ID: 926267117

View in Genome Browser
Species Human (GRCh38)
Location 2:11333917-11333939
Sequence GGTGAAGTAAAGATACCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926267117 Original CRISPR GGTGAAGTAAAGATACCTCA TGG (reversed) Intronic
900197390 1:1383556-1383578 GGTGAAGACAAGAACCCTCATGG + Intergenic
901970539 1:12904223-12904245 GGTGAAAAAAAAATACCTTATGG + Intronic
902014626 1:13297546-13297568 GGTGAAAAAAAAATACCTTATGG - Intergenic
902646954 1:17806287-17806309 AGTAATGTTAAGATACCTCAAGG + Intronic
903308660 1:22434144-22434166 GGTGAAGAAAAGATATTTCAGGG + Intergenic
909816238 1:79997871-79997893 GTTGAAGTTAAAATTCCTCAAGG - Intergenic
912688379 1:111785080-111785102 GGTGAAGTAAAGGTAGCTGTAGG + Intronic
914368878 1:147004966-147004988 CGTGAAGAAAAGAAAACTCAGGG + Intergenic
914464259 1:147912092-147912114 ACTGAAGTAAAGAGAGCTCAAGG - Intergenic
916841808 1:168608910-168608932 GGTGAAGTACAGATATTTTAGGG + Intergenic
922939767 1:229452217-229452239 GGGGAAATAAAGTTATCTCATGG + Intronic
924357531 1:243197731-243197753 GCTGAAGTAAACAACCCTCATGG + Intronic
924604001 1:245516643-245516665 GGTGAAGTAATGAGCCCGCAAGG + Intronic
1063195360 10:3736461-3736483 GGTGAAGTAAACATCACTGATGG - Intergenic
1068263461 10:54615948-54615970 GGTGAACTAAAAATATCACACGG + Intronic
1068289211 10:54980313-54980335 GATGAATTGAAGATACATCAAGG - Intronic
1071290738 10:84187269-84187291 GGTGAAGTAAGGATGCAGCAAGG + Intergenic
1074923269 10:118040648-118040670 GGTAAAGTAACTATACATCAAGG + Intronic
1075297580 10:121291868-121291890 GGTGAAGTAATGAGACAGCAAGG + Intergenic
1079572691 11:21964292-21964314 GCTGAACTGAAGATGCCTCAAGG - Intergenic
1080022697 11:27579924-27579946 GGTAATGGAAAGACACCTCATGG - Intergenic
1081615907 11:44591118-44591140 GGTGATGTCCAGATACCTCTGGG + Intronic
1083084442 11:60128320-60128342 GCTGAACTGAAGAAACCTCAAGG + Intergenic
1084330091 11:68425095-68425117 GGTGAAGTACAGGTACCTGCGGG - Exonic
1085844000 11:80044911-80044933 AGTGAAGTAAACTGACCTCAGGG + Intergenic
1088116688 11:106320404-106320426 GGTGAAGCCAAGAACCCTCATGG + Intergenic
1092520692 12:9269699-9269721 GGTGAAGAAAAGAACCCTCTTGG + Intergenic
1093335050 12:17894723-17894745 GCAGAAGTAAAGAGACATCAAGG + Intergenic
1093602737 12:21049501-21049523 GGAAAAGTAAAGATATCCCAAGG - Intronic
1094544183 12:31389099-31389121 GGTGAATTAAAGAAACCCAAGGG + Intronic
1095912346 12:47441470-47441492 GGTGGAGTAAAGGTATTTCATGG - Intergenic
1101539303 12:105650547-105650569 GGTGGAGCAAAGATACCTCTTGG + Intergenic
1104701929 12:130911839-130911861 AGTGATGTAATGTTACCTCAAGG + Intergenic
1105045163 12:132997077-132997099 GTTGAAGTACAGTTACATCAAGG + Intronic
1106001565 13:25728331-25728353 GGTGAAGTGAGGATACCTCATGG + Intronic
1111307765 13:86437754-86437776 TGTGAAGTATAGATACCTTTTGG + Intergenic
1111390348 13:87586472-87586494 GTTGAAATAAAGAAACCTTAAGG + Intergenic
1111407877 13:87833764-87833786 GGTGAATAAAAAATACCTCCAGG - Intergenic
1111990045 13:95107329-95107351 TGTGAAATAAAAACACCTCATGG - Intronic
1117214917 14:53540982-53541004 GATGATGTCATGATACCTCATGG + Intergenic
1117278241 14:54211493-54211515 GGGGAAGGAATGATACTTCAGGG + Intergenic
