ID: 926266593

View in Genome Browser
Species Human (GRCh38)
Location 2:11327972-11327994
Sequence GAGCAATCCAGGTACACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926266593 Original CRISPR GAGCAATCCAGGTACACACA AGG Intronic
901987921 1:13090985-13091007 AAGAAATCCAAGAACACACATGG + Intergenic
901993891 1:13135782-13135804 AAGAAATCCAAGAACACACATGG - Intergenic
902722223 1:18311531-18311553 GAACAATCCAGGTAAAGAAATGG - Intronic
907861793 1:58361114-58361136 CAGCAATCGTGGTACACACCAGG - Intronic
910058297 1:83058412-83058434 TAGGAATTCAGGTTCACACATGG - Intergenic
914452962 1:147809557-147809579 GAGAAGTCCAATTACACACAGGG + Intergenic
915054341 1:153112408-153112430 AAGCCATCCAGGGATACACAGGG - Exonic
915056769 1:153140384-153140406 AAGCCATCCAGGGATACACAGGG - Intergenic
1063446812 10:6123621-6123643 CAGCAAGCCAGGGACCCACAGGG - Intergenic
1063598126 10:7455928-7455950 GAACAATCCAGGTGAACACATGG + Intergenic
1069291097 10:66780543-66780565 GAGAAAGCCAGGTCAACACAAGG + Intronic
1072155418 10:92719161-92719183 GAGCAAGCCATATAAACACAGGG - Intergenic
1074622666 10:115142345-115142367 GAGCAAGCCAGGTGTACATAAGG + Intronic
1077061818 11:620873-620895 GAGCAAACCCTGAACACACAGGG - Intronic
1078108286 11:8372359-8372381 GAGCCAGCCAGGTAGAAACATGG - Intergenic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1084332749 11:68439483-68439505 GAGCACGCCAGGAACAGACAGGG - Intronic
1087266218 11:96064235-96064257 GATCCATCCAGGAACACAGATGG - Intronic
1090015904 11:123086381-123086403 GAGCATTCCAGCTACACAGAAGG + Intronic
1090868036 11:130719368-130719390 CAGCATTCCAGGCAAACACAGGG + Intergenic
1094065880 12:26360154-26360176 TAGCAGTCCAGATACACAAATGG - Intronic
1095212435 12:39509809-39509831 CAGCCCTCCAGGTAGACACAAGG - Intergenic
1098178812 12:67823105-67823127 GAGCAATCCATGTACTCTCCTGG - Intergenic
1103160762 12:118727328-118727350 AAGAAAGCAAGGTACACACACGG - Intergenic
1103272930 12:119688449-119688471 CAGCATCGCAGGTACACACACGG - Intronic
1109340036 13:61044750-61044772 TTGCAATCCAGATACACTCATGG - Intergenic
1112590573 13:100760392-100760414 CAGCAATCCAGGTATGCCCAGGG + Intergenic
1115994798 14:39185147-39185169 TAGAACTACAGGTACACACATGG - Intergenic
1117749839 14:58910007-58910029 GGGCAATTCAGCTACACACAAGG - Intergenic
1120875239 14:89369106-89369128 GCGTTATCCAGGAACACACATGG + Intronic
1121039092 14:90730387-90730409 AAGCAACCCAGGGGCACACAGGG + Intronic
1121405051 14:93714649-93714671 GAGAAAGGCAGGTACACAGATGG + Intergenic
1122793115 14:104192763-104192785 CAGGGAGCCAGGTACACACAGGG - Intergenic
1126107912 15:45159056-45159078 GAGCAATCCAGGTAAAAGGAAGG + Intronic
1126497077 15:49303610-49303632 CAGGAAACCAGGTACATACAGGG - Intronic
1126651595 15:50928154-50928176 GAGGAATACAAGGACACACATGG - Intronic
1127777369 15:62276053-62276075 GAGCAATCAAGGGAGACAGATGG - Intergenic
1127970094 15:63951807-63951829 GTGAAAACCAGGCACACACACGG - Intronic
1131397490 15:92098099-92098121 GAGCAAGGCAGGTCCACAGAGGG + Intronic
1131508411 15:93035627-93035649 GAACAATCCAGAGACAAACACGG + Intronic
1132030954 15:98438216-98438238 GAGCAGTCAAAGGACACACATGG - Exonic
1136147580 16:28324435-28324457 GAGGAATCCTGGTACACAAAAGG - Intergenic
1138533548 16:57647808-57647830 AAGAAATCCAGACACACACAAGG - Intronic
1140033402 16:71355819-71355841 GAGCAAGCCAGGAAGACACGAGG + Intergenic
1143248361 17:5504110-5504132 GAGGAATCCTAGGACACACATGG + Intronic
1143358440 17:6348247-6348269 GGGCAAACCAGATTCACACATGG - Intergenic
1144359599 17:14479348-14479370 GACCTATGCAGGTGCACACATGG - Intergenic
1146483285 17:33222904-33222926 CAGGAATCCAGGATCACACAAGG + Intronic
1151174669 17:72277379-72277401 GAGCACACCAGGTTTACACAGGG + Intergenic
