ID: 926266308

View in Genome Browser
Species Human (GRCh38)
Location 2:11325199-11325221
Sequence GGTAGTGGATGTGCAACTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 95}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926266308_926266318 28 Left 926266308 2:11325199-11325221 CCGTGAGTTGCACATCCACTACC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 926266318 2:11325250-11325272 GTTCTGGCAGGGCCAACTGTGGG 0: 1
1: 0
2: 2
3: 11
4: 113
926266308_926266313 6 Left 926266308 2:11325199-11325221 CCGTGAGTTGCACATCCACTACC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 926266313 2:11325228-11325250 AAGGCTACTTTTTGTGTATGTGG 0: 1
1: 0
2: 1
3: 16
4: 229
926266308_926266317 27 Left 926266308 2:11325199-11325221 CCGTGAGTTGCACATCCACTACC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 926266317 2:11325249-11325271 GGTTCTGGCAGGGCCAACTGTGG 0: 1
1: 0
2: 1
3: 26
4: 186
926266308_926266315 16 Left 926266308 2:11325199-11325221 CCGTGAGTTGCACATCCACTACC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 926266315 2:11325238-11325260 TTTGTGTATGTGGTTCTGGCAGG 0: 1
1: 0
2: 0
3: 33
4: 460
926266308_926266314 12 Left 926266308 2:11325199-11325221 CCGTGAGTTGCACATCCACTACC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 926266314 2:11325234-11325256 ACTTTTTGTGTATGTGGTTCTGG 0: 1
1: 0
2: 1
3: 29
4: 332
926266308_926266316 17 Left 926266308 2:11325199-11325221 CCGTGAGTTGCACATCCACTACC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 926266316 2:11325239-11325261 TTGTGTATGTGGTTCTGGCAGGG 0: 1
1: 0
2: 2
3: 28
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926266308 Original CRISPR GGTAGTGGATGTGCAACTCA CGG (reversed) Intronic
902337243 1:15760647-15760669 GGCAGAGAATGTGCAGCTCAGGG - Intronic
903500708 1:23798813-23798835 GGTGGTGGAGGTGGAACCCAGGG + Intronic
903906216 1:26688895-26688917 AGAAGAGCATGTGCAACTCAAGG + Intergenic
904294409 1:29508604-29508626 GGAAGTGGAGGTTCAGCTCATGG - Intergenic
904942016 1:34170592-34170614 GCTGGTGGATGGGCAACTCTAGG + Intronic
912627700 1:111219970-111219992 GGTAGAGGATGTGAAACTCAGGG + Intronic
916319438 1:163487084-163487106 TGGAGAGGATGAGCAACTCAGGG + Intergenic
918917031 1:190655530-190655552 GGTAGTGGATATTTAACTAATGG - Intergenic
1065813517 10:29463971-29463993 GATAATGCATGTGCCACTCAAGG + Intronic
1065958132 10:30711007-30711029 GATAATGCATGTGCCACTCAAGG - Intergenic
1067492727 10:46727195-46727217 AGGAATGGATGTGTAACTCAAGG - Intergenic
1067601939 10:47613200-47613222 AGGAATGGATGTGTAACTCAAGG + Intergenic
1069595913 10:69670077-69670099 GGTATTGGATGGGCAAATAATGG + Intergenic
1074370307 10:112895307-112895329 GCTAGAAGATGTGCAACTTAGGG + Intergenic
1075857213 10:125639893-125639915 GGGATTGGATATGCCACTCATGG + Intronic
1081109555 11:39118064-39118086 GGTAGTAAACGTGCAAATCATGG - Intergenic
1088184006 11:107143297-107143319 GGTAGGGTGTGTGCAATTCACGG - Intergenic
1099923532 12:88988415-88988437 GGTACTGCAGGTGAAACTCATGG - Intergenic
