596 ACCTTTTTGTTACCAGTTTTGGG - Intergenic
1033677109 7:143553528-143553550 ATATTTCTCTTACCCGTTTTTGG + Intergenic
1033694726 7:143775909-143775931 ATATTTCTCTTACCCGTTTTTGG - Intergenic
1033834986 7:145299787-145299809 TTCTTTTTGTTCCCAGTCTCAGG - Intergenic
1034622873 7:152469841-152469863 CTCTTTCTGTTCCTAGTTTCTGG + Intergenic
1034687649 7:152987289-152987311 CTCTTTTTCTTCCCAGTTTCAGG - Intergenic
1035572876 8:685238-685260 ATATTTCTCTTACCCGTTTTCGG + Intronic
1036098500 8:5751636-5751658 CTCTTTTTGTTCCCAGTTTCAGG - Intergenic
1036214292 8:6866209-6866231 TTATTTCTGTAACCAGTTACAGG + Intergenic
1036383942 8:8261517-8261539 ATCTTTTTCTTCCCAGTCTCAGG - Intergenic
1037167224 8:15845879-15845901 ATCTTTTTCTTTCCAGTCTCAGG - Intergenic
1037747355 8:21657071-21657093 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1038467035 8:27773808-27773830 ATCTTTGTGTCACCAGCTCCTGG - Intronic
1038752835 8:30312862-30312884 CTCTTCTTGTTACCAGTTTCAGG + Intergenic
1039048971 8:33475693-33475715 ATCATTCAGTTACTGGTTTCTGG - Intronic
1039111412 8:34044158-34044180 ATATTTCTCTTACCTGTTTTTGG + Intergenic
1040864262 8:52032310-52032332 ACCTTCCTGTTTCCAGTTTTAGG - Intergenic
1041087909 8:54273699-54273721 ATACTTCTGTTACCAGTTAGAGG - Intergenic
1042220657 8:66470331-66470353 ATCTTTGTATTAACAGTTTTTGG - Intronic
1042382812 8:68137699-68137721 ATCTTTCTGGTACTAGCTTCTGG - Intronic
1042412402 8:68480367-68480389 CTCTTTTTGTTCCCAGTTTTGGG + Intronic
1042412681 8:68482289-68482311 CTCTTTTTGTTCCCAGTTTCAGG + Intronic
1042517873 8:69678590-69678612 TTATTTCTGTAACCAGTTACAGG - Intronic
1042735570 8:71984187-71984209 GTTTTGCTGTTACCAGTTGCTGG - Intronic
1043141347 8:76593717-76593739 CTCTTTTTGTTCTCAGTTTCGGG + Intergenic
1043272054 8:78346860-78346882 GTCTTTCTGTTACTGATTTCTGG - Intergenic
1043735654 8:83739848-83739870 TTCTTTCTTCTTCCAGTTTCTGG + Intergenic
1043825429 8:84923044-84923066 TTCTCTGTGTTACCAGTTCCTGG + Intergenic
1044170325 8:89043443-89043465 ATATTTCTCTTACCCGTTTTTGG - Intergenic
1044182629 8:89214954-89214976 ATCTTTTTCTTCCCAGTCTCAGG - Intergenic
1044250555 8:90000503-90000525 TTATTTCTGTAACCAGTTACAGG + Intronic
1044260297 8:90111915-90111937 ATCTTTGTGTTTGCATTTTCAGG + Intergenic
1044784757 8:95782071-95782093 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1045522358 8:102914285-102914307 CTCTTTCTGTTTCTAGTTTATGG + Intronic
1045772049 8:105753759-105753781 ATATTTTTGTTACCACTTTGTGG - Intronic
1045919605 8:107513898-107513920 ATCTTTCTGTCTCCCGTTTTTGG - Intergenic
1045993923 8:108341219-108341241 CTCTTTTTCTTCCCAGTTTCGGG - Intronic
1046187830 8:110746378-110746400 ATATTTCTCTTACCCGTTTTTGG - Intergenic
1046231396 8:111363718-111363740 CTCTTTTTCTTCCCAGTTTCAGG - Intergenic
1046385307 8:113501433-113501455 TTATTTCTGTAACCAGTTACAGG + Intergenic
1046536575 8:115521144-115521166 ATGTTTGTGTTACTATTTTCTGG + Intronic
1046656221 8:116898341-116898363 CTCTTTTTGTTTCCAGTTTTGGG + Intergenic
1046656505 8:116900272-116900294 CTCTTTTTGTTTCCAGTTTCGGG + Intergenic
1047159981 8:122367358-122367380 CTCTTTCTGTTCCCAGTTTTGGG - Intergenic
1047286511 8:123491889-123491911 CTCTTTTTCTTACCAGTCTCAGG + Intergenic