1118742078 14:68746992-68747014 GTTTATGTAAAGTTACCTCACGG - Intergenic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1120156898 14:81103149-81103171 GGTGAAGGAAAGAAAGGTCAAGG + Intronic
1123809975 15:23914669-23914691 GGTGAAGTAATGATGACACAGGG + Intergenic
1124440547 15:29682586-29682608 GGTGAAGCCAAGAACCCTCAGGG + Intergenic
1124782471 15:32649239-32649261 GGGGAAATAAATATACCTAATGG + Intronic
1125391850 15:39200866-39200888 TGTAAAGTAAAGATGCCTCCTGG - Intergenic
1125493982 15:40172749-40172771 GAGGAAATCAAGATACCTCATGG - Intronic
1126548554 15:49901314-49901336 GGTGAAATAAATTTACCTCTAGG - Intronic
1128209596 15:65886140-65886162 GCTGAACTAAAGAAGCCTCAAGG - Intronic
1128405951 15:67339081-67339103 GGTGAACCAAAAAGACCTCATGG - Intronic
1129388024 15:75206641-75206663 GGTCCAGTAAAGACTCCTCAGGG + Exonic
1133864874 16:9633187-9633209 GGTGAAGCCAAGAACCCTCATGG + Intergenic
1137849522 16:51725368-51725390 GTTTAAGTAAAGAATCCTCAGGG + Intergenic
1139089469 16:63627660-63627682 TGTGATGTAAAAATTCCTCATGG + Intergenic
1140636233 16:76917897-76917919 GGTGAAGTCAAGAATCCTCAGGG - Intergenic
1142661203 17:1430738-1430760 TTTGAAGTAAAAATACCTCAAGG + Intronic
1143180042 17:4979030-4979052 GGAGAAGAAAAGAAACATCAGGG - Intronic
1143462178 17:7110822-7110844 GGAGGAGTAAAGATCCCTGAGGG + Intronic
1143798768 17:9359991-9360013 GCGGAACTAAAGACACCTCAGGG - Intronic
1146390447 17:32417375-32417397 CTTGAATTAAAGATACCTCATGG - Intergenic
1146515354 17:33485058-33485080 GGTGAAGCCAAGAACCCTCATGG + Intronic
1146683948 17:34827826-34827848 GGTGAAATAAAAATATCTAAAGG + Intergenic
1153359090 18:4173757-4173779 AGTGAAGTAAACAGACCTGATGG + Intronic
1156539622 18:37896878-37896900 GCTGAAGTAAAGAAACTTTAAGG + Intergenic
1157923121 18:51734028-51734050 GTTGAAGTAACGATACCCCAGGG - Intergenic
1159323619 18:66887553-66887575 GAGGATATAAAGATACCTCATGG - Intergenic
1160135831 18:76270962-76270984 GGTGAAGAAAAGAGAAGTCAGGG - Intergenic
1160309188 18:77772862-77772884 GTTGTGGAAAAGATACCTCAGGG - Intergenic
1163372939 19:16912392-16912414 GGAGAAGTGAAGTGACCTCAAGG + Intronic
1164548668 19:29189776-29189798 GGTGAACTAAAGATGCCTCCAGG + Intergenic
1165309298 19:35020997-35021019 GGTGAGGGAAAGAGAGCTCAAGG + Intronic
1168210281 19:54885145-54885167 GGAGAAGTAAAAATACATTAGGG - Intronic
926267117 2:11333917-11333939 GGTGAAGTAAAGATACCTCATGG - Intronic
930686040 2:54309209-54309231 GGTTAAGTATACATACCACATGG - Intergenic
933503571 2:83147596-83147618 GGTGAAGACAAGAGCCCTCATGG + Intergenic
935883083 2:107586254-107586276 GGTGAAGAAAAGATAAATAAAGG - Intergenic
940214043 2:151286486-151286508 GGTGAACTGAAGATGGCTCAAGG + Intronic
940321863 2:152385930-152385952 GGTGAAAGAAAGATAAATCAAGG - Intronic
942121075 2:172778085-172778107 AGTGAAGTAAAGACACCTGTAGG + Intronic
946098799 2:217301114-217301136 GCTGAAGGAAAGATGGCTCAAGG + Intronic
947197385 2:227582561-227582583 GTTGCAATAAAGATACCTAAAGG + Intergenic
947291090 2:228574583-228574605 GGTAAACTAAAGATGCCTCATGG + Intergenic
1169524504 20:6408777-6408799 GGTGAAATAAATAGACTTCAAGG - Intergenic
1170370148 20:15639641-15639663 GGTGATGGAGAGATACTTCAGGG - Intronic