1100967412 12:100027976-100027998 GGTTGTGGATATGGAACTCGTGG - Intergenic
1102145087 12:110649214-110649236 GGGAGTGGATGGGCAGCTCTTGG + Exonic
1110707393 13:78610335-78610357 TGAAGTGGAGCTGCAACTCAAGG + Intergenic
1111445351 13:88339926-88339948 GTTAGTGAAGGTGCAACTCCTGG - Intergenic
1117074678 14:52090163-52090185 GGCAGTGGTGGTGCAGCTCATGG - Intergenic
1119893450 14:78200337-78200359 GGTTGTGAATGTGCAACTTGGGG + Intergenic
1127898387 15:63322612-63322634 GCCAGTGGATGTGGAATTCAGGG + Exonic
1129181877 15:73882849-73882871 GGTCATGGAAGTGCAAGTCAAGG - Intronic
1129971252 15:79779976-79779998 GTGAGTGAATGTGCAACTCAAGG + Intergenic
1135660199 16:24289727-24289749 GGTAGTGGATCTGCAAATCCAGG - Intronic
1138534791 16:57654103-57654125 GGGAGTGGATGTGCAGGTCCTGG - Exonic
1139645235 16:68324578-68324600 GGCAGTGGCAGTGCAAGTCAGGG - Intronic
1140909703 16:79440118-79440140 GGTGGTAGTGGTGCAACTCAAGG - Intergenic
1142468671 17:149906-149928 GGTGATGGATGTACAACTCTGGG - Intronic
1143745598 17:8991872-8991894 GACAGTGGAGGTGCAACTCTTGG + Intergenic
1144443259 17:15303275-15303297 GGCAGTGGGTGTTCAACTCCAGG + Intergenic
1145243089 17:21251070-21251092 GGGAGTGGCTGTGCAGCACAGGG - Intronic
1148435270 17:47679325-47679347 GGTAGGGGACCTGCCACTCATGG - Intronic
1156758667 18:40559739-40559761 GGCAGATGATGTTCAACTCATGG + Intergenic
1158350338 18:56558748-56558770 AGTAGTGGATGTGTTACTGAAGG - Intergenic
1161702017 19:5800816-5800838 CGTGGTGGTTGTGAAACTCAGGG - Intergenic
1161749888 19:6087975-6087997 GGAAGTGGGTGTGCAGCTTATGG - Intronic
1168411589 19:56143539-56143561 GGCTGTGGATGTGCAAGTCCAGG + Intronic
926266308 2:11325199-11325221 GGTAGTGGATGTGCAACTCACGG - Intronic
928234259 2:29526222-29526244 GGTAGTAATTGTGCCACTCACGG - Intronic
935577430 2:104725389-104725411 GGTTCTGGATGGTCAACTCAGGG - Intergenic
937717388 2:125048642-125048664 GGTAGCGGGGGTGCAACTGAGGG + Intergenic
940233499 2:151484138-151484160 ATTTGTGGATGTGGAACTCAAGG + Intronic
943175459 2:184467379-184467401 TGTAGTGGATATGAATCTCAAGG - Intergenic
944595723 2:201258784-201258806 GGAAGGGGCTGTGCACCTCAGGG - Intronic
1174700471 20:52603344-52603366 GGTGATAGATGTGCAACACAGGG - Intergenic
1176428752 21:6563775-6563797 GGTAGCGGCGGTGGAACTCACGG - Intergenic
1177223998 21:18230076-18230098 GGTTGTAGTTGTGGAACTCAGGG + Intronic
1179704242 21:43172091-43172113 GGTAGCGGCGGTGGAACTCACGG - Exonic
1180139019 21:45880180-45880202 GCTGGTGGATTTGCAAGTCACGG + Intronic
1182808700 22:33097444-33097466 GGTGTTGGATGTGCACCTTACGG - Intergenic
1184212533 22:43044266-43044288 GGTAGTGGCTGTGAACTTCAGGG - Intronic
951800414 3:26589669-26589691 GGTAGTGTATGTGAGTCTCAAGG - Intergenic
952711844 3:36439543-36439565 GTCATGGGATGTGCAACTCAGGG - Intronic
954760953 3:52873483-52873505 GGAAGTGGATTTGCAATTCTCGG + Intronic
955343473 3:58143573-58143595 TGTATTTGATGTGCATCTCATGG - Exonic
956367938 3:68525059-68525081 CGTAGGGGATGTGCAGCTCAAGG + Intronic
958759726 3:98292440-98292462 GGGAGTGAATGTGCAACCCTGGG - Intergenic