1047548860 8:125847957-125847979 ATTTTTCTGATACCAGATTTTGG + Intergenic
1047580386 8:126207909-126207931 ATTTTTCTGTTACCAAGTTTAGG - Intergenic
1047623833 8:126635389-126635411 TTCTTTCTGTCTCCATTTTCTGG + Intergenic
1047941281 8:129829808-129829830 ATCTTTTTCTTCCCAGTCTCGGG - Intergenic
1048091678 8:131247892-131247914 TTCTTTTTGTTCCTAGTTTCAGG + Intergenic
1048699908 8:137077211-137077233 ATATTTTTGTTCCCAGTCTCAGG + Intergenic
1049537252 8:143188137-143188159 ATCTTGCTGTTCCAAGTCTCAGG + Intergenic
1050458911 9:5860414-5860436 ATCTTTATGTCTCCAGTGTCTGG + Intergenic
1050911091 9:11072173-11072195 ATCTTTCTGTTCCCTGTTATTGG + Intergenic
1051489969 9:17651598-17651620 ATCTTTGTTTTAGCAGTTTGTGG + Intronic
1051831678 9:21285925-21285947 AACTATCTGATACCAGTGTCAGG - Intergenic
1051902790 9:22060693-22060715 CTCTTTTTGTTCCTAGTTTCAGG - Intergenic
1052351600 9:27464675-27464697 CTCTTTTTGTTCCCATTTTCAGG - Intronic
1053636748 9:40015185-40015207 ATTTTTCTGTTACCATTTTTTGG + Intergenic
1053769241 9:41449429-41449451 ATTTTTCTGTTACCATTTTTTGG - Intergenic
1054317617 9:63612266-63612288 ATTTTTCTGTTACCATTTTTTGG + Intergenic
1054547911 9:66360930-66360952 ATTTTTCTGTTACCATTTTTTGG - Intergenic
1054747678 9:68871229-68871251 AGGATTCTGTTACAAGTTTCAGG - Intronic
1054753562 9:68933615-68933637 ATCTTTCTATTCTCAGTTTCTGG + Intronic
1054923279 9:70563095-70563117 ATGTTTCTGTTTCCACTTTTTGG + Intronic
1055878627 9:80971804-80971826 CTCTTTTTGTTCCCAGGTTCAGG + Intergenic
1055912601 9:81369410-81369432 ATCCTTCCGTAACCAGCTTCTGG + Intergenic
1056087446 9:83165332-83165354 GTCTTTCTGTTATTAATTTCTGG - Intergenic
1056255235 9:84792368-84792390 AGCTTTCTGATGTCAGTTTCAGG + Intronic
1056786238 9:89594469-89594491 CCCTTTCTGTCACCAGTTGCTGG + Intergenic
1057317980 9:93982934-93982956 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1058076411 9:100656335-100656357 CTTTTTTTGTTCCCAGTTTCAGG + Intergenic
1058253287 9:102729285-102729307 ATATTTCTCTTACCTGTTTTCGG + Intergenic
1058325674 9:103694479-103694501 ATCATTCTGTTTCTAGTTACAGG - Intergenic
1058370589 9:104262059-104262081 ATCTTTCTGGTTCCTATTTCAGG + Intergenic
1058549032 9:106093569-106093591 ATATTTCTCTTACCCGTTTTTGG - Intergenic
1058881273 9:109287907-109287929 GTCTTTCTGTGGCCAGCTTCGGG + Intronic
1058956530 9:109953881-109953903 ATCTTTTTGTCTCCAGTCTCAGG - Intronic
1062616615 9:137399634-137399656 CTCTTTTTGTTCCCAGTTTCAGG - Intronic
1062708443 9:137958042-137958064 CTCTATCTGGTACCAGATTCTGG + Intronic
1186081098 X:5932776-5932798 CTCTTTCTGTTACCTGATCCTGG - Intronic
1186248853 X:7644688-7644710 CTCTTTTTGCTTCCAGTTTCGGG - Intergenic
1186593082 X:10952298-10952320 ATGTTTTTATTCCCAGTTTCTGG - Intergenic
1186598173 X:11007121-11007143 ATATTTCTCTTACCTGTTTTCGG - Intergenic
1186822160 X:13300567-13300589 ATCTTGTTGTTTCCAGTTTTGGG + Intergenic
1187132137 X:16513141-16513163 TTATTTCTGTAACCAGTTACAGG - Intergenic
1188428151 X:30073532-30073554 CTCTTTGTGTTCCCAGTTTTAGG - Intergenic
1188562104 X:31480775-31480797 AACTTTGTATTTCCAGTTTCAGG - Intronic
1188984877 X:36760276-36760298 ATCTGTCTATTACCAGGTTTTGG + Intergenic