1173192692 20:40888121-40888143 GGTGAAGAAAAGAAACCCCTTGG - Intergenic
1174498496 20:50966612-50966634 GGGGAAGTCAAGATGCCTCAGGG + Intergenic
1174707418 20:52670610-52670632 GGTGAAGCCAAGAACCCTCATGG + Intergenic
1177196213 21:17906064-17906086 AGTGAAGTGAAGCTACCTAAAGG + Intronic
1177310094 21:19379504-19379526 GTTAAAATAAAGATCCCTCAAGG + Intergenic
1178260616 21:31096949-31096971 GGTGACGTAGAGATAACACACGG - Intergenic
1180035311 21:45245344-45245366 GGTGATGTTAAGATATCACAAGG + Intergenic
1183113563 22:35671257-35671279 GGCAAAGTAAAGAAAACTCATGG - Intergenic
1184391947 22:44207760-44207782 GGTGAAGGGAAGACCCCTCAAGG - Exonic
950215142 3:11153890-11153912 GGGGAACTAAAGAGACCCCAGGG - Intronic
953051841 3:39351461-39351483 GGTGAAGTGAAGTTATCTCAAGG - Intergenic
955781212 3:62486662-62486684 GGTGAAGCCAAGAACCCTCATGG - Intronic
955884289 3:63581118-63581140 GGTAAAGAAAGGATCCCTCAGGG + Intronic
956488367 3:69745357-69745379 GGTGAGGGAAAGAGAACTCATGG + Intronic
958740613 3:98065990-98066012 GGTGAGGCAAACATACCTCCAGG + Intergenic
960498738 3:118409169-118409191 GTTGAAATAAAGATACATCATGG - Intergenic
961010415 3:123432021-123432043 TGGGAAGTAAAGGTACGTCAAGG - Intronic
963542815 3:146615978-146616000 GTTGAAGTAAAGAACTCTCATGG + Intergenic
963583555 3:147156044-147156066 GGTCAAGTAAAGACACGTCCTGG + Intergenic
965119056 3:164526635-164526657 GGAAAAGTAAAGCTACTTCAGGG + Intergenic
965318882 3:167226783-167226805 GGTTAAGTAAAGACACATGATGG - Intergenic
967652931 3:192008720-192008742 GGTGAAATAAAGAGATATCAAGG + Intergenic
967931655 3:194694593-194694615 TGGGAATTAAATATACCTCATGG - Intergenic
968276340 3:197443269-197443291 GATGAAGGAAAGATTCCTTATGG + Intergenic
970326486 4:14930260-14930282 GATGAAGAGAAGGTACCTCAGGG - Intergenic
972970068 4:44563691-44563713 GGAGAAGTAAAGATACATGTAGG + Intergenic
976786546 4:88827637-88827659 GGAGGAGTAAAGATGACTCATGG - Intronic
979244278 4:118481749-118481771 GCTGAAGTAAACAACCCTCATGG - Intergenic
980045015 4:127977879-127977901 TGTGTAGTAAAGATACTTAAAGG + Intronic
982950753 4:161692669-161692691 CGTGAAGTAGAGGGACCTCAGGG + Intronic
984670336 4:182477031-182477053 TTTGAAGTAAAAATATCTCACGG - Intronic
985701455 5:1375652-1375674 GGTGAAGTCAAGAACCCTCCCGG + Intergenic
986388291 5:7261022-7261044 GGTGAAGAAATGATACCAAATGG + Intergenic
987761418 5:22167328-22167350 GCTGAAAGAAAGATACCCCAGGG + Intronic
987798762 5:22666038-22666060 GATGTCTTAAAGATACCTCAAGG + Intronic
989311307 5:40021921-40021943 GGTGAAGCCAAGAACCCTCATGG - Intergenic
989539576 5:42603510-42603532 AGAGAAGTAAAGATAGCTTAAGG - Intronic
990032031 5:51273173-51273195 AATGAAGTAAAGAAACCACAAGG + Intergenic
991896211 5:71400796-71400818 GCTGAAAGAAAGATACCCCAGGG + Intergenic
992558204 5:77924153-77924175 GGTGAGTTAAAGATGCCTCAGGG - Intergenic
992979428 5:82152678-82152700 GGTGAAGGAAAAATATTTCAAGG - Intronic
995636085 5:114192529-114192551 GCTGGATTAAAGATGCCTCAGGG + Intergenic
998649126 5:144098124-144098146 GGTGAAATTAAAATGCCTCAAGG - Intergenic
1003342108 6:5231465-5231487 AGTGAAGTAAAGTTAGCTGATGG - Intronic
1003935625 6:10972595-10972617 GGTGTAGAAAAGATACCTAGAGG - Intronic