959109945 3:102111129-102111151 GGTTGTGGATGTGGAACCCGTGG + Intronic
960036655 3:113109181-113109203 GGTAATGGAGGTGCATGTCAAGG - Intergenic
962261448 3:133911154-133911176 GATGGTGGATGAGCATCTCAAGG - Intergenic
966332841 3:178834288-178834310 GTTAGTGAATGTGTAACTCTGGG - Intronic
970854234 4:20634910-20634932 GGGAGTGGATGTGGAAATAAGGG + Intergenic
986580002 5:9255915-9255937 GGTAGTGTATGGGCAACACTAGG - Intronic
988942335 5:36159078-36159100 GGTAATGGATGTGCAAATCTGGG + Intronic
991530472 5:67608544-67608566 GGTAGTAGATGTCCTACTAAAGG + Intergenic
991567076 5:68016248-68016270 GGTAGTGGAACTGTAAATCAAGG + Intergenic
992219191 5:74555200-74555222 TGTAGTGGATGTGCAGCACAAGG - Intergenic
993912726 5:93704107-93704129 GCTAGGGGATGTGCATCTGAGGG + Intronic
997151593 5:131501823-131501845 AGTAGTGGAATTGTAACTCATGG + Intronic
1005342695 6:24858202-24858224 GGTAGACCATGTGGAACTCAAGG + Intronic
1008178071 6:48292724-48292746 GGTAGTTGACTTGCAACTGACGG + Intergenic
1011895923 6:92225032-92225054 GATAGTGGTTCTGAAACTCATGG - Intergenic
1011995994 6:93589056-93589078 GGTAATGCATCTGCAACCCAAGG - Intergenic
1012678488 6:102148225-102148247 GGTGGTGGATCTGGAATTCAAGG - Intergenic
1013887394 6:114986885-114986907 TATAGTGGATGTGAAACTCAAGG - Intergenic
1014891102 6:126847327-126847349 GTTATTGTATCTGCAACTCATGG + Intergenic
1016075018 6:139785687-139785709 GTTAGTGAATGTGCAACACCAGG - Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1020778604 7:12489893-12489915 GCTAGTGGATGTACATTTCATGG + Intergenic
1020925998 7:14325361-14325383 GATGGTAGATGTGCAACTGAAGG + Intronic
1022847591 7:34226532-34226554 AGTAGGATATGTGCAACTCAGGG + Intergenic
1023905549 7:44519383-44519405 GGGAGTGGATGTGTCAGTCAGGG - Intronic
1028585073 7:92444627-92444649 GTTTGTGGATGTGGAACCCATGG - Intergenic
1031116992 7:117679744-117679766 GTAAGTGGATGGGAAACTCAAGG + Intronic
1033792598 7:144809293-144809315 AGTTGCTGATGTGCAACTCAGGG + Intronic
1037113327 8:15193049-15193071 GGTAGTGGAGGTGGAAATGAGGG + Intronic
1039253568 8:35693335-35693357 AGTAGTGGATGGGCAACTAAGGG - Intronic
1044086009 8:87942902-87942924 GGTTGTGGATGATGAACTCAAGG - Intergenic
1044369387 8:91390728-91390750 GGTTGTGTCTGTGCAGCTCAGGG + Intronic
1046078337 8:109338681-109338703 GGCAGTGTATATGCAACTAATGG - Intronic
1047072943 8:121367788-121367810 GGTAGTGGATATAAAACTAAAGG - Intergenic
1047650402 8:126914195-126914217 TGGAGTGGATATGTAACTCAAGG + Intergenic
1049364045 8:142227854-142227876 GATAATGGATGTACAACACATGG + Intronic
1050274440 9:3982166-3982188 GGTAGAGGAAGGGCAAATCATGG - Intronic
1052845119 9:33328780-33328802 GGAAGTGGTTGTGGCACTCAAGG + Intronic
1055647524 9:78375176-78375198 GGTGGGTGATGTGCATCTCATGG + Intergenic
1195038282 X:100990184-100990206 GGCAGAGGATGGGCACCTCATGG + Intronic
1195666344 X:107434479-107434501 GGTACTTGATGACCAACTCAGGG - Intergenic
1197260244 X:124309529-124309551 CGTAGAGGATGTTCAACTAATGG - Intronic
1199478510 X:148273064-148273086 GTGAGTGAATGTGCAACCCAGGG + Intergenic