1151200470 17:72464166-72464188 GAACATCCCAGGTACCCACAGGG + Intergenic
1152058506 17:78051006-78051028 GGCCAATCCAGGTACAAACTGGG + Exonic
1159117152 18:64127780-64127802 TAGCAATGCAGAAACACACATGG - Intergenic
1159202607 18:65206697-65206719 AAGGAATGCAGGTACACAGAAGG + Intergenic
1166410415 19:42552801-42552823 GAGCAATGCAGGAGCATACATGG - Intronic
1166800249 19:45452240-45452262 CAGAAATCCAGAAACACACATGG - Intronic
1167881855 19:52465769-52465791 GAGAAAGCCAGGGACACAAATGG - Intronic
925337462 2:3108667-3108689 CAGCTATTCAGTTACACACATGG + Intergenic
926266593 2:11327972-11327994 GAGCAATCCAGGTACACACAAGG + Intronic
926853291 2:17224816-17224838 CAGCAATCTAGTTACACATATGG + Intergenic
926861856 2:17318158-17318180 GAGCAATCCTGTTAAACAGATGG - Intergenic
928516866 2:32052077-32052099 GAGGAAACCAGGTGCAAACAAGG - Intergenic
929951783 2:46416636-46416658 GAGCAAACCAGGAATAAACAGGG + Intergenic
932374209 2:71220915-71220937 GAGCAATCAAGGGAGACAGATGG - Intronic
935944116 2:108270463-108270485 CAGCAATCCAGCTGCACACTGGG - Intergenic
941016572 2:160364195-160364217 GAACAATCCAGGTAGCCAAAAGG - Intronic
1170437155 20:16342009-16342031 GAGCTCTCCAGGTACAGAAAGGG - Intronic
1172210364 20:33193631-33193653 GAGAAATCCAGGTAAGCACAAGG + Intergenic
1173418460 20:42879631-42879653 GAGCAAGGCAGGAACCCACAGGG + Intronic
1177906371 21:26975946-26975968 GAGGACTCCATCTACACACATGG + Intergenic
949228813 3:1726377-1726399 TAGCAATCGAGGTACACATGGGG + Intergenic
960543754 3:118888923-118888945 GAGCAATCCAGGTAGAAAGAAGG + Intergenic
968052315 3:195663515-195663537 GAGAAAGCCAGCTACTCACATGG - Intergenic
970034825 4:11721212-11721234 GAGCAATTGAGGTACAGCCAGGG + Intergenic
972601962 4:40580922-40580944 GAGCAATCTAGGCACAAACAAGG + Intronic
984912631 4:184688611-184688633 GAGCAATCCATGCACACAGCAGG + Intronic
985189565 4:187357486-187357508 GAGCATTTCAGGAACAAACAGGG - Intergenic
985975191 5:3414331-3414353 GAGCACTCCAGGTAGAGTCAGGG - Intergenic
989488448 5:42020904-42020926 AAGGAATCCAGGTAAACACTAGG + Intergenic
990519617 5:56566279-56566301 GAGCAAGCCATGTAGACACCTGG + Intronic
990919836 5:60950556-60950578 CAGCAAACGAGGTACAGACAGGG - Intronic
991356582 5:65775345-65775367 CAGGAACCCAGGTACACACACGG + Intronic
998999478 5:147904137-147904159 GGGCAACCCAGGTACTCAGAAGG + Intronic
1008390496 6:50946045-50946067 GAGCATTCCAGGTGCTGACAAGG + Intergenic
1010730530 6:79385944-79385966 GAGAAATCCTGGAACACCCAAGG - Intergenic
1014189649 6:118479393-118479415 GAGCATGCCAGGTACATAAAGGG + Intronic
1014486324 6:122003642-122003664 GAGAAATCCAGGTAGAAGCAGGG - Intergenic
1015398731 6:132764458-132764480 GAGTAATCCAGTTACACAGCAGG - Intergenic
1019583748 7:1784257-1784279 GATCAATCCAGCAGCACACAGGG - Intergenic
1025854078 7:65263313-65263335 GAGCAGTCCAGCTGCACACCTGG - Intergenic
1026195144 7:68166595-68166617 GAGGAAGCCAGTTACATACAAGG - Intergenic
1029186443 7:98742169-98742191 CAGCAGCCCAGGTACCCACATGG + Intergenic
1031795640 7:126171514-126171536 GAGCAATTCAAATACACATAAGG + Intergenic
1032406714 7:131661293-131661315 GAGCAAGGCAGGTACACATCAGG + Intergenic
1033058979 7:138087170-138087192 CAGCAATCAAGGTACACCCTTGG - Intronic
1033800954 7:144901633-144901655 GAGCAATTCATATACACTCAAGG + Intergenic
1035322129 7:158038235-158038257 GAGAAATATAAGTACACACATGG + Intronic
1037523479 8:19702637-19702659 GAGCATTCCAGGTGCATGCAGGG - Intronic
1046871850 8:119212730-119212752 GAGAATTCCAGGTAGAAACAAGG + Intronic
1050672580 9:8014482-8014504 GAGCAATCCACCTGCATACAGGG - Intergenic
1052994208 9:34541529-34541551 GAGAAAGCCAGGTAAACATAGGG + Intergenic
1193959100 X:87901418-87901440 GACCAAGCAAGGTACACACTGGG - Intergenic
1195432006 X:104799393-104799415 CAGCAATCCAGGTTTTCACAAGG - Intronic