1004071429 6:12301442-12301464 GGAGAAGTAAAAAGACCTTAAGG + Intergenic
1005859131 6:29887964-29887986 GGTGGTGTAGAAATACCTCATGG - Intergenic
1008221806 6:48863373-48863395 GCTGAACTAAAGAAGCCTCAAGG + Intergenic
1008225933 6:48916794-48916816 GGTAATGTAAACATTCCTCAGGG - Intergenic
1010229772 6:73523829-73523851 GCGGAAGAAAAGTTACCTCAAGG - Intergenic
1011982861 6:93405488-93405510 TGCTAAGTAAAGAAACCTCATGG - Intronic
1014050352 6:116945599-116945621 GGTGAAGTACAAATAACTCACGG + Intergenic
1014872834 6:126617228-126617250 AGTGAAGTAAGGATGCCTCTGGG + Intergenic
1015479583 6:133692925-133692947 GGTGAAGAAAAGAAACATGATGG + Intergenic
1016672874 6:146729177-146729199 GGTGAAGCAAAGAGACTTCCTGG + Intronic
1017892761 6:158652852-158652874 TGTGAAGTAGAGATATCTGAGGG + Intronic
1018305056 6:162446140-162446162 GATGCTGTGAAGATACCTCAGGG - Intronic
1020685411 7:11287705-11287727 GGTGAAGTAAAAATAGTCCAAGG + Intergenic
1020763828 7:12297046-12297068 GTTGAACTGAAGAAACCTCAAGG + Intergenic
1023712859 7:43013353-43013375 TGTGATGTAAAGATAGCCCAGGG + Intergenic
1028732105 7:94162879-94162901 GGTGAAGGACAGAATCCTCATGG + Intergenic
1031247620 7:119337046-119337068 GGTGAAGCAAAGAAACTTCCTGG - Intergenic
1031941303 7:127792505-127792527 GGTGAAGAAAAGAACCCTAAGGG + Intronic
1032972379 7:137179585-137179607 GGGGAAGTAAGGATAGCTAATGG + Intergenic
1033044910 7:137953164-137953186 GATGAAGTCAAGAGACATCAAGG - Intronic
1033722642 7:144077956-144077978 GGGGAAGCAAACATAGCTCAGGG + Intergenic
1034789699 7:153957143-153957165 GCTGAAGTAAAATAACCTCAGGG + Intronic
1036783984 8:11673186-11673208 GGAGAAATAAAAATACCTGACGG + Intergenic
1037011781 8:13852258-13852280 GGTAAAGTAAAATTCCCTCAGGG - Intergenic
1038223381 8:25631918-25631940 GGTGAAGCCAAGAAACCTCGTGG - Intergenic
1039419845 8:37427389-37427411 GGTGAAGTCAAGAAACATGAAGG + Intergenic
1040303594 8:46200745-46200767 GGAGAAGCGAAGATACCGCAAGG + Intergenic
1040306008 8:46212196-46212218 GGTGAAGCAATGATACCACTGGG + Intergenic
1050399533 9:5236769-5236791 GCTGAACCAAAGATACCTGAGGG + Intergenic
1054842280 9:69756234-69756256 GGTGAAGAAAAGCTGGCTCAAGG - Intronic
1057822339 9:98342315-98342337 GGAGAAGTAACAATAGCTCAGGG + Intronic
1059918941 9:119136331-119136353 TGTGAAGTCAAGATGCCTCAGGG + Intergenic
1062139845 9:134949896-134949918 GGTGAAGTAAAGAATCCTTGGGG - Intergenic
1187248536 X:17575631-17575653 GGGGAAGTAAAGAGAAATCAAGG - Intronic
1188868723 X:35347475-35347497 GGAGAAGGAAAGAGTCCTCAAGG + Intergenic
1189863434 X:45297408-45297430 GCTGAGCTAAAGAAACCTCAAGG - Intergenic
1191640319 X:63424491-63424513 GGTGAAGAAAAAATACTGCAGGG + Intergenic
1194457823 X:94126142-94126164 GGAGAGGTAAAGAAACCTGATGG - Intergenic
1195804153 X:108743779-108743801 TTTGAAATAGAGATACCTCAAGG + Intergenic
1196316786 X:114236017-114236039 AGCTAAGTAAAGATACCTAATGG - Intergenic
1199323351 X:146467754-146467776 AGTCACGTAAAGATACCTCATGG - Intergenic
1200986336 Y:9306065-9306087 GGAGAAGCAAAGAGTCCTCATGG + Intergenic
1202124242 Y:21554837-21554859 GGAGAAGCAAAGAGTCCTCATGG - Intergenic
1202154766 Y:21874543-21874565 GGAGAAGCAAAGAGTCCTCATGG + Intergenic