ID: 926268162

View in Genome Browser
Species Human (GRCh38)
Location 2:11344604-11344626
Sequence CCGCGCGGGAGTGTGTGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926268162_926268165 -9 Left 926268162 2:11344604-11344626 CCGGCGCACACACTCCCGCGCGG 0: 1
1: 0
2: 1
3: 13
4: 92
Right 926268165 2:11344618-11344640 CCCGCGCGGCCGCCCGTCTCCGG 0: 1
1: 1
2: 1
3: 16
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926268162 Original CRISPR CCGCGCGGGAGTGTGTGCGC CGG (reversed) Intronic