ID: 926273459

View in Genome Browser
Species Human (GRCh38)
Location 2:11385670-11385692
Sequence TAGGAGAAAGAGCATGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926273459_926273461 -8 Left 926273459 2:11385670-11385692 CCTCCTACATGCTCTTTCTCCTA No data
Right 926273461 2:11385685-11385707 TTCTCCTACAGATAATTTTTTGG No data
926273459_926273462 -7 Left 926273459 2:11385670-11385692 CCTCCTACATGCTCTTTCTCCTA No data
Right 926273462 2:11385686-11385708 TCTCCTACAGATAATTTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926273459 Original CRISPR TAGGAGAAAGAGCATGTAGG AGG (reversed) Intergenic
No off target data available for this crispr