1189073581 X:37890481-37890503 TTATTTCTGTAACCAGTTACAGG - Intronic
1189228898 X:39436600-39436622 CTTTTTTTGTTCCCAGTTTCGGG - Intergenic
1189371454 X:40432546-40432568 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1189403243 X:40691971-40691993 ATCTCTCTGATTCCAGATTCTGG - Intronic
1190152823 X:47962352-47962374 ATATTTCTCTTACCCGTTTTTGG + Intronic
1190390355 X:49925149-49925171 ATTTTTCTGTTTACATTTTCAGG + Exonic
1190883972 X:54514333-54514355 CTCTTTTTCTTCCCAGTTTCAGG + Intergenic
1191856289 X:65629546-65629568 CTCTTTCTCTTCCCAGTCTCGGG - Intronic
1192142250 X:68655685-68655707 AGCTTTCTGGGACCAGTTTTTGG + Intronic
1192954408 X:76053198-76053220 TTCTTTTTGTTCCTAGTTTCAGG - Intergenic
1193315172 X:80056510-80056532 ATCTGTCTGTTTTCAGTTCCTGG + Intergenic
1193346867 X:80413731-80413753 CTCATTTTGTTCCCAGTTTCGGG + Intronic
1193417831 X:81245693-81245715 TTCTGTCTGTTACCATTTTATGG + Intronic
1193797108 X:85890679-85890701 CTCTTTTTCTTTCCAGTTTCGGG + Intronic
1193938344 X:87650768-87650790 ATCTTTTTCTTCCCAGTCTCAGG - Intronic
1194209773 X:91058024-91058046 ATTTTTCTTTTTCTAGTTTCTGG - Intergenic
1194226227 X:91262014-91262036 ATCATTCTGTTACCAAAATCTGG - Intergenic
1194264683 X:91739546-91739568 TTCTTTTTGTTACCAGTTTCAGG + Intergenic
1194310337 X:92298802-92298824 TTATTTCTGTAACCAGTTACAGG + Intronic
1194394859 X:93370506-93370528 TTCTTTCTGTTACCTTTTTAAGG + Intergenic
1195087707 X:101428113-101428135 ATTTGTCTGTTTCCAGTTTGGGG - Intronic
1195133904 X:101884177-101884199 ATCTTTCTGAAACAAGTTTTTGG + Exonic
1195209924 X:102645127-102645149 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1195551525 X:106176691-106176713 ATTTTTTTGTTTCCAATTTCAGG + Intronic
1195880598 X:109588893-109588915 CTCTTTCTATTCCCAGTCTCAGG + Intergenic
1196545407 X:116958611-116958633 CTCTTTTTGTTCCCAGTTTCAGG + Intergenic
1197160691 X:123318882-123318904 GTCTTTTTGTTCCCACTTTCGGG - Intronic
1197336293 X:125213092-125213114 CTTTTTTTGTTCCCAGTTTCCGG - Intergenic
1197400216 X:125980347-125980369 CTCTTTTTGTTACCAGTTTTGGG - Intergenic
1197547181 X:127839274-127839296 CTTTTTTTGTTCCCAGTTTCGGG - Intergenic
1197859532 X:130955694-130955716 ATCTTTCTGTTACTGATTTCTGG + Intergenic
1198475930 X:136998450-136998472 CTCTTTTTGTTCCCAGTTTTGGG - Intergenic
1198569051 X:137935527-137935549 CTCTTTTTGTTCCCAGTCTCGGG + Intergenic
1198707488 X:139464244-139464266 CTCTTTTTGTTTCCAGTTTCAGG + Intergenic
1198734777 X:139773261-139773283 CTCTTTTTGTTCCCAGTTTCGGG + Intronic
1199113395 X:143960356-143960378 CTCTTTTTGTTCCTAGTTTCTGG - Intergenic
1199315939 X:146378126-146378148 TTTTTTCTGTAACTAGTTTCTGG + Intergenic
1199362738 X:146942405-146942427 CTCTTTTTGTTCCCAGTTTCGGG - Intergenic
1200618626 Y:5413088-5413110 TTATTTCTGTAACCAGTTACAGG + Intronic
1200878397 Y:8184260-8184282 ATACTTCTCTTACCCGTTTCCGG + Intergenic
1201307870 Y:12566565-12566587 ATCTTTCTGTGATGAATTTCTGG + Intergenic
1201343038 Y:12954363-12954385 ATATTTCTCTTACCTGTTTTTGG + Intergenic
1201400765 Y:13601722-13601744 TTCTCTCTGTTACAAATTTCTGG - Intergenic
1201665944 Y:16454218-16454240 ATCTTTCTTTTCACAGATTCTGG + Intergenic
1202074348 Y:21023319-21023341 ATCTTGCTGTTACCAGGCTTTGG - Intergenic